ID: 1168634417

View in Genome Browser
Species Human (GRCh38)
Location 19:57984474-57984496
Sequence GTCCCCTCCATTAGAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168634412_1168634417 18 Left 1168634412 19:57984433-57984455 CCAATCTGAATGGAAAACAACTG 0: 1
1: 0
2: 0
3: 21
4: 252
Right 1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG 0: 1
1: 0
2: 0
3: 17
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168634417 Original CRISPR GTCCCCTCCATTAGAGTGGG TGG Intronic
905912488 1:41663638-41663660 GTTCCCTCCATTAAAGCTGGGGG - Intronic
916462413 1:165040224-165040246 GTACACTCCTTTAGAGTGGAGGG + Intergenic
919062041 1:192645624-192645646 GTCCCCTCCATTCTTCTGGGCGG - Intronic
922830208 1:228549016-228549038 GTCTCTTCCATTAGAGTGCCTGG + Intergenic
1062939825 10:1412944-1412966 CCCCTCTCCATTAGGGTGGGCGG - Intronic
1067346616 10:45442816-45442838 GTCCCTTGCATTGGATTGGGCGG + Intronic
1074975489 10:118577803-118577825 GCCCCCCCCATTATAGTTGGGGG + Intergenic
1079953545 11:26834177-26834199 TTGCCCTCCATTAAAGTGGATGG - Intergenic
1083374644 11:62209571-62209593 TTCCTCTCCCTTACAGTGGGAGG + Intronic
1084267859 11:68014183-68014205 TTCCCCCTCATTAGACTGGGAGG - Intronic
1084696312 11:70757650-70757672 GTCCCCTCAAGGAGAGAGGGAGG + Intronic
1089216599 11:116837906-116837928 TTCCCCTCCATGGGAGTGTGTGG + Exonic
1089583936 11:119498122-119498144 GCCCCCTCCCTCAGAGTGGCTGG + Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1094105676 12:26808990-26809012 CTGCCCTTCATTTGAGTGGGTGG + Intronic
1120018353 14:79499754-79499776 GTCCCCTAGATTAGGGTGGCTGG - Intronic
1123471936 15:20562177-20562199 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1123646068 15:22438176-22438198 CTCCCCTCTCTTAGGGTGGGTGG - Intergenic
1123732239 15:23157168-23157190 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1123750374 15:23354550-23354572 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1123880811 15:24676291-24676313 GTCTCCTCCAGGAGAGTGGCTGG - Exonic
1124282744 15:28378466-28378488 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124299956 15:28533147-28533169 CTCCCCTCTCTTAGGGTGGGTGG - Intergenic
1124481282 15:30082755-30082777 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124487737 15:30134851-30134873 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124522317 15:30414438-30414460 CTCCCCTCTCTTAGAGTGGGTGG - Intergenic
1124536347 15:30551780-30551802 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124542826 15:30603828-30603850 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124755792 15:32403470-32403492 CTCCCCTCTCTTAGAGTGGGTGG - Intergenic
1124762304 15:32455812-32455834 CTCCCCTCTCTTAGAGTGGGTGG - Intergenic
1124776327 15:32593258-32593280 CTCCCCTCTCTTAGAGTGGGTGG + Intergenic
1124960528 15:34389966-34389988 CTCCCCTCTCTCAGAGTGGGTGG - Intronic
1124977157 15:34536187-34536209 CTCCCCTCTCTCAGAGTGGGTGG - Intronic
1128649067 15:69397285-69397307 GTCACTTCCATTGGGGTGGGAGG + Intronic
1129266994 15:74398644-74398666 ATCCCCGCCATCAGAGTGTGAGG - Intergenic
1132434078 15:101782281-101782303 CTCCACTCTCTTAGAGTGGGCGG - Intergenic
1134347279 16:13402488-13402510 GTCACCTACATTGGAGAGGGTGG + Intergenic
1136384665 16:29916092-29916114 GTCTCCTGCATTAGTGTGGAGGG - Intronic
1137047828 16:35685141-35685163 GTCTCATCCATTAGAATGTGTGG + Intergenic
1137048152 16:35687186-35687208 GTCTCTTCCATTAGAATGCGTGG + Intergenic
1138041776 16:53679202-53679224 GTCCCCTCCATTCCTGTGGGTGG - Intronic
1139465682 16:67152897-67152919 ACCCGCTCCATTATAGTGGGTGG + Intergenic
1144137713 17:12314401-12314423 GTACCACCCAATAGAGTGGGTGG - Intergenic
1157241767 18:46016567-46016589 GTCTCCTCCATTAGACTCTGAGG - Intronic
1157786178 18:50485038-50485060 GTCTTCTCCAGTAGAGAGGGAGG + Intergenic
1160968067 19:1755271-1755293 CTCCCCTCCTCCAGAGTGGGTGG + Intronic
1161435235 19:4258955-4258977 GTCCCATCCATGAGGGTGGGAGG + Intronic
1162519916 19:11173711-11173733 GTCTCCTCCATCAGACTGGGAGG + Intronic
1162519943 19:11173879-11173901 GTCTCCTCTATCAGACTGGGAGG + Intronic
1162519961 19:11173965-11173987 GTCTCCTCCATCAGCCTGGGAGG + Intronic
1162520005 19:11174132-11174154 GTCTCCTCCATCAGCCTGGGAGG + Intronic
1162520013 19:11174160-11174182 ATCTCCTCCATCAGACTGGGAGG + Intronic
1162520020 19:11174188-11174210 ATCTCCTCCATCAGACTGGGAGG + Intronic
1163665894 19:18604028-18604050 GGCCCCCCCAACAGAGTGGGAGG + Intronic
1164375185 19:27677930-27677952 GTCTCTTCCATTAGAATGTGGGG + Intergenic
1164384526 19:27761692-27761714 GTCTCCCCCATTAGAATGTGTGG + Intergenic
1168613050 19:57816012-57816034 GCCCACTCCATTTGAGTGGAAGG + Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
925336404 2:3102138-3102160 GTCCCCTCCAGTGGTCTGGGCGG - Intergenic
936861467 2:117025548-117025570 ATCCTATCCATTATAGTGGGTGG + Intergenic
939293032 2:140219878-140219900 ATCCTGTCCATTATAGTGGGTGG - Intergenic
942503654 2:176618739-176618761 GTGCCCTCCATCAGAGAGGTTGG + Intergenic
1172851856 20:37972179-37972201 GTCTCCTCCATCAGACTGTGAGG + Intergenic
1173358017 20:42313462-42313484 GTCCTCACCATAAGAGTGGTTGG - Intronic
1178408869 21:32347668-32347690 GACCCCTGCACTAAAGTGGGTGG + Exonic
1179669084 21:42932834-42932856 GCCCACTCCATTTGAGTGGAAGG + Intergenic
1180793433 22:18589999-18590021 GTCTCCACCATTAGACTGGCAGG + Intergenic
1181228306 22:21405313-21405335 GTCTCCACCATTAGACTGGCAGG - Intergenic
1181250344 22:21529537-21529559 GTCTCCACCATTAGACTGGCAGG + Intergenic
1183599152 22:38830053-38830075 GTCCCCTGCATCAGAGTGCTGGG + Intronic
950520738 3:13496352-13496374 GTCCCCTTCTGTACAGTGGGTGG + Intronic
957888915 3:86329617-86329639 GTTGCCTCCCTTAGAGTGGTTGG + Intergenic
967972513 3:195009915-195009937 GTCTCCTCCCTTAGAGGGAGAGG + Intergenic
970192536 4:13529709-13529731 GTCCCCACCCTAGGAGTGGGAGG + Intergenic
971648558 4:29240131-29240153 TTCCCCTCCAGTGGAGTGAGAGG - Intergenic
973808057 4:54544608-54544630 GTGCCCTCCATGAGGGTGGGTGG - Intergenic
974699648 4:65424048-65424070 GGACTCACCATTAGAGTGGGAGG - Intronic
980105269 4:128582584-128582606 GTCCCTTCCATCAGGGTTGGTGG + Intergenic
982443384 4:155462177-155462199 ATCCTATCCATTATAGTGGGTGG - Intergenic
990786415 5:59425498-59425520 GTCCCCTGCATGAGAGGTGGAGG + Intronic
997779906 5:136646223-136646245 CTCCCCTCCATTAAAGGAGGTGG + Intergenic
997981200 5:138468208-138468230 TTCCACTCCAGTAGAGAGGGAGG - Exonic
998128676 5:139640287-139640309 GTCCCCTCCAGGAAGGTGGGAGG + Intergenic
998206063 5:140157602-140157624 GTCCGCTCCGTGACAGTGGGCGG + Intergenic
1001843845 5:174903717-174903739 GTCCCCTCCATTAGTGTCCTTGG - Intergenic
1002639051 5:180621995-180622017 GGCCCCTCCAGGAGAGAGGGAGG - Intronic
1003414612 6:5896801-5896823 GTCCCTTCCTCTAGGGTGGGAGG + Intergenic
1004050300 6:12071281-12071303 GTCACCTCCTTGATAGTGGGGGG + Intronic
1012445794 6:99306045-99306067 GGCAGCTACATTAGAGTGGGTGG + Intronic
1015451720 6:133377079-133377101 GTCTCCTCCACTAGAGGAGGAGG + Intronic
1018421509 6:163644222-163644244 GTGCCCTCCCTTGGAGTGTGAGG - Intergenic
1019890268 7:3940890-3940912 GGCCACTCCATGAGAGTGTGAGG - Intronic
1022172100 7:27840559-27840581 CTCTCCTGCATTAGAGTGCGTGG - Intronic
1026438055 7:70417084-70417106 GTCTCCTCCAGCAGAGTGGAGGG - Intronic
1026977660 7:74508214-74508236 GTCCCCTCCTCTTGGGTGGGTGG - Intronic
1028489872 7:91399337-91399359 GGGCCCTACATTATAGTGGGAGG - Intergenic
1039483584 8:37894050-37894072 GTTTCCTACACTAGAGTGGGAGG + Intronic
1046790745 8:118319203-118319225 GTCACCTCCATTAATGGGGGTGG + Intronic
1048367960 8:133754886-133754908 ATCCTATCCATTATAGTGGGCGG + Intergenic
1049069725 8:140347134-140347156 GCCCCCACCATTAGAGCGGGAGG + Intronic
1051540950 9:18216967-18216989 CTCCCCTCCATTAGATTGTTGGG + Intergenic
1051594541 9:18811232-18811254 CTCCCCTCCATGAGGGTTGGGGG - Intronic
1055846154 9:80565573-80565595 ATCCTATCCATTATAGTGGGCGG - Intergenic
1062398020 9:136360351-136360373 GTCCCAGCCAGTAGCGTGGGCGG - Intronic
1191245772 X:58227121-58227143 GTCTCTTCCATTAGAATGGTTGG - Intergenic
1196490778 X:116263227-116263249 ATCCCCTTGATTAGACTGGGTGG + Intergenic
1197057165 X:122135173-122135195 CTCTCCACCATTAGAGGGGGGGG + Intergenic