ID: 1168634412

View in Genome Browser
Species Human (GRCh38)
Location 19:57984433-57984455
Sequence CAGTTGTTTTCCATTCAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168634412_1168634415 14 Left 1168634412 19:57984433-57984455 CCAATCTGAATGGAAAACAACTG 0: 1
1: 0
2: 0
3: 21
4: 252
Right 1168634415 19:57984470-57984492 AAAAGTCCCCTCCATTAGAGTGG 0: 1
1: 0
2: 0
3: 5
4: 117
1168634412_1168634417 18 Left 1168634412 19:57984433-57984455 CCAATCTGAATGGAAAACAACTG 0: 1
1: 0
2: 0
3: 21
4: 252
Right 1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG 0: 1
1: 0
2: 0
3: 17
4: 89
1168634412_1168634416 15 Left 1168634412 19:57984433-57984455 CCAATCTGAATGGAAAACAACTG 0: 1
1: 0
2: 0
3: 21
4: 252
Right 1168634416 19:57984471-57984493 AAAGTCCCCTCCATTAGAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168634412 Original CRISPR CAGTTGTTTTCCATTCAGAT TGG (reversed) Intronic
902202519 1:14844637-14844659 GAGCTGATTCCCATTCAGATGGG - Intronic
903469212 1:23573852-23573874 GAGTTCTTTTCCATTCTGACTGG - Intergenic
904307648 1:29600487-29600509 CAGATGATTTCCATCCAGACTGG + Intergenic
906055421 1:42912380-42912402 CCTTTTTATTCCATTCAGATGGG + Intergenic
907860154 1:58345250-58345272 CAGTTGATTTTGATTCAGCTGGG - Intronic
908178047 1:61575483-61575505 CAGTTTTTGCCCATTCATATTGG + Intergenic
911130287 1:94380856-94380878 GATTTGTTTTCCATTCACACAGG - Intergenic
911932833 1:103926959-103926981 CAGGTGTCCTCCATGCAGATGGG + Intergenic
913525505 1:119688506-119688528 GAGATGTTATCCATTCAGTTAGG - Intronic
914434240 1:147646267-147646289 GAGGTGTCTTTCATTCAGATAGG + Exonic
915894979 1:159804810-159804832 CAATTGTTTTCCAGTGAGGTGGG + Intronic
916365815 1:164026578-164026600 CAGTTGATGTACATTTAGATTGG + Intergenic
917372785 1:174313611-174313633 CAGTTTTTCTCCATTCAGTATGG + Intronic
917753314 1:178074393-178074415 CAGAAGTATTCCATTCAGATTGG + Intergenic
918583443 1:186159519-186159541 CAGTTTTTGTCCATTCAGTATGG + Intronic
918926872 1:190797608-190797630 CAGTTGTTACCTATTCACATTGG - Intergenic
918946779 1:191076620-191076642 TAGTTTTATACCATTCAGATTGG - Intergenic
919351798 1:196466502-196466524 AAGTTATTTTCCATTTAAATGGG - Intronic
919702365 1:200643768-200643790 CAGTTGTTTTACCTTCTGCTTGG - Intronic
920228639 1:204455770-204455792 CAGTGGTATTACATGCAGATAGG + Intronic
921754250 1:218835104-218835126 CATTTGCTTCCCATTCTGATAGG + Intergenic
923260066 1:232259765-232259787 CATTTTTTTTCCTTTGAGATGGG - Intergenic
923449744 1:234105448-234105470 CAGTTGTTTCTCTTTCAGATGGG + Intronic
923808062 1:237282242-237282264 CAGATGTTTTCTATTCAGCTTGG + Intronic
924217197 1:241834879-241834901 CAGTTTCTTCCCATTCAGAGAGG + Intergenic
924840682 1:247707154-247707176 CAGTTTTTGTCCACTCAGAGAGG + Intergenic
1063431407 10:5992430-5992452 CTGTTGTTTTTCATTCATCTGGG - Intergenic
1063585387 10:7347644-7347666 AAGCTGTTTTCCATTTAGAGGGG - Intronic
1063859200 10:10289995-10290017 CATTTTTTTTTCTTTCAGATGGG - Intergenic
1064878361 10:20020992-20021014 CAGTTGTTTGCTATTCAGACAGG - Intronic
1065091573 10:22239969-22239991 TAGTTGTTCTCCTTTCTGATGGG - Intergenic
1066166934 10:32798548-32798570 CAGTTTTTGACCATTCAGAGAGG + Intronic
1066169524 10:32827001-32827023 CAGTTTTTGACCATTCAGAGAGG - Intronic
1066229569 10:33419289-33419311 CAGATGTATTCCATTCATGTGGG - Intergenic
1067941622 10:50661443-50661465 CAGAAGTCTTCCATTCAGCTTGG + Intergenic
1068984628 10:63095781-63095803 AACTTGTTTTCCTTACAGATGGG - Intergenic
1069014666 10:63415751-63415773 CAGTTGTTTTTCATTGTGTTAGG - Intronic
1071133774 10:82429205-82429227 CAGTTGTTTTTAAATCAGATAGG + Intronic
1071266986 10:83973324-83973346 CAGTTTTTGACCATTCAGAGAGG + Intergenic
1072569185 10:96643608-96643630 TAGGTGTTTGCCATTCAGATTGG - Intronic
1074880760 10:117655830-117655852 CAGTGATTTTCCATTGAGGTGGG - Intergenic
1078424958 11:11242102-11242124 CAGATGTTTTCCATTCTCTTGGG + Intergenic
1078523503 11:12082896-12082918 CAGTTTTTGTCCATTCAGTATGG + Intergenic
1078849793 11:15153273-15153295 CACATGGTTTCCATTCAGCTTGG + Intronic
1080515926 11:33020071-33020093 CAATTGTTTTCCCTTTAAATAGG + Intronic
1085268432 11:75252382-75252404 CAGTTCTGTTCCATTGATATAGG + Intergenic
1085360572 11:75881586-75881608 AAGATGTTTTCCTTTCACATTGG + Intronic
1086219113 11:84420343-84420365 CCACTGTTTTCCATTCAGAGTGG - Intronic
1087854930 11:103079997-103080019 CGTTTGTTTTCTATTCATATAGG - Intronic
1089903702 11:122014269-122014291 CAGTTTTTGGCCATTCAGAGAGG - Intergenic
1089994767 11:122895967-122895989 CATGTGTTTTCCATCCAGAAAGG + Intronic
1091480029 12:818416-818438 CACTTGTTTTACATACACATGGG - Intronic
1092588929 12:9932433-9932455 CTGATGTTTTCCATTTGGATTGG - Intergenic
1092774167 12:11927850-11927872 CAGTTGTTATCCCTACAGAGTGG + Intergenic
1094109485 12:26846476-26846498 CAGTATTTTTCCATTGAAATAGG + Intergenic
1094179095 12:27572082-27572104 CAGTGGGTTTCAATTCAGTTGGG - Intronic
1095630152 12:44366956-44366978 CAGCTGGTGTCCATTCTGATTGG - Intronic
1096911215 12:54986153-54986175 CAGTTGTTTTCCAATATGTTTGG + Intergenic
1098080055 12:66774386-66774408 CAGTTGTGTCACATTCATATTGG - Intronic
1098317277 12:69206065-69206087 CAGTTTTCTACCATTCAGAGTGG - Intergenic
1099183295 12:79491947-79491969 CAGTTTTTGACCATTCAGAGAGG + Intergenic
1099526451 12:83723751-83723773 CAGTTGTTGACCACTCAGAGAGG - Intergenic
1100701461 12:97153267-97153289 AAGCTCTTTTCCATTCATATTGG + Intergenic
1102160107 12:110761963-110761985 CAGTTTTCTTACATTCAGACTGG - Intergenic
1102341775 12:112127000-112127022 CAGTGGTTTACCATTGAGCTTGG + Intronic
1102798792 12:115713467-115713489 TAGCTGTTTGCCATGCAGATTGG - Intergenic
1103158610 12:118708475-118708497 CAGTTGTCTTCCATTTAAACAGG - Intergenic
1104147880 12:126053318-126053340 CAGTTTTTGACCATTCAGAGAGG - Intergenic
1107073961 13:36300753-36300775 CAGAGGTTTTCCATTCTGGTGGG - Intergenic
1109705124 13:66079662-66079684 CATTTGTTGCCCATTCAGAAAGG - Intergenic
1109808968 13:67483859-67483881 AATTTGTTTTGAATTCAGATAGG + Intergenic
1111611242 13:90610533-90610555 CAGTTGTATTCAATTAAGTTAGG + Intergenic
1112289547 13:98133025-98133047 AAGTTGTTTGCCAGTCTGATAGG - Intergenic
1112902389 13:104374134-104374156 CAAATGTTGTTCATTCAGATCGG + Intergenic
1113979363 13:114260783-114260805 GATTTGTTTTTCATTCACATGGG + Intronic
1116068181 14:40009824-40009846 CAGTTTTTTACCACTCAGAGAGG - Intergenic
1117561120 14:56939935-56939957 CACCTGTTTTCCATTCTTATGGG + Intergenic
1117834305 14:59786230-59786252 CAGAGGTTTTGCAGTCAGATAGG + Intronic
1118161289 14:63293104-63293126 CAGTTGATTTCCATTTATAAAGG - Exonic
1119371658 14:74150824-74150846 CAGTAGTTTTCCAGCCAGTTAGG + Intronic
1120129584 14:80789200-80789222 CAGTTTTTTTCCTGTCACATTGG - Intronic
1120498325 14:85262928-85262950 CAGTTTTTCACCATTCAGAGAGG + Intergenic
1202946857 14_KI270726v1_random:35780-35802 CAGTTTTTGTCCATTCAGTATGG + Intergenic
1123916355 15:25032514-25032536 CAGTTCTTTTCTTTTCATATTGG + Intergenic
1126453449 15:48835260-48835282 CAGGAGTTTTTCTTTCAGATGGG + Intronic
1126852025 15:52803232-52803254 AATTTGTTTTCCATTTGGATTGG + Intergenic
1126947846 15:53844070-53844092 CACTTCTTTTCCCTTCAGCTGGG - Intergenic
1128109881 15:65069454-65069476 CAGCAGTTGTCCATTGAGATTGG - Intronic
1130143366 15:81251982-81252004 CAGTTGTTTTCAAACCTGATAGG - Intronic
1131549036 15:93340560-93340582 CAATTGTTTTACATTCAGCCAGG + Intergenic
1131663813 15:94547794-94547816 CAGTTATTTTACATTCATTTGGG + Intergenic
1133193100 16:4149040-4149062 CATTTGTTTTCCTTACAAATAGG - Intergenic
1134453459 16:14377496-14377518 CAGATGTTTTCAATTCTGCTGGG - Intergenic
1135872679 16:26165381-26165403 CAGTAGTCTTTCATTCATATGGG + Intergenic
1139007507 16:62591332-62591354 CTGTTGTCTTCCATTCAAGTAGG + Intergenic
1139285273 16:65807511-65807533 CAGATGTTTCCCATTGAGAAAGG + Intergenic
1140550949 16:75864987-75865009 CAATTGTTTTCCATTCTGGCAGG - Intergenic
1140691538 16:77489133-77489155 CAGATGTATACAATTCAGATTGG - Intergenic
1146779656 17:35657732-35657754 CAGGTGTCCTCCATGCAGATGGG + Exonic
1146851023 17:36221695-36221717 CAGTTTTTGACCATTCAGAGAGG - Intronic
1149019898 17:51950834-51950856 CGGCTATTTTCCATTCAAATGGG - Intronic
1149486219 17:57045117-57045139 CAGTTGCTTGCCATTCTGAGTGG + Intergenic
1150207354 17:63419119-63419141 CAGTTCTTTCCCATGCAGCTGGG - Intronic
1150451821 17:65275626-65275648 CATTTGTTTTCCATTCTCTTGGG - Intergenic
1150809874 17:68347925-68347947 CAGCCGTTTTCCATAGAGATAGG - Intronic
1151204814 17:72498598-72498620 CAGCTGTTATCCATTCATACTGG - Intergenic
1152121008 17:78418318-78418340 CAGTGGTTTTCCCTACAGAAAGG - Intronic
1153715500 18:7843768-7843790 CTGTTGTCTGACATTCAGATAGG + Intronic
1155122487 18:22837029-22837051 TAGTTGTTATTCATTAAGATGGG + Intronic
1156015609 18:32543511-32543533 CAGTTTTTTTCCATAAAAATGGG + Intergenic
1156070543 18:33201881-33201903 CAGCTCTTTTCTATTCAGTTTGG - Intronic
1156303943 18:35859347-35859369 CAGTTTTTTACCACTCAGAGAGG - Intergenic
1156888780 18:42165893-42165915 AAGTTGTTTTCTAGTCAGAAGGG + Intergenic
1157469438 18:47977518-47977540 CAGTGTTTTTCCATGCATATAGG - Intergenic
1159490303 18:69124362-69124384 CTGTTGTTTTCTTTTCAGATGGG - Intergenic
1160194366 18:76740006-76740028 GAGATGTTCTCCATCCAGATGGG - Intergenic
1160313129 18:77816280-77816302 CAGTGGTTTACAATTCAGTTCGG + Intergenic
1163148966 19:15400042-15400064 CACTGGTTTTGCCTTCAGATGGG - Intronic
1166586599 19:43954498-43954520 CAGTTCACCTCCATTCAGATAGG + Intronic
1167836634 19:52077593-52077615 CAGTTGTCTTCTAGTAAGATGGG - Intronic
1167972131 19:53194719-53194741 CAGTTGTTTCCTAGTAAGATAGG - Intergenic
1168467771 19:56618122-56618144 CAGTTCTTTTCCTCTGAGATGGG + Intronic
1168634412 19:57984433-57984455 CAGTTGTTTTCCATTCAGATTGG - Intronic
925301861 2:2822187-2822209 CACTTGTTACCCATCCAGATAGG - Intergenic
927249519 2:20985107-20985129 CAGATGTTTTCCTTTTTGATAGG + Intergenic
928481466 2:31688470-31688492 CAGCTGTTAGCCATTCCGATTGG + Intergenic
931017111 2:57995332-57995354 TAGTTATTTTCTATTGAGATTGG - Intronic
933328757 2:80871055-80871077 GATTTGTCTTCCATTCTGATTGG - Intergenic
933518692 2:83340773-83340795 AAGATGTTTTCAATTCAGTTGGG - Intergenic
933533856 2:83546698-83546720 CAGTTCTTTTCCATTTAGCTGGG + Intergenic
936803491 2:116295538-116295560 CAGCTTTTTTGCATCCAGATAGG - Intergenic
939367976 2:141259403-141259425 CAGTTGTCTTCCAGTTAGATTGG + Intronic
939612017 2:144322514-144322536 CAGCTGTTTTCTATTAAGCTAGG - Intronic
939978592 2:148750590-148750612 CTGATGTTTTCATTTCAGATTGG + Intronic
941505967 2:166345913-166345935 CAGTTGTTTTTCAGTAATATTGG - Intronic
943689733 2:190857418-190857440 CAATTGTTTGACATCCAGATGGG - Intergenic
943730672 2:191300238-191300260 AAGTTGTTTTCTATTCAAACTGG - Intronic
945880974 2:215324748-215324770 CATTTGTTTTGCCTTCAGAGAGG - Intronic
946200872 2:218070018-218070040 CACATATTTTCCATTCAGCTGGG + Intronic
947064591 2:226208408-226208430 CAGTGGTTTTCCAGACAGAAAGG + Intergenic
947128129 2:226893665-226893687 CAGTGGTTTTCCACTGGGATGGG + Intronic
1170080883 20:12473682-12473704 CATAAGTTTTCCAATCAGATAGG + Intergenic
1174382128 20:50162776-50162798 CATTTCTTTTCCTTTCACATAGG + Intergenic
1175052834 20:56170736-56170758 CAGTTGTTAGCCAATGAGATGGG + Intergenic
1175091676 20:56509805-56509827 CAGTTGTTTTCATTTCTGTTGGG - Intronic
1177415154 21:20783342-20783364 CAGTTGTATTCCAGTCATGTTGG - Intergenic
1177450272 21:21257357-21257379 CTTTTGTCTTCCATTCAGAATGG - Intronic
1177970447 21:27782775-27782797 CAGTTTTTCACCATTCAGAATGG - Intergenic
1179073495 21:38095224-38095246 CAGATATTTTCCATGGAGATGGG - Intronic
1182170419 22:28223118-28223140 CAGTTGTGTTCCATGGAGAGGGG + Intronic
950879180 3:16308463-16308485 TTGCTGTTTTCCATTCAGACAGG - Intronic
951009891 3:17664547-17664569 CACTTCTTTTGCATTCTGATGGG + Intronic
951609660 3:24478535-24478557 CAATTGTTTACAATGCAGATGGG + Intronic
951646826 3:24901346-24901368 CTGTTGTTCTCCTTTCAGATAGG - Intergenic
951763251 3:26167842-26167864 CACTTGTTTTCCATGGAGATGGG - Intergenic
957466830 3:80604033-80604055 TCCTTGTTTTCCATTCACATTGG + Intergenic
961160555 3:124721077-124721099 CATTTCTTTTTCATTTAGATAGG - Intronic
961372321 3:126439131-126439153 TAGTTTTTTTGCATTCAAATTGG - Intronic
961688041 3:128648669-128648691 CAGTTGTTTCCCACTGGGATAGG + Intronic
963957507 3:151271325-151271347 AAGTTTTTTTCCATTCTAATGGG - Intronic
964157441 3:153603007-153603029 CAGATGTTTGCCAAGCAGATGGG + Intergenic
966292524 3:178376667-178376689 CAGTTATTATTAATTCAGATGGG - Intergenic
966445778 3:179999213-179999235 CAGTTTTTGACCATTCAGAGAGG - Intronic
966642298 3:182204394-182204416 CTGTTTTTTTCCATTCAAAATGG - Intergenic
966733673 3:183171213-183171235 CAGTTGTTTACCCTTGGGATTGG - Intergenic
968723084 4:2222095-2222117 CTGTTATTTTGCATTCACATGGG + Intronic
970748372 4:19328176-19328198 CAAATTTTTTCCATTCATATTGG + Intergenic
971100926 4:23465768-23465790 CAGTTTTTGTCCACTCAGAGAGG + Intergenic
971212742 4:24635446-24635468 CTGATCTTTTCCATGCAGATTGG - Intergenic
974352329 4:60765209-60765231 TAGTTGTTTTCTATACACATAGG + Intergenic
974667971 4:64990310-64990332 CATCTGTTTTCCTTACAGATGGG + Intergenic
974738035 4:65965391-65965413 CAAATGTTTTCCATGCAGCTAGG + Intergenic
975739646 4:77417204-77417226 CAGCTTTTTCCCATTCAGTTTGG + Intronic
976427125 4:84918006-84918028 CATTTCTTTGCCCTTCAGATTGG + Intronic
978138810 4:105294870-105294892 AATTTGTTTTCCATTCAGGCTGG + Intergenic
978934723 4:114360236-114360258 CTGTTGTTTTCCACTGTGATAGG + Intergenic
979044740 4:115849464-115849486 CAGTTTGTTTCCATTCCGCTTGG + Intergenic
980285995 4:130779299-130779321 AAGTTATTTTTAATTCAGATTGG + Intergenic
980571314 4:134623935-134623957 TAGTTGATTTCCATTCCTATGGG - Intergenic
981880807 4:149609777-149609799 CAGTTTTTCTCCATTTAGAATGG - Intergenic
981936466 4:150245338-150245360 CAGTGGGTGTCCATTCAGCTGGG + Intronic
986025665 5:3848068-3848090 CAGTTTTTGTCCACTCAGATAGG - Intergenic
986114315 5:4755140-4755162 CATTTGTTTGCCATTCTAATGGG + Intergenic
986448846 5:7847343-7847365 CAATTTTTTTCCATGCAGTTTGG - Intronic
987632238 5:20489273-20489295 CATTTGTTTGCCATCCAGAGTGG - Intronic
988153655 5:27420583-27420605 CAGTTTTTCTCCATTCAGTATGG + Intergenic
988228841 5:28448778-28448800 CAGTTTTTTACCACTCAGAGAGG - Intergenic
988559495 5:32267545-32267567 CAAATGTTTTTCATTCAGTTTGG - Intronic
988731053 5:33973249-33973271 CATCTCTTTTCCATTCAAATGGG - Intronic
989018391 5:36968687-36968709 CCTTTTTTTTCCATACAGATGGG - Intronic
989307411 5:39973969-39973991 CAGTTTTTGACCATTCAGAGAGG + Intergenic
992187484 5:74258005-74258027 AAGTTGTGTTCCATGCAGAGTGG - Intergenic
992914897 5:81439344-81439366 TATTTGTTTTGCATTCACATAGG - Intronic
993412489 5:87591162-87591184 CAGTTTTTGACCATTCAGAGAGG + Intergenic
994263815 5:97690969-97690991 AAGTAGCTTTCCATTGAGATTGG + Intergenic
996000381 5:118354767-118354789 CAGGTGTTTTTCAGTCAAATGGG + Intergenic
996096396 5:119403507-119403529 CAGTTGTAATCTTTTCAGATTGG + Intergenic
996893072 5:128446238-128446260 CAGTTGTGTTGCATTGAGAATGG - Intronic
997601711 5:135143262-135143284 AAGTTTTTTTTCATTGAGATGGG + Intronic
997913812 5:137903522-137903544 CTGTTGGTTTCCTTTCAGAATGG - Intronic
998057834 5:139094187-139094209 CAGTGGTTTCCCATTCCAATGGG - Intronic
998324855 5:141271239-141271261 TAGTCCATTTCCATTCAGATAGG - Intergenic
1001615082 5:173036785-173036807 CAGTACTTTTCTATTCAGATAGG + Intergenic
1003585670 6:7387001-7387023 CCGGTGGTTTCCATACAGATTGG + Exonic
1005929129 6:30467986-30468008 CAGATGGATTCCATTCAGTTGGG - Intergenic
1005929212 6:30469281-30469303 CAGTTGTTTACCAAGCAAATGGG + Intergenic
1006597303 6:35202868-35202890 CAGTTTATTTCCATTTAAATGGG + Intergenic
1007710446 6:43819783-43819805 CAGTTCGCTCCCATTCAGATAGG - Intergenic
1008467266 6:51844582-51844604 CAGGTTTTTTCCACTCAGCTGGG + Intronic
1009740563 6:67738339-67738361 CAGCTTTTTTTCATTCAGAATGG - Intergenic
1011132566 6:84066511-84066533 TAGTTGTTTTCTATTAACATTGG - Intronic
1012182649 6:96174372-96174394 CAGATGTTTTCCATCTACATGGG + Intronic
1012948352 6:105491657-105491679 AAATTTTTTTACATTCAGATAGG - Intergenic
1012953712 6:105546073-105546095 CTGGTGTTTACCATTCAGTTAGG - Intergenic
1014096698 6:117469185-117469207 CAGTTCATTCCCATTCAGACAGG + Intronic
1016465807 6:144324001-144324023 CATTTGTTTTCCTTTCAGCCAGG + Intronic
1018083750 6:160281795-160281817 TAATTGTTTTCCCTTAAGATTGG - Intergenic
1021305019 7:19021888-19021910 CAGTTTTTGCCCATTCAGAGAGG + Intronic
1021323942 7:19244168-19244190 CAGTTGTTTTCAAATCACCTTGG - Intergenic
1021444865 7:20721758-20721780 CAAATTTTTTCCATTCAAATAGG + Intronic
1022773253 7:33497248-33497270 CACTTGGGTTCCATTCAAATTGG + Intronic
1024753147 7:52493687-52493709 TAATTGTTTTCCTTTCATATAGG + Intergenic
1025739346 7:64183240-64183262 CAGTTCTTTTCCCTGGAGATGGG - Intronic
1027025645 7:74850290-74850312 CATTTGTTTTCAATTCTCATAGG - Intronic
1027062119 7:75093829-75093851 CATTTGTTTTCAATTCTCATAGG + Intronic
1028206798 7:88026825-88026847 CAGTTTTTTTCCATTCAGTATGG + Intronic
1030854605 7:114538875-114538897 CAATGGTTTTCCATACATATGGG - Intronic
1033471715 7:141655838-141655860 TAGTTGCTTTCTATTAAGATAGG + Intergenic
1038066891 8:23972675-23972697 CAGTTATTTTCTTTTCAGATGGG - Intergenic
1038408956 8:27343425-27343447 CTGGTGTTTTCCAGGCAGATGGG + Intronic
1038707181 8:29905484-29905506 CTGTTATTTTTCATTCACATAGG + Intergenic
1038866062 8:31439916-31439938 CAGTCCATTTCCATTCAGATAGG - Intergenic
1038890587 8:31717771-31717793 CACTTATTTTTCATTCAGCTAGG - Intronic
1039039867 8:33396933-33396955 CCTTAGTTTTCCCTTCAGATGGG - Intronic
1039088523 8:33803681-33803703 CAGTTGGTTTGAATTTAGATGGG - Intergenic
1040668784 8:49661406-49661428 CAGTTATTTTCCATTCACCAAGG - Intergenic
1040718198 8:50284470-50284492 CATTGGTTGTCCTTTCAGATGGG + Intronic
1042663366 8:71179909-71179931 CAGTTGGTGTCCATTTAGAAAGG + Intergenic
1042721649 8:71832974-71832996 CAGCTGTTTTCCATGCACACTGG - Intronic
1043604561 8:81984739-81984761 CAGTTATTTTCCAAACAGAGGGG - Intergenic
1043716105 8:83488964-83488986 CTGTTGCTGTCCATTCAGAAAGG - Intergenic
1044005575 8:86932793-86932815 CAGTTTTTTTTCTTTCAGATGGG - Intronic
1046141875 8:110104516-110104538 CAATTGTTTTTCAGTAAGATTGG + Intergenic
1046321577 8:112583829-112583851 CAGTTTTGTTCAATTCAGAATGG + Intronic
1046920229 8:119720005-119720027 CAGTTATTTTCCAGTCTGAGAGG - Intergenic
1047067295 8:121299238-121299260 CAGTTGTTTTCAGTTAAAATGGG + Intergenic
1050416199 9:5419878-5419900 CAGTTGTTTTCCATTCTTTTGGG - Intronic
1050592048 9:7171070-7171092 CAGCTTTTTTCCAGTCAGATGGG + Intergenic
1051727868 9:20106740-20106762 CAGTTTTTGTCCATTCAGTATGG - Intergenic
1057160928 9:92887602-92887624 CTGTTGTGTTCCTTCCAGATGGG + Intergenic
1057562997 9:96142944-96142966 CAGTTGTTTGCCAATCAGGTTGG - Intergenic
1058088633 9:100779180-100779202 CAGTTTTTATCCATTCAGTATGG - Intergenic
1058223422 9:102330496-102330518 CTGTTGCTTTGCATTCATATTGG - Intergenic
1058397888 9:104576782-104576804 TAGTTGGTGTCCATTCTGATCGG + Intergenic
1058882398 9:109297077-109297099 CAATTGTCATCCAATCAGATTGG - Intronic
1186350410 X:8733212-8733234 CAGTTGTTGTCCATTCGAATAGG - Intergenic
1187374163 X:18736228-18736250 CAGTTTTTGTCCATTCAGTATGG + Intronic
1188196650 X:27242671-27242693 CAATTGTTTTCAATACATATGGG - Intergenic
1188398249 X:29712654-29712676 CAAATGTCTTCCATTCATATGGG - Intronic
1189131263 X:38500258-38500280 CTGTGATTGTCCATTCAGATTGG - Intronic
1191261335 X:58325452-58325474 CAGTTTTTGTCCATTCAGTAAGG - Intergenic
1191931880 X:66382769-66382791 CAGTAGTCTTCCATACAGACAGG + Intergenic
1192053685 X:67750067-67750089 CAAATGTTTTCCAATCTGATGGG - Intergenic
1192276220 X:69633846-69633868 CACCTGTTTTCCATTCATTTGGG + Intronic
1193478652 X:81998382-81998404 CAGTTTTTGTCCATTCAGTATGG + Intergenic
1193957373 X:87878868-87878890 CAGTTTTTGACCATTCAGAGAGG - Intergenic
1194383406 X:93223066-93223088 CAGGTGTCCTCCATGCAGATGGG - Intergenic
1194649506 X:96498490-96498512 CAATTTTTGCCCATTCAGATAGG - Intergenic
1194802859 X:98293388-98293410 TAGTTCTTTTCCAGTCAGGTGGG - Intergenic
1196131291 X:112159773-112159795 CAAATGCATTCCATTCAGATTGG + Intergenic
1196171584 X:112594162-112594184 CAGTTTTTGTCCATTCAGTATGG - Intergenic
1196172576 X:112606266-112606288 CAGTTTTTGTCCATTCAGTATGG - Intergenic
1197477282 X:126940781-126940803 CAGTTTTTGACCATTCAGAGAGG + Intergenic
1199955355 X:152737412-152737434 GTGTTGTTTTTTATTCAGATTGG + Exonic