ID: 1168632342

View in Genome Browser
Species Human (GRCh38)
Location 19:57967336-57967358
Sequence GTTTTTTAACATGTGAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 338}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168632340_1168632342 12 Left 1168632340 19:57967301-57967323 CCTGGAGGAGTCTAAGGGATCGA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1168632342 19:57967336-57967358 GTTTTTTAACATGTGAACACTGG 0: 1
1: 0
2: 1
3: 34
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168632342 Original CRISPR GTTTTTTAACATGTGAACAC TGG Intronic
902303843 1:15522414-15522436 CTTTTTTAAGATGTGAAAGCTGG + Intronic
904195793 1:28784555-28784577 TTTTTTTAACATGATAACAACGG - Intergenic
907228443 1:52971535-52971557 TTTATTTAACGTGTGTACACGGG + Intronic
909224508 1:73000546-73000568 GTATTCAAACATTTGAACACAGG - Intergenic
910473986 1:87587002-87587024 ATTTTTTAACATGGGAACATAGG - Intergenic
912006943 1:104915911-104915933 GTTGTTTAAAATGAGAACCCAGG + Intergenic
914807790 1:151004231-151004253 GTCATTTTAGATGTGAACACCGG + Intronic
917594253 1:176512832-176512854 TTTTTTTAATTTGTAAACACAGG - Intronic
919212285 1:194503185-194503207 GTTTTTTAAAATGTGGAGATGGG + Intergenic
919264587 1:195245624-195245646 ATTTTTTAAAGTGTGAACTCTGG - Intergenic
919836310 1:201576026-201576048 GTTTTGCAAGATGTTAACACTGG - Intergenic
920755162 1:208722869-208722891 TTTTTTTAAACTGTCAACACAGG + Intergenic
922544385 1:226444999-226445021 TTTGTTTAACATGTATACACAGG + Intergenic
923653054 1:235891803-235891825 GTTATGTAAGATGTCAACACTGG + Intergenic
924386681 1:243505401-243505423 GTTTTTTAAACTCTGAACATAGG + Intronic
1062892169 10:1071692-1071714 ATTTTTAAAAATGTGGACACTGG + Intronic
1063089412 10:2849021-2849043 GTATTGTAAAATGTGCACACTGG - Intergenic
1063189544 10:3680461-3680483 GGGATTTAACATGTTAACACAGG - Intergenic
1064145846 10:12825833-12825855 TTTTTTTAACATGTAATCACTGG + Intronic
1064606323 10:17044593-17044615 GATTTTTAACAAATGAACAATGG + Intronic
1064853674 10:19739875-19739897 ATTTATTATCATGTGAAAACTGG - Intronic
1067056106 10:43051821-43051843 GTTTTGTAAGATGTTACCACTGG + Intergenic
1067074051 10:43162813-43162835 CTTCTCTAACATGTTAACACAGG + Intronic
1071688551 10:87790108-87790130 GTATTTTAACATGTAAATACAGG + Intronic
1072455601 10:95572919-95572941 TTTTTTTAACATTTGAAGAAGGG - Intergenic
1073676916 10:105658422-105658444 GTTTTTTAAATTGTTAACTCAGG + Intergenic
1073965306 10:108982122-108982144 TCTGTTTAAGATGTGAACACAGG + Intergenic
1074046598 10:109844974-109844996 GTTTCTTTACCTGTAAACACAGG - Intergenic
1074180210 10:111055386-111055408 GTCTTTCAATATATGAACACAGG + Intergenic
1074261746 10:111860984-111861006 GTGCTTTGACATGTGCACACTGG - Intergenic
1074827900 10:117228099-117228121 GGATTTTAACATATGAACAGGGG + Intergenic
1075162071 10:120033175-120033197 TTTATTTAACATGTATACACGGG - Intergenic
1075372234 10:121947031-121947053 GTATTTCAACATTTCAACACTGG + Intergenic
1076097358 10:127742507-127742529 GTGTTTTAAAAAGTGAACATTGG + Intergenic
1076942799 10:133621046-133621068 GTTTTTTATCTTGTGATCATTGG - Intergenic
1078868739 11:15324451-15324473 CTATTTTAACATGTTAACAGAGG - Intergenic
1079305248 11:19315949-19315971 TTTATTTAACATGTGTACATGGG + Intergenic
1080041678 11:27765811-27765833 ACTTTTTAACATTTGAACTCTGG - Intergenic
1080796957 11:35573763-35573785 TTTATTTAACATGTGTTCACAGG + Intergenic
1083807874 11:65085849-65085871 GTATGTGAACATATGAACACAGG + Intronic
1085846437 11:80071267-80071289 GTATTTTAACATATGAACTTGGG - Intergenic
1087463593 11:98475983-98476005 GTTTTCTACCAAGTAAACACAGG + Intergenic
1088057780 11:105606312-105606334 ATTTTTTAACATTTAAGCACAGG - Intergenic
1088439005 11:109847586-109847608 GACTTTTAAAATGTGTACACTGG - Intergenic
1088973405 11:114793390-114793412 GATTTTTAACTTGTGGACAAGGG - Intergenic
1089037317 11:115408190-115408212 TTATTTTTACATGTGAACACTGG + Intronic
1090524247 11:127512907-127512929 GTCTTCTAACCTGTGAACATGGG + Intergenic
1091115742 11:133011492-133011514 GTTTTATAGCATGTCAACTCTGG - Intronic
1092068560 12:5613608-5613630 GGATTTCAACAGGTGAACACAGG - Intronic
1093501083 12:19813254-19813276 GTTATGTAACATGTGACCATTGG - Intergenic
1094567096 12:31609411-31609433 GTATTTTAAAATGTTATCACTGG + Intergenic
1094583441 12:31755551-31755573 TTTATTTAACATGTATACACAGG + Intergenic
1094808973 12:34119381-34119403 GGTTTTTAACAACCGAACACTGG + Intergenic
1095328318 12:40925314-40925336 GATTTTTAAATTGTGAAAACAGG - Intronic
1095684521 12:45017351-45017373 TTTTTTTAACATGTGAAATGAGG - Intronic
1095776974 12:46020498-46020520 GTTTTTTGAGATGTGAACTTAGG + Intergenic
1095809979 12:46362962-46362984 GTTTTTAGACATGTGAATATTGG - Intronic
1096776487 12:53967394-53967416 GTTTTTTATGATGAAAACACAGG - Intergenic
1097553493 12:61106365-61106387 GTCATTCAGCATGTGAACACTGG + Intergenic
1097602281 12:61707768-61707790 GTTTTGTAAAATGTTATCACTGG + Intergenic
1098473467 12:70872277-70872299 GTTATTGAGCATGTGGACACTGG + Intronic
1099472010 12:83062085-83062107 GATTTTTATCACTTGAACACCGG + Intronic
1099802133 12:87470765-87470787 TTTATTTAACTTGTGTACACAGG - Intergenic
1102355982 12:112236136-112236158 TTTATTTAACATGTATACACAGG + Intronic
1102532923 12:113560028-113560050 CTTTCTTTACATTTGAACACAGG + Intergenic
1102762507 12:115400637-115400659 ATTTTATCACATGTAAACACAGG + Intergenic
1105650183 13:22369106-22369128 TTTATTTAACATGTGTACCCAGG + Intergenic
1105953663 13:25258461-25258483 ACTTTTTAAAATGTGACCACTGG + Intronic
1106714772 13:32376189-32376211 TTTTTTAAACATGAGTACACTGG + Intronic
1106974380 13:35189775-35189797 GTTATTTAAAATAAGAACACTGG + Intronic
1107510986 13:41084731-41084753 TTTTCTCAACATGTTAACACTGG + Intergenic
1107518145 13:41151989-41152011 TTTATTTAACATGTATACACAGG - Intergenic
1109123977 13:58495094-58495116 GTTTTTTAAAAGGTGAACAATGG + Intergenic
1109204991 13:59472944-59472966 GTCTTTTAACCCATGAACACGGG - Intergenic
1109452358 13:62534097-62534119 GCATTTTATCATTTGAACACTGG - Intergenic
1110360838 13:74623404-74623426 AATTTTTAAAATGTGACCACTGG - Intergenic
1110386087 13:74912427-74912449 GTTTTGTAAAATGTCACCACTGG + Intergenic
1110939523 13:81331328-81331350 GTTTTTTTAAATGTGAGCATGGG + Intergenic
1111229318 13:85321688-85321710 TTTTTTTAACATATCAACAATGG + Intergenic
1112103885 13:96219245-96219267 ATTTTGTAACATGTGTACATTGG + Intronic
1112478511 13:99753254-99753276 GGTTTTTAATGTGAGAACACTGG + Intronic
1115081840 14:29462714-29462736 GTTTAATAACAGGTGAACACTGG - Intergenic
1115282662 14:31681803-31681825 GTTGTTTAATATCTGAACATTGG + Intronic
1115554851 14:34536934-34536956 GTTTTGTAGTATGTTAACACTGG + Intronic
1116478004 14:45364403-45364425 GTTTTTTAACATGAGTCCAGGGG - Intergenic
1116491257 14:45506154-45506176 GCTTTCTAAAAGGTGAACACTGG + Intergenic
1117644187 14:57833956-57833978 TTATTTTAACATGTGAAGAGAGG - Intronic
1118455696 14:65944187-65944209 GTTTTTTATCATGAGATCCCTGG + Intergenic
1118546659 14:66897142-66897164 GTTTTGTAAGATGTTACCACTGG - Intronic
1119752233 14:77087686-77087708 TTTATTTAACATGTGTACACAGG + Intergenic
1119889409 14:78171723-78171745 TTTTTTTAACAAGTAATCACAGG - Intergenic
1120086630 14:80283005-80283027 GCTTTTTAACATGTGAATTGTGG - Intronic
1120634369 14:86932894-86932916 GTTATATAAGATGTTAACACAGG - Intergenic
1121853856 14:97248428-97248450 GTTTGTTAACAGGTGCACAAAGG - Intergenic
1123126524 14:105950674-105950696 GTTTTGTAACATGTCTACATAGG + Intergenic
1123407038 15:20026777-20026799 GTTTTGTAACATGTCTACATAGG + Intergenic
1123516369 15:21033433-21033455 GTTTTGTAACATGTCTACATAGG + Intergenic
1123773280 15:23550702-23550724 GTCTTTCAACCTGTGAACATGGG + Intergenic
1124231104 15:27947148-27947170 TTCATTTAACATGTGTACACAGG - Intronic
1126721229 15:51582516-51582538 GATTTTTCATATGTCAACACTGG - Intronic
1127423364 15:58830878-58830900 GTTTGTGGACATGTGAAGACTGG - Intronic
1128401058 15:67281332-67281354 TTTATTTAACATGTATACACAGG + Intronic
1129800251 15:78408427-78408449 AAGTTTTAACATGTGAACACAGG - Intergenic
1133105335 16:3504304-3504326 GTGTTTTAAAATGTTAACAGTGG - Intronic
1133237906 16:4396675-4396697 GTTTTTCAAAATATGAAAACAGG - Intronic
1135877929 16:26221611-26221633 ATTTTTTAACATGTAAAAATAGG - Intergenic
1136715894 16:32281030-32281052 CTTTTTTAAAATTTAAACACAGG - Intergenic
1136752018 16:32648735-32648757 CTTTTTTAAAATTTAAACACAGG + Intergenic
1136822570 16:33331731-33331753 CTTTTTTAAAATTTAAACACAGG - Intergenic
1136829133 16:33388270-33388292 CTTTTTTAAAATTTAAACACAGG - Intergenic
1136834199 16:33487052-33487074 CTTTTTTAAAATTTAAACACAGG - Intergenic
1139710636 16:68773135-68773157 GGTTTGTAACATGTGAACTGAGG + Intronic
1141375354 16:83525383-83525405 CTTTTTAACCATGTGACCACAGG - Intronic
1141957401 16:87382303-87382325 GTTTTTTAAAATGTTAAGAGTGG + Intronic
1203010717 16_KI270728v1_random:237468-237490 CTTTTTTAAAATTTAAACACAGG + Intergenic
1203054160 16_KI270728v1_random:908721-908743 CTTTTTTAAAATTTAAACACAGG + Intergenic
1143604275 17:7972570-7972592 GTTTTGTAATATGTTACCACTGG + Intergenic
1146115194 17:30130457-30130479 GTTTTTCAACATGTGCTCATTGG + Intronic
1149797946 17:59538715-59538737 GTTATGTAACATGTTAACACTGG - Intergenic
1149902136 17:60490279-60490301 GTTATATAATATGTGACCACTGG + Intronic
1150603157 17:66668012-66668034 GTTTCTTAACACTTGACCACTGG - Intronic
1152996692 18:414106-414128 GTTTTGTAAGATGTTACCACTGG + Intronic
1153127998 18:1818910-1818932 TTTATTTAACATGTATACACAGG - Intergenic
1153245413 18:3068328-3068350 GTTTTGTAAAATGTTACCACTGG - Intronic
1154226473 18:12509376-12509398 GTTTGCTAACTTCTGAACACTGG + Intronic
1155795891 18:30035881-30035903 TGTTTTTAAAATGTGAAGACAGG + Intergenic
1156248408 18:35326404-35326426 TTTATTTAACATGTATACACGGG + Intergenic
1156276388 18:35586949-35586971 ATTTTTCAATCTGTGAACACAGG + Intronic
1156741201 18:40330859-40330881 GTTTTTTAACATGTGTGCCAAGG - Intergenic
1157672945 18:49545778-49545800 GTTTTTTAACATGATAACATTGG - Intergenic
1157752068 18:50188045-50188067 GTTATATGACATGTTAACACTGG + Intronic
1158115626 18:53992120-53992142 GTTTTGTAATATGTATACACTGG - Intergenic
1158306262 18:56109487-56109509 GTTTTCTGCCAGGTGAACACTGG + Intergenic
1158450172 18:57557153-57557175 GTTGTGTAAGATGTTAACACTGG + Intronic
1159473325 18:68884261-68884283 TTTTTTTCATAAGTGAACACTGG - Intronic
1162918736 19:13888220-13888242 TTTTTTTAACATCTCAACACAGG + Intronic
1164475251 19:28570605-28570627 GATTTTGGACATGAGAACACAGG - Intergenic
1164996953 19:32728006-32728028 GTTTTGTAACAAATGAGCACTGG - Intronic
1166416671 19:42600303-42600325 GGTTTAAAACAAGTGAACACTGG - Intronic
1167554149 19:50182620-50182642 ATTTTTAAAAATGTGAGCACTGG + Intergenic
1168604539 19:57747865-57747887 GTTTTTTGATATGGGAACCCTGG + Intronic
1168632342 19:57967336-57967358 GTTTTTTAACATGTGAACACTGG + Intronic
925013286 2:502398-502420 GTTTTTGCAAATGAGAACACTGG - Intergenic
925256014 2:2489043-2489065 ATTTTTTATTATGTGAAAACAGG + Intergenic
926417702 2:12666131-12666153 GTTTTGTAACATGTTACCACTGG - Intergenic
926804838 2:16698436-16698458 GTTTTTTAACTTTTGAATAATGG - Intergenic
926915451 2:17886879-17886901 CTCTTTTAAGATGTGAACATAGG + Intronic
928556375 2:32430202-32430224 ATTTTTTAAAATGGGAACAATGG + Intronic
929730402 2:44485260-44485282 ATTTTTTAATAGCTGAACACTGG + Intronic
929876201 2:45798865-45798887 GTTTTTTAAAATGTGAGCATTGG + Intronic
930366969 2:50451748-50451770 TCTTATTAACATGAGAACACAGG + Intronic
930944303 2:57053278-57053300 TTTTTTTAACTTGAGAAGACTGG + Intergenic
931023750 2:58083391-58083413 TTGTTTTAAAATGTGAACACTGG + Intronic
931660515 2:64557712-64557734 GTTTTCCATCCTGTGAACACTGG + Intronic
932784579 2:74588668-74588690 GGTTATCAACATGTGAACTCAGG + Intronic
933390170 2:81657485-81657507 GTGTTTTAACATGAGACCTCAGG + Intergenic
933511553 2:83246608-83246630 GTTTTTTGACAAATGCACACAGG - Intergenic
935829169 2:106982005-106982027 GTTATATAACATGTTACCACTGG - Intergenic
936273033 2:111066510-111066532 GTTTTTTAAGATGTTACCATTGG + Intronic
936376227 2:111943560-111943582 GCATTTCAACATGTAAACACCGG + Intronic
936602449 2:113911300-113911322 TTTTTTTAAAACGTGAACAGTGG + Intronic
937007419 2:118530020-118530042 GTTTTTTCACATGTAAATAAGGG - Intergenic
937154380 2:119708418-119708440 GTGTGTTAATTTGTGAACACGGG - Intergenic
938165936 2:129026936-129026958 TTATTGAAACATGTGAACACAGG - Intergenic
938874588 2:135519224-135519246 GTTTTCTAAGATGTTACCACTGG + Intronic
940049558 2:149447980-149448002 GTTTTTCAAAATGTCACCACTGG - Intronic
940747028 2:157578809-157578831 ATTTATTAACATGTTAACCCAGG - Intronic
941677095 2:168355427-168355449 GAATTTTAACATTAGAACACGGG - Intergenic
941957760 2:171221770-171221792 GTTTTTTTCCATGTGTACAGAGG - Intronic
944051127 2:195471145-195471167 GTTTTGTAAGATGTTAACAGAGG - Intergenic
944054383 2:195508231-195508253 GTCTGTAAACATGTGATCACTGG - Intergenic
944386109 2:199166644-199166666 GTTTGTTAATATGTGAATACTGG + Intergenic
944659037 2:201905062-201905084 GTTTTTTAGCAAGAGAACACTGG - Intergenic
944843713 2:203647542-203647564 GTTTTTGAACATGTCAACATTGG - Intergenic
948170605 2:235898745-235898767 GTTTTTAAAGATGTGGACATGGG + Intronic
948203738 2:236149455-236149477 GTTTTTTAAAGTGTGGACGCGGG + Intergenic
948308205 2:236965634-236965656 CTTTTTTAAGATGTGAGAACAGG - Intergenic
1170846219 20:19964179-19964201 GTGTTAGAAAATGTGAACACTGG + Intronic
1171074562 20:22109383-22109405 TTTTTAAAACATGTGAAAACCGG - Intergenic
1171142108 20:22752179-22752201 TTTTTTAAAGATGTGAAAACTGG - Intergenic
1172377636 20:34458063-34458085 GTTTCTTAACCTGAGATCACTGG + Intronic
1174399484 20:50268219-50268241 GTTTTTTAGAATCTGAACATGGG + Intergenic
1175200708 20:57275232-57275254 GTTTGTTATCATGTGAGCTCTGG - Intergenic
1176331745 21:5554494-5554516 TTTTTTTAACCTATGAACCCAGG + Intergenic
1176396012 21:6266457-6266479 TTTTTTTAACCTATGAACCCAGG - Intergenic
1176441145 21:6722647-6722669 TTTTTTTAACCTATGAACCCAGG + Intergenic
1176465407 21:7049716-7049738 TTTTTTTAACCTATGAACCCAGG + Intronic
1176488968 21:7431494-7431516 TTTTTTTAACCTATGAACCCAGG + Intergenic
1178166963 21:29990275-29990297 GTTATTTAAGATGTTAGCACTGG + Intergenic
1178220076 21:30646088-30646110 CTTTTTTAACTTTTGTACACTGG + Intergenic
1178835349 21:36092808-36092830 TTTATTTAACATGTGTACAAGGG - Intergenic
1179524321 21:41965841-41965863 GCTTTATAACATGTGCCCACAGG - Intergenic
1181691873 22:24567435-24567457 TTTTTTTAACATGTAAAGATGGG + Intronic
1181984897 22:26793341-26793363 GCATTTCCACATGTGAACACAGG - Intergenic
1182643172 22:31785490-31785512 GTCTTTCAACCTGTGAACACAGG - Intronic
1185320809 22:50199601-50199623 GTTTTGTGACGTGTGAACATGGG + Intergenic
949461128 3:4295862-4295884 GTTTTTTATCATATCAACAAGGG + Intronic
949691303 3:6643022-6643044 GTTTTTTAACATATGAATGTGGG + Intergenic
949867833 3:8561124-8561146 CTTTTTTGCCATGTGAAGACAGG - Intronic
950478746 3:13231592-13231614 GGGTTTTAACATGTGAACCTGGG + Intergenic
951667599 3:25144473-25144495 ATTTTTTAACTAGAGAACACGGG - Intergenic
951699440 3:25480200-25480222 GTGTAATAACATGTGAGCACTGG + Intronic
952398633 3:32943022-32943044 GTCTTCTAATACGTGAACACAGG + Intergenic
954016830 3:47700421-47700443 TTTTTTGAAAATGTGATCACTGG + Intronic
954406301 3:50347053-50347075 GTTTTTGAACATCTGACCTCAGG + Intergenic
956546173 3:70406118-70406140 GTTTTGAAATATGTGTACACTGG - Intergenic
957383030 3:79458519-79458541 ATTTTTTATCATGTGTTCACTGG + Intronic
957429012 3:80077384-80077406 GTTTAGTGACATGAGAACACAGG - Intergenic
957779562 3:84801341-84801363 GTTTTTTAACCTGTGTACTTGGG - Intergenic
959307191 3:104682988-104683010 GTTTCTTAATATCTGAAAACTGG + Intergenic
959360313 3:105381763-105381785 GTTTCTTAAAATATGATCACTGG - Intronic
959861423 3:111219778-111219800 GTTTTTCAAGATGTTACCACTGG - Intronic
960447423 3:117765059-117765081 ATTTTTGAACACGTGGACACAGG - Intergenic
961247947 3:125473071-125473093 GGTTTGTTACATGTGTACACTGG + Intronic
962509098 3:136080904-136080926 ATTTTTTAAAATATAAACACTGG - Intronic
962651373 3:137496801-137496823 GTTTTTTGACATTTTAATACTGG + Intergenic
962683730 3:137826195-137826217 GTTTTATAACATCTCAAAACTGG + Intergenic
963097104 3:141555312-141555334 GTTGTGTAAGATGTTAACACTGG + Intronic
963708979 3:148724277-148724299 GTATTTGAATATGTGAACCCTGG + Intronic
964694094 3:159487502-159487524 GCTTTTTTCCATGTGAACAGGGG + Intronic
965633707 3:170759454-170759476 ATTTTTAAACATGGGAAGACAGG - Intronic
969055615 4:4400565-4400587 GTTTTTCAATCTGTGAACACAGG + Intronic
969962899 4:10963904-10963926 GTTTATACACATGTGAACACAGG + Intergenic
970697656 4:18696854-18696876 TTTATTTAACATGTACACACAGG + Intergenic
970913054 4:21300898-21300920 GTTTTCTAAAATGAGAAAACTGG - Intronic
971099929 4:23454606-23454628 GTTTTATAAAATATGTACACTGG - Intergenic
972658183 4:41087191-41087213 GTGTTCTAATCTGTGAACACAGG - Intronic
972892818 4:43580235-43580257 GTTTTTTAGTCTATGAACACAGG + Intergenic
972974365 4:44615477-44615499 GCATTTTAAAATGTGAACACTGG - Intergenic
972978202 4:44663437-44663459 CTTTCTTAACAGGTGAACAGTGG - Intronic
974224982 4:59029078-59029100 GTTTTCTAATTTGTGAAAACTGG + Intergenic
974371976 4:61029170-61029192 CTTTTTTAACTTGTGAACATGGG + Intergenic
974558253 4:63480525-63480547 GTTTTATAAGATGTTACCACTGG + Intergenic
975044749 4:69787621-69787643 GTTTTGCAACATGTTACCACTGG - Intronic
975436189 4:74354807-74354829 GGATTTTAACATCTAAACACAGG + Intergenic
975464517 4:74694281-74694303 CTTTTTTAACATATAAACAAAGG + Intergenic
978749368 4:112230253-112230275 GTTTTGTAACATGTCACCACTGG - Intergenic
978896205 4:113890360-113890382 GTTTATTAGCATGTGGAGACGGG + Intergenic
980077555 4:128309670-128309692 GCTTTTTTTCATGTGATCACTGG + Intergenic
981174460 4:141665211-141665233 GTTTCTTAAAAAGTCAACACAGG - Intronic
981706055 4:147660150-147660172 GTTATTCAATATGTGAATACAGG - Intronic
981916255 4:150036650-150036672 GTTTGTTAACACATGAACAAGGG + Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982352997 4:154436465-154436487 ATTTTTTAACATGAAAACACAGG - Intronic
984365795 4:178799019-178799041 TTTTTTTAAAATGTGCACATAGG + Intergenic
984701458 4:182821231-182821253 TTTATTTAATATGTGTACACAGG + Intergenic
985101453 4:186462433-186462455 GTTTATTAACATGTGCACAGGGG - Intronic
988197161 5:28018902-28018924 CTTTATAAACATGTGAAGACAGG - Intergenic
989200837 5:38761586-38761608 GTTTTTTAAGATTTGAACTTAGG - Intergenic
989702743 5:44289810-44289832 GTTTTTCAAGATGTTACCACTGG + Intergenic
990070860 5:51781390-51781412 GTTTTTCAACATGTGGTCTCTGG + Intergenic
991105379 5:62836920-62836942 GTTTTGTAAGATGTTACCACTGG + Intergenic
992227057 5:74629150-74629172 GATTTTTAAAATGTCAAGACAGG - Exonic
993301524 5:86216940-86216962 ATTATTAAACATGTGAACAGTGG + Intergenic
993447782 5:88035830-88035852 GTTTTTCAACATCTGACCATTGG - Intergenic
993588521 5:89763280-89763302 GTATTTCTACATTTGAACACTGG - Intergenic
993593393 5:89823971-89823993 GTTTTTTAAGAGATGAACAGGGG + Intergenic
993701740 5:91126924-91126946 ATTTTCTAACATCTGAAGACAGG + Intronic
994924191 5:106092917-106092939 TTTTTTTAACATGTAAAAAAAGG + Intergenic
995409327 5:111836831-111836853 GTGTTTTAACTTGTGAAATCTGG + Intronic
996187357 5:120493550-120493572 GTTTTTCAAGATGTTACCACTGG - Intronic
996522887 5:124447162-124447184 GTTTTCTAAGGTGTGGACACTGG - Intergenic
997028646 5:130096519-130096541 GTTATGTAACATGTTAACAGAGG + Intronic
998427845 5:142044897-142044919 TTTATTTAACATGTATACACAGG - Intergenic
1000252829 5:159511470-159511492 GATTTATGACATATGAACACTGG - Intergenic
1000555626 5:162722152-162722174 GGTTCTTAACATTTGAACTCTGG - Intergenic
1001519492 5:172380991-172381013 GTGTTTTAACAAGTGAAGTCAGG - Intronic
1002768441 6:265154-265176 ACTTTTTAACATGTGAAAAGAGG - Intergenic
1002804563 6:560438-560460 GCTTTTTAAAATGTGATTACCGG - Intronic
1002830648 6:817381-817403 GTTTTTCAAAATGTTACCACTGG - Intergenic
1007360798 6:41353781-41353803 GTTTTTTAAAATGTAAACGGAGG + Intergenic
1008206611 6:48667703-48667725 GTTATTTAAGATGTCAACAGTGG + Intergenic
1008219467 6:48837882-48837904 TTTATTTAACATGTATACACAGG + Intergenic
1008326623 6:50189674-50189696 GTTTTCTAACACAGGAACACTGG + Intergenic
1009331495 6:62426741-62426763 ATTTTTTAAAATGGGAACACAGG - Intergenic
1011447842 6:87461957-87461979 GTTTGTTAACATGAGAAAGCTGG + Intronic
1011982463 6:93399189-93399211 GTGTTTTAAAATGAGAACAGTGG - Intronic
1012114639 6:95280873-95280895 GTTGCTTAACAAGTGACCACCGG - Intergenic
1013433485 6:110077816-110077838 GTTTGTTAAAATGTGACCAATGG + Intergenic
1013858947 6:114610349-114610371 TTTTTTAAACATATGAAAACAGG - Intergenic
1014856269 6:126405618-126405640 TTTTTCTAATATGTGAACATTGG + Intergenic
1015769384 6:136753280-136753302 CTTTTTTTTCAAGTGAACACAGG + Intronic
1016435582 6:144034143-144034165 GTGGTTTTACATGTAAACACAGG - Intronic
1017885857 6:158598971-158598993 GTTTTTAAACATGGGGACCCAGG + Intronic
1018625194 6:165771218-165771240 GTTTTTTAAAAAGTGAAATCTGG + Intronic
1019079531 6:169420836-169420858 TTTTTTTAATATGTGCCCACCGG + Intergenic
1019492092 7:1319052-1319074 GTGTGTTAACATGTGCACCCGGG + Intergenic
1020805784 7:12789053-12789075 GTTATGTAACATGTTAACACTGG + Intergenic
1022748078 7:33193138-33193160 GTTTGTTAACAAGTGAAAAATGG - Intronic
1024494472 7:50028866-50028888 GTCTTTTAATCTGTGAACACAGG - Intronic
1024497538 7:50065539-50065561 GGTTTTTAACAACTAAACACTGG + Intronic
1025634525 7:63310184-63310206 GTTTTTTATAAATTGAACACTGG + Intergenic
1025648172 7:63437990-63438012 GTTTTTTATAAATTGAACACTGG - Intergenic
1028432713 7:90766285-90766307 TTTTTTTCACCTGTGAAAACAGG + Intronic
1028586880 7:92460816-92460838 GAATTTTAACATGTCAACAGAGG + Intergenic
1029330738 7:99852410-99852432 GTTTTCTAATCTGTGAACACGGG + Intronic
1029362822 7:100099805-100099827 GCATTTTCACATATGAACACTGG - Intronic
1030003973 7:105096960-105096982 GTTTTTAAACACATGTACACTGG - Intronic
1030104612 7:105976422-105976444 GTTTTTTAAAATGAGAGCACTGG - Intronic
1030465926 7:109903760-109903782 GTTTTGTATCAGGTTAACACTGG + Intergenic
1030733339 7:113015946-113015968 GGTTTTCAAAATGTGATCACTGG + Intergenic
1030904042 7:115160639-115160661 GTTTCTTAACTTGTAAACAAAGG - Intergenic
1031111259 7:117612076-117612098 GTTTTTAAAACTGTGAAAACAGG - Intronic
1031507157 7:122599136-122599158 ATTTTTTAATGTGTGGACACAGG + Intronic
1031576964 7:123426638-123426660 GTTATTTGAGATGTTAACACTGG + Intergenic
1031828222 7:126593134-126593156 CTTTTTCAATCTGTGAACACAGG - Intronic
1033014147 7:137654546-137654568 TCTTTTCAACATGTGCACACTGG - Intronic
1033229574 7:139585757-139585779 CTTAGTTAACATGTGAAAACAGG + Intronic
1035712393 8:1728688-1728710 GCTTTTTAAAATTAGAACACTGG + Intergenic
1036178368 8:6561766-6561788 TTTTTTTCACATGTAAACATGGG - Intronic
1036535019 8:9640396-9640418 GATTTTTAACATATGAACTTTGG + Intronic
1037050624 8:14368100-14368122 TTTTTTTTAAATGTGTACACTGG + Intronic
1038053395 8:23834633-23834655 GTTTTTTAAAATGTGTATAAGGG - Intergenic
1039226586 8:35395196-35395218 GTTCTTTAAGATGTGAACATTGG - Intronic
1039778281 8:40758459-40758481 GTTCTTTAATACGTCAACACAGG - Intronic
1042442792 8:68847567-68847589 TTTATTTAACATGTATACACAGG - Intergenic
1042538762 8:69886286-69886308 GTTTTGTAAGATGTTACCACTGG + Intergenic
1042608483 8:70571531-70571553 GTTTTTTAAAATATATACACAGG - Intergenic
1042824203 8:72963718-72963740 TTTATTTAACATGTTTACACAGG + Intergenic
1043334088 8:79151482-79151504 GTTCTTTATCCTGGGAACACTGG - Intergenic
1044420499 8:91990542-91990564 GTTTTTAAACATATGATCAGTGG - Intronic
1044980505 8:97711557-97711579 GTTTTTTAACATGTTACCACTGG - Intronic
1045447624 8:102283740-102283762 GCTTTTGAACATGTGAGAACTGG - Intronic
1045958821 8:107942310-107942332 GGTTTTTAAAATGTTAACATGGG - Intronic
1046040556 8:108898405-108898427 GTCTTTTAATCTATGAACACAGG - Intergenic
1046050998 8:109022624-109022646 GTAATTTAACATGTTAACATGGG - Intergenic
1046230855 8:111355210-111355232 GTATTTTAAAATCTGAACCCTGG - Intergenic
1047448649 8:124942741-124942763 GTTTTTTCACTTGTGAAAATAGG - Intergenic
1048727537 8:137403679-137403701 GTTTTCTAGCATATGTACACAGG - Intergenic
1049082311 8:140452981-140453003 GTTTTGTAACATGGCACCACGGG + Intronic
1050043903 9:1523792-1523814 GTACTTTAACATGTAAACTCAGG - Intergenic
1050967024 9:11818032-11818054 GTTTTAACATATGTGAACACTGG - Intergenic
1051168595 9:14294480-14294502 GTTTTTAAACATATGTAAACTGG - Intronic
1051272573 9:15369649-15369671 GTTTATTAACATGTGTACATAGG + Intergenic
1051491282 9:17669188-17669210 GTTTTTCAAGATGTTACCACTGG - Intronic
1051963052 9:22791348-22791370 GTTTTGCAAAATGTTAACACTGG + Intergenic
1052039959 9:23727099-23727121 TTTATTTACCATGTCAACACTGG + Intronic
1052170901 9:25395187-25395209 TTTATTTAACATGTATACACAGG + Intergenic
1052352948 9:27475704-27475726 GTTTTCTGAAATGAGAACACTGG - Intronic
1053431651 9:38045754-38045776 GTTTTTTGACATGAGAACGTGGG + Intronic
1054928502 9:70612289-70612311 TTTTTATTACATGTGAAGACAGG + Intronic
1054984981 9:71251578-71251600 GTTTTTAAACATGGGTACATAGG + Intronic
1055519436 9:77065403-77065425 TTTATTTAACATGTGTACATAGG - Intergenic
1055857190 9:80703424-80703446 GTCTCTTAACATATTAACACAGG + Intergenic
1056016742 9:82396827-82396849 GTTTTTTCACATATGCCCACTGG - Intergenic
1056246630 9:84701850-84701872 GTGTTTTCACATATGTACACTGG + Intronic
1056567612 9:87788533-87788555 GTATTTTAATAGGTGAACATAGG + Intergenic
1057073598 9:92121905-92121927 GTTTTGCAAGATGTTAACACTGG - Intergenic
1057091433 9:92261649-92261671 GTTTTGCAAAATGTGACCACTGG + Intronic
1057491713 9:95525360-95525382 GTTCTTTAAAATGTGCATACAGG + Intergenic
1057625511 9:96672975-96672997 GTTATGTAAAATGTGAACACTGG + Intergenic
1057989666 9:99755408-99755430 TTTTTATAAAATGTGAAAACTGG - Intergenic
1058214059 9:102210961-102210983 GTCTATTAAAATGTAAACACTGG + Intergenic
1060156423 9:121323241-121323263 GTTATGTAAGATGTGAACATAGG - Intronic
1060349105 9:122842043-122842065 GTTATGTAACATGTTACCACTGG + Intergenic
1061677185 9:132224112-132224134 CTCTTTTAACAGTTGAACACTGG + Intronic
1203430354 Un_GL000195v1:85840-85862 TTTTTTTAACCTATGAACCCAGG - Intergenic
1186250522 X:7660926-7660948 TTTATTTAAAATGTGCACACAGG + Intergenic
1186615997 X:11188638-11188660 GTTTTTGTTCATGTGAAAACTGG - Intronic
1187909143 X:24094192-24094214 GTTTTGTAAGATGTTACCACTGG - Intergenic
1189030988 X:37450235-37450257 GTCATTTAACATCTGAACATCGG - Intronic
1189709900 X:43798876-43798898 GTTTTCTAGCATGTGAACTGTGG - Intronic
1190073870 X:47301279-47301301 TGTATTTAACATGTGTACACAGG + Intergenic
1192039607 X:67604569-67604591 GATTTGTAACATGCGATCACAGG + Intronic
1193910979 X:87306270-87306292 GTTTCCTAGCATGTGAATACTGG + Intergenic
1195744125 X:108097137-108097159 CTTTTTTAAAATGAGAAAACAGG + Intronic
1196256145 X:113521559-113521581 ATTATTTAACATGTATACACAGG - Intergenic
1196657900 X:118239001-118239023 GTTTTTTAAAATGAGAAATCAGG - Intergenic
1198801371 X:140451270-140451292 GTTTATAAACATCTGAACACTGG + Intergenic
1201227223 Y:11829925-11829947 GTTATTTAACATATTAAAACAGG - Intergenic
1201683177 Y:16671427-16671449 CTTTTTTGACATGTGAAAATTGG + Intergenic
1202233383 Y:22679321-22679343 GCTGGTTAACATGTGAAAACCGG - Intergenic
1202309773 Y:23516837-23516859 GCTGGTTAACATGTGAAAACCGG + Intergenic
1202561028 Y:26153756-26153778 GCTGGTTAACATGTGAAAACCGG - Intergenic