ID: 1168634861

View in Genome Browser
Species Human (GRCh38)
Location 19:57988381-57988403
Sequence GCCCAGGTTGAGAAGTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168634861_1168634868 22 Left 1168634861 19:57988381-57988403 CCCTGTGACTTCTCAACCTGGGC 0: 1
1: 0
2: 1
3: 17
4: 152
Right 1168634868 19:57988426-57988448 CTCCATGCTCTTTAAGCATTAGG 0: 1
1: 0
2: 0
3: 9
4: 178
1168634861_1168634863 -10 Left 1168634861 19:57988381-57988403 CCCTGTGACTTCTCAACCTGGGC 0: 1
1: 0
2: 1
3: 17
4: 152
Right 1168634863 19:57988394-57988416 CAACCTGGGCAGAATATGCAAGG 0: 1
1: 0
2: 1
3: 12
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168634861 Original CRISPR GCCCAGGTTGAGAAGTCACA GGG (reversed) Intronic