ID: 1168635236

View in Genome Browser
Species Human (GRCh38)
Location 19:57991029-57991051
Sequence CAGTGGGACGAGGGTGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 426}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168635236_1168635242 6 Left 1168635236 19:57991029-57991051 CCTCCTGCACCCTCGTCCCACTG 0: 1
1: 1
2: 2
3: 29
4: 426
Right 1168635242 19:57991058-57991080 ACAGTCCATCTCCTCCTGCAAGG 0: 1
1: 0
2: 3
3: 15
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168635236 Original CRISPR CAGTGGGACGAGGGTGCAGG AGG (reversed) Intronic
900145428 1:1157106-1157128 TAGCTGGAAGAGGGTGCAGGAGG + Intergenic
900525710 1:3127660-3127682 CAGTAGGACGAGGGTTGAGAGGG + Intronic
900562082 1:3312232-3312254 CAGTGGGGCGAGGATGCTGACGG - Intronic
900627144 1:3613539-3613561 CCCTGGGACGGGGGTGGAGGAGG + Intergenic
900720414 1:4172296-4172318 CAGTCGCATGAGGGTGGAGGAGG - Intergenic
900772791 1:4559171-4559193 CAGTGGGATGAGGGAGTAAGAGG + Intergenic
901109986 1:6786010-6786032 CAGTGGGGCGCGGGGCCAGGAGG - Intronic
901165236 1:7216143-7216165 CAGGAGGAAGAGGGTGAAGGGGG + Intronic
901758737 1:11457045-11457067 CAGTGGGTGGTGGGTGCAGCTGG + Intergenic
901770719 1:11529217-11529239 CGGGGGTACGAGGGTTCAGGAGG - Intronic
902105552 1:14032966-14032988 CAGTAAGACCAGGGTGCAGAGGG - Intergenic
902241653 1:15094132-15094154 CTGGGGGACGAGGCTGCTGGGGG - Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
902676804 1:18014480-18014502 CTGGGGGATGAGGTTGCAGGGGG - Intergenic
903301140 1:22379493-22379515 CATTGGCATGAGGGTGCAGCAGG - Intergenic
903740313 1:25554868-25554890 CAGTGGGAAGAAGCTGCAGAAGG + Exonic
906390833 1:45414518-45414540 AAGGGGGATGAGGGTGGAGGTGG + Intronic
908516441 1:64897454-64897476 CAGGAGGACGAGGGAGGAGGAGG + Intronic
910243668 1:85115699-85115721 CAGGGGGAGGTGGGGGCAGGGGG + Intronic
912384480 1:109264403-109264425 CAGTGGAGCGGGGCTGCAGGTGG - Intronic
912436858 1:109668172-109668194 CGGTGGGACGGGGGTGCGTGGGG + Intronic
912543430 1:110433931-110433953 CTGTGGGCTGAGAGTGCAGGAGG - Intergenic
912551413 1:110487847-110487869 CAGTGTGATAAGGGTGCAGCAGG + Intergenic
912634441 1:111278812-111278834 GAGTGGGAGGTGGGTACAGGAGG + Intergenic
915936338 1:160092249-160092271 CAGAGTGAGGAGGGTGGAGGGGG + Intronic
916072410 1:161177865-161177887 AAGTGGCACTAGGCTGCAGGGGG - Exonic
916392139 1:164342403-164342425 CAGTGGGAGGAGGGTTCACTTGG - Intergenic
916431683 1:164736124-164736146 CAGTGGGAAGAGGCTGGATGGGG - Intronic
917442759 1:175081551-175081573 TGGTGGGACTAGGGTGGAGGTGG + Intronic
917791209 1:178500186-178500208 CAGAGGGCCGATGGTGAAGGCGG + Intergenic
917929169 1:179812187-179812209 CATTGGGACCAAGGGGCAGGAGG - Intronic
920135349 1:203764804-203764826 CAGTGGGTGGAGGCTGCAGAGGG - Intergenic
920418452 1:205813647-205813669 AAGTGGGAGGAGGGAGCACGCGG - Intronic
923567621 1:235088251-235088273 GAGTGGGAGAGGGGTGCAGGTGG + Intergenic
923724641 1:236495552-236495574 CAGGTGGAGGAGGGTGGAGGTGG - Intergenic
923820048 1:237428595-237428617 CGGTGGGGCGGGGGTGCAAGGGG + Intronic
924448479 1:244156294-244156316 CAGTGGGTAGAGGGTGAGGGAGG - Intergenic
924741990 1:246799594-246799616 CATTGGGAAGGGGGTCCAGGAGG - Intergenic
1062786854 10:271934-271956 CAGGGGAGGGAGGGTGCAGGAGG - Intergenic
1062890692 10:1057241-1057263 CAGAGGGACCAGGGTGCGGGAGG + Intronic
1063745261 10:8872170-8872192 CAGAGGGTGGAGGGTGGAGGAGG - Intergenic
1064230002 10:13521549-13521571 CAGTGGGGCCAGGGTGCTGAAGG + Intronic
1065255403 10:23861674-23861696 CAATAGGACGAGGATGCAGGTGG + Intronic
1066058766 10:31704299-31704321 CAGTGGGAAGGGGGAGCATGCGG + Intergenic
1066259746 10:33717909-33717931 CAGTGGAACCGGGGTGCAGATGG + Intergenic
1066349557 10:34624801-34624823 CAGTGGGACGTGGGCCCTGGAGG - Intronic
1066352547 10:34649992-34650014 CAGTGGGACAGAGGTGCTGGTGG - Intronic
1066711350 10:38237979-38238001 CAGTTGGACAAAGTTGCAGGAGG - Intergenic
1067105292 10:43362372-43362394 CAGTGAGGCGAGGGCCCAGGAGG - Intergenic
1067431846 10:46250468-46250490 CTGTGGGAGGAGGGGGCAGATGG - Intergenic
1067441574 10:46311710-46311732 CTGTGGGAGGAGGGGGCAGATGG + Intronic
1067578271 10:47421170-47421192 CTGTGGGAGGAGGGGGCAGCCGG + Intergenic
1069587281 10:69616495-69616517 CAGTGGGACAAGTGTGTGGGTGG + Intergenic
1069926115 10:71851780-71851802 CAGGGGCACGTGGGGGCAGGTGG + Intergenic
1070125954 10:73621996-73622018 AAGTGGGGAGAGGTTGCAGGTGG - Intronic
1070548668 10:77473633-77473655 CAGTGGGACACTGGAGCAGGGGG + Intronic
1070636297 10:78130863-78130885 CAGTGGGAAGAAGGAGCATGTGG - Intergenic
1070650298 10:78230535-78230557 TAGTGGGAGGAGGGTGATGGTGG - Intergenic
1071641591 10:87314208-87314230 CAGGGGGTCGAGGCTGCAGTGGG - Intergenic
1072614754 10:97042181-97042203 CACTGGGAGTAGGCTGCAGGGGG + Intronic
1072983893 10:100122541-100122563 CATTGAGGAGAGGGTGCAGGAGG - Intergenic
1073533645 10:104255083-104255105 CAGTGGGACGCGGGGGCGGTGGG + Intronic
1073578740 10:104644963-104644985 CAGGTGGTTGAGGGTGCAGGAGG + Intronic
1074377120 10:112950043-112950065 CGGAGGGAGGAGTGTGCAGGGGG - Intergenic
1074644477 10:115430805-115430827 GAGTGGGACGTGGGTGCCGTGGG + Intronic
1075818353 10:125283941-125283963 CGGTGGGAGAAGGGTGCAGTGGG - Intergenic
1075822034 10:125322823-125322845 CAGGGCGACGATGGTGGAGGTGG + Intergenic
1075835371 10:125448412-125448434 CAGGAGGACGAAGGTGAAGGTGG - Intergenic
1076022464 10:127085315-127085337 CAGTGGGCAGGGGGTACAGGTGG + Intronic
1076358269 10:129868632-129868654 CAGCAGAAGGAGGGTGCAGGGGG + Intronic
1076399922 10:130175837-130175859 CAGTGGGCCTGGGGTGCAGTGGG - Intronic
1076571628 10:131437206-131437228 CAGTGGGTGGAGGGTGATGGGGG - Intergenic
1076740060 10:132478516-132478538 CAGAGGGCAGAGGGTGCCGGGGG - Intergenic
1076769673 10:132656156-132656178 CAGTGGGGACAGGGTGCAAGAGG + Intronic
1076813892 10:132904894-132904916 CAGTTGGAAGGGGCTGCAGGGGG - Intronic
1077015988 11:399400-399422 CAGGTGGAGGAGGGGGCAGGTGG - Intronic
1077137178 11:1006279-1006301 CCGAGGGAGGAGGGTGCTGGAGG + Intronic
1077310879 11:1888605-1888627 TCCTGGGACTAGGGTGCAGGGGG - Intronic
1077389929 11:2296097-2296119 GAGTGGAACGAGGCTGCAGTGGG + Intronic
1077476963 11:2795082-2795104 GAGTGGGACGTGGGAGGAGGTGG - Intronic
1077553443 11:3214450-3214472 CAGTGTGCTGAGGGTGCACGTGG - Intergenic
1078170898 11:8928543-8928565 CTGTGGGAGGAGGGTGGAGGTGG - Intronic
1079351766 11:19697861-19697883 CAGTGGGAAAAAGGAGCAGGAGG - Intronic
1080789368 11:35507989-35508011 CAGTGGCACTATGCTGCAGGAGG - Intronic
1081710742 11:45213868-45213890 TAGTGGGAAGAGGAGGCAGGGGG + Intronic
1081908860 11:46687237-46687259 CAGTGGGAAGAGGGTTCAGAAGG + Intronic
1082039630 11:47674199-47674221 GAGTGGCAGGAGGGTGAAGGAGG + Intronic
1083601937 11:63954221-63954243 CCTTAGGATGAGGGTGCAGGAGG - Intronic
1083619546 11:64042101-64042123 CAGTGGGACCAGGCGGGAGGGGG + Intronic
1083994854 11:66266850-66266872 CTGTGGGCAGAGGGGGCAGGTGG - Intronic
1084039412 11:66532674-66532696 CAGGGAGAAGGGGGTGCAGGAGG + Exonic
1084092747 11:66889305-66889327 CAGTGGGACAGGGGTGGCGGGGG + Intronic
1084121260 11:67070399-67070421 CAGGGGGGCGAGGGGGCATGTGG - Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1085461008 11:76693168-76693190 CTGTGGAACGTCGGTGCAGGAGG - Intergenic
1085865282 11:80283403-80283425 CAGTGGGAAGAGGGAGCAGGAGG - Intergenic
1087662964 11:101009208-101009230 CAGTGGAATGACAGTGCAGGGGG - Intergenic
1089176439 11:116552180-116552202 CAGGGTGAAGAGGGTGCAGGTGG - Intergenic
1089824839 11:121265799-121265821 CAGTGGGAGGAGCCTGCATGGGG - Intergenic
1090056293 11:123427920-123427942 GTGTGGGAAGAGGGTGCTGGTGG + Intergenic
1090687058 11:129133132-129133154 CAGGGGGAAGAGTGAGCAGGAGG + Intronic
1090740424 11:129654606-129654628 CAGTGTGGAGAGGGAGCAGGTGG - Intergenic
1090949870 11:131464105-131464127 CTGAGGGAGGAGGGTGCAGAGGG + Intronic
1091174633 11:133547022-133547044 CAGAGGGACGAGGCTGCACAGGG - Intergenic
1092277960 12:7076575-7076597 CATTGGGAAGAGAATGCAGGAGG - Intergenic
1092615563 12:10212976-10212998 CGCTGGGCCGAGTGTGCAGGGGG - Exonic
1093486377 12:19657239-19657261 CAGTGGGATAAGGGTCCAGCTGG - Intronic
1094213980 12:27921357-27921379 AGGTGGGAAGAGTGTGCAGGGGG - Intergenic
1095947481 12:47761698-47761720 CAGTCAGAGGAGGGTGGAGGCGG - Intronic
1100679107 12:96899478-96899500 CAGGTGGAGGAGGGTGCAGAGGG - Intergenic
1101568029 12:105928027-105928049 CAGTGGGAAGAGAGTGGAAGAGG + Intergenic
1101866640 12:108525120-108525142 CAGAGGGAGAAGGCTGCAGGAGG + Intronic
1103592776 12:122004175-122004197 CACTGGGCGGAGGGTCCAGGTGG - Intergenic
1104040156 12:125124690-125124712 CAGTGATGCTAGGGTGCAGGCGG - Exonic
1105446575 13:20462196-20462218 TAGTGGGAGGAGGGGGCAGGAGG + Intronic
1105885762 13:24639714-24639736 CACTGGGAGGAGGGCGCACGGGG - Intergenic
1107628786 13:42320511-42320533 CAGTGGGAGGAGGGGGGAGGGGG - Exonic
1108839355 13:54593263-54593285 CAGTGGTGGGAGGGTTCAGGTGG - Intergenic
1108884651 13:55165186-55165208 CAATGGGGGGAGGCTGCAGGTGG - Intergenic
1110786067 13:79527876-79527898 CAGTGGGACAAATGTGGAGGTGG + Intronic
1113153928 13:107295642-107295664 GAGTGGGAGGAGGGTGGAGGAGG + Intronic
1113671816 13:112180825-112180847 CAGAGGGAGGAGGATGCACGTGG + Intergenic
1113681197 13:112246201-112246223 GAGTGGGGCGAGGGTGTGGGAGG - Intergenic
1114726329 14:24941545-24941567 CAGGGGGAGGAGGGAGCAGGAGG + Intronic
1115059058 14:29168593-29168615 GAGTGGGCAGAGGTTGCAGGAGG - Intergenic
1115383603 14:32769289-32769311 CTGTGGGAGGAGGAGGCAGGCGG - Intronic
1116681408 14:47974479-47974501 AAGTGGGATCAGGGTGGAGGAGG + Intergenic
1118148331 14:63164297-63164319 CAGTTGGACAGGGTTGCAGGAGG - Intergenic
1118473172 14:66093881-66093903 CAGCGGGGCGAGGAGGCAGGGGG + Intergenic
1122053779 14:99078550-99078572 CAGTAGGAAGAGTGTGCAGGTGG - Intergenic
1122234282 14:100323214-100323236 CACTGGGACAAGGGTCCCGGGGG + Intergenic
1122328117 14:100894889-100894911 CAGTGGGCAGTGGGTCCAGGGGG + Intergenic
1202885956 14_KI270722v1_random:107417-107439 CAGTGGTACGAGGGTGTAAATGG - Intergenic
1124866115 15:33492990-33493012 CAGAGGGAGGAGGGTGTAAGTGG + Intronic
1126109597 15:45167595-45167617 CAGTGGGGAGAGGGTGGTGGTGG + Exonic
1126696412 15:51329620-51329642 CAGTGGGCAGAGGGTGCTGCTGG + Intronic
1126928738 15:53622618-53622640 CAGTCTGAGGAGGGAGCAGGGGG + Intronic
1128242410 15:66109995-66110017 CAGCAGGACAAGGGTGCAGAGGG + Intronic
1129414026 15:75364800-75364822 CAGTGTGACAAGAGTGCATGTGG + Intronic
1129435067 15:75532756-75532778 CAGAGGGATGGGTGTGCAGGAGG - Intronic
1130220507 15:82015392-82015414 CAGTGGGACCAGCCTGAAGGAGG - Intergenic
1131640054 15:94283028-94283050 CAGTGGGAGGAGGCTGTGGGTGG + Intronic
1131823685 15:96298233-96298255 CACTGGGACTAGGGTACAGAAGG + Intergenic
1132408822 15:101561525-101561547 CTGGGGGACAAGGGAGCAGGCGG + Intergenic
1132576664 16:667409-667431 CTGTGGGTAGACGGTGCAGGTGG - Intronic
1133744371 16:8675486-8675508 CGGTGGGAGGATGGTGCAGGGGG - Intronic
1134058245 16:11183332-11183354 CAGTAGGACGTGGGGGAAGGGGG - Intergenic
1136365382 16:29806937-29806959 GAGTGGGCCGCGGGTGCGGGCGG - Intronic
1136484349 16:30561636-30561658 CCCTGGGAGTAGGGTGCAGGAGG + Intergenic
1137334389 16:47533545-47533567 GAGGGGGCCGAGGCTGCAGGGGG + Intronic
1138337851 16:56267147-56267169 AAGAGGGAGGAGGGTCCAGGCGG + Intronic
1138353878 16:56362514-56362536 CAGTGGGAAGAGTGTGGGGGAGG - Exonic
1138456391 16:57123495-57123517 CACTGGGATGGGGGTGCAGAGGG - Intronic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1139662503 16:68430635-68430657 CAGTGGGGTGATGGGGCAGGGGG - Intronic
1140543485 16:75783168-75783190 CTGTGGGAGGAGGGTGGATGGGG - Intergenic
1141556499 16:84839879-84839901 CAGTGGGACTGAGGTGGAGGTGG + Intronic
1141608756 16:85169882-85169904 CAGTGCGACGCGGGCGCAGGCGG + Intergenic
1141742434 16:85902756-85902778 CAGTGGGAGGGGCCTGCAGGGGG + Intronic
1141748570 16:85942876-85942898 CAGGGGGCAGAGGTTGCAGGGGG - Intergenic
1141848780 16:86629903-86629925 GTGTGGGAGGAGGGTGTAGGGGG + Intergenic
1142379126 16:89721751-89721773 CGGTGGGCCGAGGGTGGACGGGG + Exonic
1142707723 17:1707299-1707321 CAGTGGGAGGAAGGTAGAGGAGG - Exonic
1144009266 17:11130515-11130537 CAGGAGGAAGAGGGTGAAGGGGG + Intergenic
1145219911 17:21079905-21079927 CAATGGGACAAGGGTCCAGCAGG - Intergenic
1145997328 17:29112164-29112186 CGAGGGGACGAGGGTGGAGGAGG - Intronic
1146524300 17:33552960-33552982 CAGTGGGCCCAGGGTTCAGTTGG - Intronic
1147037179 17:37690465-37690487 CAGTGGGGCAAGGGTGGAAGTGG + Intronic
1147240026 17:39084755-39084777 TAGTGGGACCAGGTTGCTGGAGG + Intronic
1147911341 17:43858031-43858053 CAGAGGGAGGAGGGGCCAGGAGG - Intronic
1147940698 17:44045642-44045664 CAGTGGGTGGAGGTTGCAGTGGG - Intronic
1149893691 17:60412411-60412433 CGGTGGGGCGGGGGAGCAGGTGG + Intronic
1151141157 17:71993361-71993383 CAGTGGGAAGAGGCTGCAGGGGG - Intergenic
1151584889 17:75003010-75003032 CAGGGGGAGAAGGGTGGAGGAGG + Intronic
1151887783 17:76933314-76933336 CAGAGGGTAGAGGGGGCAGGCGG - Intronic
1151937310 17:77270513-77270535 CAGAGGGCTGAGGGTGCTGGCGG - Intergenic
1152135601 17:78501471-78501493 CAGTTGGATGTGGGTGCTGGAGG - Intronic
1152226341 17:79094552-79094574 GAGTGGGAGGAGGGTGGGGGAGG + Intronic
1153552222 18:6273584-6273606 CAGTCGGAAGTGGGAGCAGGCGG + Intronic
1155225272 18:23724482-23724504 CAGGGGGACGGGGTGGCAGGGGG - Intronic
1156401768 18:36745787-36745809 AAGTGAGCGGAGGGTGCAGGTGG - Intronic
1157110294 18:44814134-44814156 CAGTGGGAGTAGGGTGATGGGGG + Intronic
1157191470 18:45585766-45585788 CAGAGGGAGAAGGGGGCAGGTGG - Intronic
1157259829 18:46168214-46168236 CAGAGGGACGAGCGGCCAGGGGG - Intergenic
1157794060 18:50559522-50559544 CACTGGGCCGAGGGTCGAGGGGG - Intergenic
1158430936 18:57386822-57386844 CATGGGGACTAGGGTGCAGTAGG - Intergenic
1159677487 18:71303968-71303990 CAGGAGGAAGAGGGAGCAGGGGG - Intergenic
1159708959 18:71729812-71729834 CTGTAGGCCAAGGGTGCAGGTGG + Intergenic
1160208656 18:76858671-76858693 CAGCTGGAGGCGGGTGCAGGTGG + Intronic
1160208683 18:76858759-76858781 CAGCTGGAGGCGGGTGCAGGTGG + Intronic
1160208710 18:76858847-76858869 CAGCTGGAGGCGGGTGCAGGTGG + Intronic
1160208724 18:76858891-76858913 CAGCTGGAGGCGGGTGCAGGTGG + Intronic
1160208738 18:76858935-76858957 CAGGTGGAGGCGGGTGCAGGTGG + Intronic
1160208753 18:76858979-76859001 CAGGTGGAGGCGGGTGCAGGTGG + Intronic
1160208780 18:76859067-76859089 CAGCTGGAGGCGGGTGCAGGTGG + Intronic
1160208794 18:76859111-76859133 CAGCTGGAGGCGGGTGCAGGTGG + Intronic
1160208809 18:76859155-76859177 CAGGTGGAGGCGGGTGCAGGTGG + Intronic
1160208836 18:76859243-76859265 CAGGTGGAGGCGGGTGCAGGTGG + Intronic
1160265290 18:77336503-77336525 CAGTGGGAGGAGGTGGAAGGGGG + Intergenic
1160532751 18:79575162-79575184 CAGTGTGACCGTGGTGCAGGTGG + Intergenic
1160903741 19:1442180-1442202 CAGTGGGACGGTGCTGCACGTGG + Intergenic
1161493548 19:4575588-4575610 CAGAGTGACGTGGGTGCTGGGGG + Intergenic
1161533387 19:4803906-4803928 CAGAGGGACGAGGGGGCTGTTGG + Intergenic
1162187927 19:8921843-8921865 CAGGGGGAAGAGGGGACAGGGGG - Intronic
1162697239 19:12485744-12485766 CAGAAGGTCGAGGCTGCAGGGGG - Intronic
1163148992 19:15400118-15400140 GAGTGGGAAGGGGGTGGAGGCGG + Intronic
1163226076 19:15962560-15962582 AATTGAGAGGAGGGTGCAGGGGG - Intergenic
1163831619 19:19549784-19549806 CCCTGGGCCGAGGGTGGAGGGGG + Intergenic
1164495297 19:28754851-28754873 CAGTGGGACAGTGGTGCAGCAGG - Intergenic
1165157000 19:33795371-33795393 CAGTGGGAGGAAGGTGAAGTGGG - Intergenic
1165722210 19:38087658-38087680 CAGGTAGACGAGGGAGCAGGAGG + Intronic
1166219285 19:41354360-41354382 CAGTGGGAGGAGGGGGCAACAGG + Intronic
1166672426 19:44718940-44718962 GAGTAGGAGGAGGGTGGAGGAGG + Intergenic
1167510721 19:49894238-49894260 GGGCGGGAGGAGGGTGCAGGCGG + Intronic
1167520654 19:49952441-49952463 CTGTGGGAGGAAGGGGCAGGAGG - Intronic
1167563944 19:50244396-50244418 ACGTGGGACAGGGGTGCAGGAGG - Intronic
1167795391 19:51704955-51704977 CTGAGGGAGGAGGGGGCAGGGGG - Intergenic
1168077710 19:53990459-53990481 CTGAGGGAGGAGGGGGCAGGGGG - Intergenic
1168258919 19:55181959-55181981 CAGTGGGACGAGGGACCCTGGGG - Intronic
1168635236 19:57991029-57991051 CAGTGGGACGAGGGTGCAGGAGG - Intronic
1202661358 1_KI270708v1_random:74397-74419 CAGTGGTACGAGGGTGTAAATGG - Intergenic
926054595 2:9767173-9767195 CAGAAGGTCGAGGCTGCAGGGGG - Intergenic
926690380 2:15729131-15729153 AAGTGGGACTAGGGCCCAGGTGG + Intronic
926953643 2:18271430-18271452 CAGCGGGAGCAGGGTGGAGGAGG - Intronic
926989082 2:18657744-18657766 CAGTGGGGCCGAGGTGCAGGTGG - Intergenic
928225254 2:29442973-29442995 CAGTGTGATGAAGTTGCAGGGGG + Intronic
928477193 2:31640686-31640708 CAGTGGCACTATGCTGCAGGAGG - Intergenic
928680790 2:33700273-33700295 CAGTGGGAGGAGGGTGCAGGTGG - Intergenic
931285733 2:60830052-60830074 GAGAGGGAGAAGGGTGCAGGGGG + Intergenic
931485085 2:62682842-62682864 CAGTGAGTGGAGGGTGCAGTGGG - Intronic
932411285 2:71549446-71549468 TAGAGGGGCGAGGGTGCTGGAGG + Intronic
932504893 2:72219255-72219277 CAGTGGCAAGAGGGAGCAAGGGG + Intronic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
933979457 2:87538539-87538561 CAGGGGGACGAGGGGGCGGCTGG - Intergenic
934532887 2:95106665-95106687 GATGGGGAGGAGGGTGCAGGTGG - Intronic
934576629 2:95405846-95405868 CAGAGCGGGGAGGGTGCAGGGGG - Intronic
934794800 2:97091397-97091419 CAGAGCGGGGAGGGTGCAGGGGG + Intronic
936314366 2:111412252-111412274 CAGGGGGACGAGGGGGCGGCTGG + Intergenic
937221064 2:120343630-120343652 CGGTGGGAGGCGGGGGCAGGAGG + Intergenic
938137463 2:128770845-128770867 CAGTGGGAAAGGGGTGCAGGGGG - Intergenic
939453451 2:142401493-142401515 CAGTGGTACTGGGGTCCAGGTGG - Intergenic
939878795 2:147606788-147606810 AAGTGGGAGGAGGTAGCAGGAGG + Intergenic
943439945 2:187916127-187916149 CAGTTGGACAGGGTTGCAGGAGG + Intergenic
946219727 2:218216485-218216507 CTGTGGGACGTGGGGGCAGCTGG - Intergenic
946241272 2:218357417-218357439 CTGTGGGATGAGGAGGCAGGTGG + Intronic
946959719 2:224971287-224971309 CAGTGGGAAGAGGGTGTGGTTGG + Intronic
947141956 2:227027479-227027501 GAGTGGGAGGAGGGGGGAGGGGG + Intronic
947429143 2:230010377-230010399 CAGTGGGGTGGGGGTGAAGGTGG + Intronic
947818099 2:233051520-233051542 AAGTAGGAGGAGGGGGCAGGAGG + Intergenic
948046530 2:234950521-234950543 CAGTGAGGCGAAGGGGCAGGTGG - Intergenic
948449631 2:238061042-238061064 CAGTGGGGCGGGGATGGAGGCGG + Exonic
948459867 2:238123877-238123899 CAGTGGGGTGAGGGTCCTGGAGG + Intronic
948663970 2:239523244-239523266 CAGGGCCACGAGGGTGCAGTGGG + Intergenic
948910494 2:240999991-241000013 CAGTGGGTTGAGGCTGGAGGTGG - Intronic
948924821 2:241088709-241088731 CAGTGGGAGGAAGAGGCAGGGGG + Exonic
948936367 2:241167544-241167566 CAGGGAGGCCAGGGTGCAGGAGG - Intronic
949009130 2:241668441-241668463 CAGTGTGATGTGGGTGCAGTGGG + Intronic
1168842221 20:916845-916867 CAGAGGGAGGAAGGTGCAGCGGG - Intergenic
1169119094 20:3084633-3084655 CAGTAGGCCGAGGAAGCAGGCGG + Exonic
1169208149 20:3751475-3751497 CGGGGGGACGCGGGTGAAGGGGG - Intronic
1170782423 20:19437812-19437834 CAGGGGGAACAGGGTGGAGGAGG - Intronic
1172323438 20:34015964-34015986 CAGTGGGACAGGGGTGTAAGAGG - Intronic
1172442832 20:34977981-34978003 CAGTGGCACTGGGGTGAAGGAGG - Exonic
1174548048 20:51341394-51341416 AAGTGTCACGAGGGTGCAGCTGG - Intergenic
1174624329 20:51901825-51901847 CAGTAGGAGGAGGTTGCAGTGGG - Intergenic
1175260831 20:57673138-57673160 CAGTGCGGCCAGGGTGCTGGCGG - Intronic
1175510356 20:59520008-59520030 AAGTGGGACAAGGGCTCAGGTGG - Intergenic
1175518961 20:59587558-59587580 CTGTGGGTCAGGGGTGCAGGTGG + Intronic
1175697514 20:61113695-61113717 CAGTAGGATGAGGGGGCAGAAGG - Intergenic
1175885485 20:62288126-62288148 CATGGGGATGAGGGTGGAGGGGG + Intronic
1176026087 20:62986349-62986371 CAGGTGGACTGGGGTGCAGGTGG + Intergenic
1176026103 20:62986398-62986420 AGGTGGGCAGAGGGTGCAGGTGG + Intergenic
1176026154 20:62986589-62986611 AGGTGGGCAGAGGGTGCAGGTGG + Intergenic
1176026184 20:62986671-62986693 CGGGTGGACTAGGGTGCAGGTGG + Intergenic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1179575738 21:42307209-42307231 CAGTGGGATGGGGGAGCAGAGGG + Intergenic
1179788669 21:43743392-43743414 GAGAGGGAGGTGGGTGCAGGCGG - Intronic
1179907666 21:44432592-44432614 CAGGAGGACCCGGGTGCAGGAGG - Intronic
1180081731 21:45490358-45490380 TGGTGGGCCCAGGGTGCAGGGGG + Intronic
1180635189 22:17258327-17258349 ACGGGGGAGGAGGGTGCAGGTGG - Intergenic
1180824832 22:18855036-18855058 CAGTGGGACGGGGGTGGGGTGGG + Intronic
1180968303 22:19801865-19801887 CACTTGGAGGCGGGTGCAGGGGG - Intronic
1181392420 22:22593441-22593463 CAGATGGAGCAGGGTGCAGGAGG + Intergenic
1181845792 22:25707785-25707807 AAGTGGGATGGGGCTGCAGGTGG + Intronic
1181961553 22:26625451-26625473 CAGAGGGTAGAGTGTGCAGGAGG - Intronic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182268163 22:29135541-29135563 GAGTGGCATGAGTGTGCAGGAGG - Intronic
1182711996 22:32328989-32329011 CAGTAGGAAGAGGAAGCAGGAGG - Intergenic
1183083963 22:35475135-35475157 CAGTGGGAGGTGGGTGGATGGGG + Intergenic
1183281847 22:36936465-36936487 GAGGGTGACGGGGGTGCAGGAGG - Intronic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183594482 22:38802388-38802410 CAATGGGAGCATGGTGCAGGAGG - Intergenic
1184053055 22:42023256-42023278 CAGGGGGTCGAGGCTGCAGGGGG - Intronic
1184257202 22:43294158-43294180 CAGTGGGAAAAGGGTGCAGAGGG - Intronic
1184274730 22:43403922-43403944 CAGTGGGCAAAGGGAGCAGGTGG + Intergenic
1184317119 22:43703091-43703113 CAGTTGGACAGGGTTGCAGGAGG - Intronic
1184399540 22:44265873-44265895 CAGTAGGAAGAGGAAGCAGGAGG - Intronic
1185049851 22:48548326-48548348 CGGCGGGGCGAGGGAGCAGGAGG - Intronic
1185281754 22:49972645-49972667 CAGTGGGACCAGGGAGGAGGAGG - Intergenic
1185296225 22:50056650-50056672 CAGTGGGATCGGGGTACAGGAGG + Intronic
1203274978 22_KI270734v1_random:80941-80963 CAGTGGGACGGGGGTGGGGTGGG + Intergenic
949875973 3:8626386-8626408 CAGGAGGAAGGGGGTGCAGGTGG - Intronic
950444715 3:13029946-13029968 AGGTGGGACGAGGGTGGAGCTGG - Intronic
950759481 3:15207729-15207751 CAGTGGGACAAGATTGGAGGTGG - Intronic
952272657 3:31847915-31847937 CTGTGGGACGAGGAGCCAGGGGG + Intronic
953551666 3:43908178-43908200 GAGGGGGACTTGGGTGCAGGTGG + Intergenic
953990279 3:47478052-47478074 CAGTGGGCCCAGGGCTCAGGAGG - Intergenic
954309435 3:49753399-49753421 AAGGGGGTGGAGGGTGCAGGTGG - Intronic
954391005 3:50267894-50267916 GAGTGGGACAAGGTTCCAGGTGG - Intronic
954647480 3:52140438-52140460 CGGTGGCAGGAGGGTGCAGAAGG + Intronic
954785086 3:53086880-53086902 AAGTGAGACGGGTGTGCAGGGGG - Intronic
955108546 3:55924673-55924695 CTGTGGGGAGAGGGAGCAGGGGG + Intronic
955552726 3:60101325-60101347 CAGTGAGCCCAGGGTGCAGGAGG - Intronic
959751376 3:109840318-109840340 CAGTGGGGCAAAGGTGCAGGGGG - Intergenic
964814358 3:160701000-160701022 CAGTGTGGAGAGGGTGCTGGGGG + Intergenic
965619570 3:170629405-170629427 CACTGGGACTGTGGTGCAGGGGG + Intronic
966911307 3:184561915-184561937 CCGGGGCAGGAGGGTGCAGGTGG - Exonic
967107011 3:186262219-186262241 ATGTGGGACCAGGGTTCAGGAGG - Intronic
968564543 4:1304080-1304102 CAGGGGGAGGAGGGTGCGTGGGG - Intronic
968741147 4:2332375-2332397 CAGGGGCACGTTGGTGCAGGTGG - Intronic
970073839 4:12195397-12195419 CAGAGGGGCCAGGATGCAGGAGG + Intergenic
972933550 4:44104292-44104314 GTGTGGGAGCAGGGTGCAGGTGG + Intergenic
974047335 4:56908585-56908607 CGGTGGGACCCGGGGGCAGGAGG - Intronic
974557716 4:63473004-63473026 CAGTGGGACAAGCTGGCAGGTGG + Intergenic
975195029 4:71514320-71514342 CAGGAGGAAGAGGGTGAAGGGGG - Intronic
975361615 4:73477304-73477326 CAGTGTGGAGAGGGAGCAGGTGG + Intergenic
975909227 4:79248268-79248290 CAGTTGGGGGAAGGTGCAGGCGG - Intronic
976902659 4:90197789-90197811 TAGTGGGAGGTGGGTGGAGGTGG + Intronic
979253177 4:118586389-118586411 GACTGGGAGGAGGGTGCAGAGGG - Intergenic
981259926 4:142707565-142707587 CAGGAGGAAGAGGGTGAAGGGGG - Intronic
982239356 4:153283213-153283235 TAGTGGGAGGAGGGAGTAGGAGG - Intronic
982840246 4:160175103-160175125 CAGTGGGAGGAGGTTGGAGTCGG - Intergenic
984825876 4:183924307-183924329 CAGTGGGATGAGGGTGATGATGG + Intronic
986921195 5:12684045-12684067 AAGTGGGATAAGGGTGCAGTAGG - Intergenic
987423041 5:17743454-17743476 GAGTGGGATTAGGGTACAGGTGG - Intergenic
988849483 5:35164752-35164774 CAGTGGAACCAGGCTGCTGGAGG + Intronic
989239021 5:39182230-39182252 CAGTGTGAACAGAGTGCAGGTGG + Intronic
991974339 5:72171514-72171536 CAGGAGGTCGAGGCTGCAGGGGG + Intronic
993065721 5:83095337-83095359 CAGTTGGACAGGGTTGCAGGAGG + Intronic
995060870 5:107810456-107810478 CTGAAGGAGGAGGGTGCAGGTGG + Intergenic
995069670 5:107904934-107904956 CAGGAGGAGGAGGGTGAAGGTGG + Intronic
996245915 5:121263630-121263652 CAGTTGGAGGAGAGTGCGGGTGG + Intergenic
997560858 5:134845302-134845324 CAGTGGGAAGAGGCTAGAGGAGG - Intronic
999375339 5:151082561-151082583 CAGTGGGTAGAGGGTGGGGGTGG - Intronic
999563665 5:152833557-152833579 CAGGGGGAAGAGGGTAAAGGGGG + Intergenic
1002184809 5:177449369-177449391 CAGTAGGACCAGGGTGCCGAGGG - Intronic
1002196285 5:177503458-177503480 CAGTGGGGGCGGGGTGCAGGTGG - Intronic
1002525134 5:179811364-179811386 CAGGGGGAGGAGCATGCAGGGGG + Intronic
1002567421 5:180119722-180119744 CAGAGGGAGGAGGGCGCTGGAGG - Intronic
1002910704 6:1489037-1489059 CAGTAGGAAGAGAGTGAAGGGGG - Intergenic
1003016225 6:2469508-2469530 CTGTGGGACGTGGGAGCAGTGGG + Intergenic
1005393850 6:25361380-25361402 GGGTGGGAGGAGTGTGCAGGGGG - Intronic
1006502051 6:34465589-34465611 CAGTGGGGCGGTGGTGCAGGGGG + Intergenic
1007634121 6:43287723-43287745 CAGGGGGAGGAGGCTGCAGCTGG - Exonic
1007649892 6:43412862-43412884 GAGGGGGACGAGGCAGCAGGGGG - Intergenic
1007727738 6:43926860-43926882 CAGAGGGAGGAGGGAGCAGCAGG - Intergenic
1008104695 6:47428928-47428950 CAGTGTCATGAGGCTGCAGGGGG + Intergenic
1008251958 6:49251079-49251101 CAGTGGGTGGAGGTTGCAGTGGG + Intergenic
1008288192 6:49680144-49680166 CAGAGGGTGGAGGATGCAGGAGG - Intergenic
1008838653 6:55869802-55869824 CAGTGGGTGGAGGCTGCAGTTGG + Intronic
1010004733 6:70983429-70983451 CAGTGGGGCCAGGGTGGAGATGG - Intergenic
1010569969 6:77464137-77464159 CCGTGGGACCAGGGTGGCGGTGG - Intergenic
1010756242 6:79669136-79669158 CAGAAGGACCAGCGTGCAGGAGG - Intronic
1010767513 6:79793101-79793123 CAGTGGGAAGGGTGTCCAGGTGG - Intergenic
1015189899 6:130461093-130461115 CAGTGGGAGGAAGTGGCAGGTGG - Intergenic
1017763506 6:157589173-157589195 CAGGAGGAAGAGGGTGCAAGGGG + Intronic
1018049528 6:159996997-159997019 CAGTGGGTAGAGGGTGGGGGAGG + Intronic
1018542891 6:164902134-164902156 AAGTGGAAAGAGGGTGGAGGTGG + Intergenic
1018631486 6:165826471-165826493 CAGAGGGACGTGGGGACAGGTGG - Intronic
1018897144 6:168027601-168027623 CTGTGGGAGGTGGGTGCTGGGGG + Intronic
1019455218 7:1123317-1123339 CTGTGGGAAGAGGCTGCACGGGG + Intronic
1019502890 7:1374008-1374030 CAGGAGGAAGAGGGTGAAGGGGG + Intergenic
1019626989 7:2021079-2021101 CAGTGGGATGACCGTGAAGGTGG + Intronic
1019729541 7:2622661-2622683 CAGGGGGAGGTGGGGGCAGGAGG - Intergenic
1019729552 7:2622686-2622708 CAGGGGGAGGTGGGGGCAGGAGG - Intergenic
1021363987 7:19753307-19753329 GAGTGGGAGTAGGGTGCTGGTGG - Intronic
1022235341 7:28455339-28455361 GAGTGGAACAAGGGTGAAGGTGG + Intronic
1022249603 7:28594090-28594112 CACTGGGAGGTGGGGGCAGGGGG - Intronic
1024517511 7:50271952-50271974 AAGAGTGACGAGGGTGGAGGAGG + Intergenic
1024680391 7:51680842-51680864 CAGTGGGAAGAGGTTGCATGCGG + Intergenic
1029269832 7:99370491-99370513 CTGTGGGACGGGTGGGCAGGTGG + Intronic
1030464681 7:109885604-109885626 CATTGGGAGGAGGTTGGAGGAGG + Intergenic
1031547508 7:123068405-123068427 CAGTGGGTGGAGGCTGCAAGTGG + Intergenic
1032086337 7:128885761-128885783 GTGTGGGACGAGGGGGCAGTGGG + Intronic
1032999957 7:137492950-137492972 CAGTGGTGGGAGGGTGCGGGTGG - Intronic
1034456695 7:151174579-151174601 CTCTGGGACGCGGGTGCGGGTGG - Intronic
1034461272 7:151199307-151199329 CCGCGGGGCGGGGGTGCAGGCGG - Intronic
1035026661 7:155830920-155830942 GAGTGGGCTGAGCGTGCAGGGGG + Intergenic
1036202971 8:6784623-6784645 GAGTGGGATGATGGTGGAGGAGG - Intergenic
1036498710 8:9294288-9294310 CAGAGAGAGGAAGGTGCAGGCGG - Intergenic
1038258775 8:25974740-25974762 CAGTAGGATGGGGGGGCAGGGGG - Intronic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1041378008 8:57221910-57221932 CAGTTGGAAGAGGGTGTAGTGGG + Intergenic
1042006171 8:64182682-64182704 CAGTGGGAGGAGGAAGCGGGTGG - Intergenic
1042530176 8:69806639-69806661 CAGTGGGAAGGGAGTGGAGGTGG - Intronic
1043145532 8:76648861-76648883 CAGGAGGAAGAGTGTGCAGGGGG - Intergenic
1044414687 8:91924012-91924034 CAGTGGGACAAGATTGGAGGTGG + Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048278585 8:133087773-133087795 CAGTGGGGCCAGGCAGCAGGAGG + Intronic
1049292708 8:141812978-141813000 CAGGGAGATGAGGGTGCTGGGGG - Intergenic
1049292716 8:141813002-141813024 CAGGGAGATGAGGGTGCTGGGGG - Intergenic
1049292773 8:141813163-141813185 CAGGGAGATGAGGGTGCTGGGGG - Intergenic
1049292797 8:141813233-141813255 CAGGGAGATGAGGGTGCTGGGGG - Intergenic
1049292855 8:141813391-141813413 CAGGGAGATGAGGGTGCTGGAGG - Intergenic
1049292861 8:141813415-141813437 CAGGGAGATGAGGGTGCTGGGGG - Intergenic
1049292947 8:141813642-141813664 CAGGGAGATGAGGGTGCTGGGGG - Intergenic
1049354767 8:142182252-142182274 AAGTGGGAAGAGAGTGCAGCTGG + Intergenic
1049365437 8:142234723-142234745 TAATGGGATGAGGGAGCAGGTGG - Intronic
1049425922 8:142537849-142537871 CAGGGGCACAAGGCTGCAGGAGG - Intronic
1053382636 9:37661242-37661264 CAGAGGCAGGAGGGTGCAGGGGG + Intronic
1053480547 9:38413434-38413456 CAGTGGGAGGAGGAGGAAGGAGG - Intronic
1053664208 9:40306060-40306082 CAGTGGGAGGTGGGTGTGGGAGG + Intronic
1053665175 9:40312265-40312287 CAGTGGGAGGTGGGTGTGGGAGG + Intronic
1053914754 9:42937312-42937334 CAGTGGGAGGTGGGTGTGGGAGG + Intergenic
1054519442 9:66064019-66064041 CAGTGGGAGGTGGGTGTGGGAGG - Intergenic
1054520408 9:66070225-66070247 CAGTGGGAGGTGGGTGTGGGAGG - Intergenic
1054810927 9:69433269-69433291 CAGTGACCCGAGGTTGCAGGCGG + Intronic
1055131377 9:72778907-72778929 CAGAGGGGGGAGGCTGCAGGTGG - Intronic
1056283071 9:85061463-85061485 CAGTGGGAGGAGGATGCATATGG + Intergenic
1057164003 9:92912469-92912491 CAGTGGGATGAGGGGCAAGGAGG + Intergenic
1057327411 9:94078001-94078023 CAGGGGGACTAGGGTGAAAGTGG - Intronic
1058709610 9:107667854-107667876 CAGTGGGACAATGATGCAGTGGG - Intergenic
1059829896 9:118083469-118083491 CAGGGGGACGGGGGAGCAGGTGG + Intergenic
1059948105 9:119433571-119433593 CAGTAGGTTGAGGGTGCAAGAGG - Intergenic
1060814073 9:126625714-126625736 CGGTGGGACGAGGGTGGCGGCGG - Intronic
1061153951 9:128845921-128845943 CAGAGGCTGGAGGGTGCAGGAGG + Intronic
1061246192 9:129402237-129402259 GAGAGGGAAGAGGGTGAAGGAGG - Intergenic
1061669771 9:132182296-132182318 TAGAGGGTGGAGGGTGCAGGGGG + Intronic
1061942457 9:133891148-133891170 CCGGGGGACAAGGGTGCAGGGGG + Intronic
1062230671 9:135479966-135479988 ACGTGGGACGCGGGCGCAGGCGG + Exonic
1062238542 9:135524051-135524073 CATGGGGAAGAGGGTGCAGGAGG - Intronic
1062495458 9:136829480-136829502 CAGTGGTAAGAGGGAGCTGGCGG + Exonic
1185603670 X:1355181-1355203 GAGGGGGAGGAGGGTGGAGGGGG + Intronic
1185603678 X:1355197-1355219 GAGGGGGAGGAGGGTGGAGGGGG + Intronic
1185603686 X:1355213-1355235 GAGGGGGAGGAGGGTGGAGGGGG + Intronic
1187328591 X:18315016-18315038 CAGGGGGCAGAGGTTGCAGGCGG + Intronic
1188734588 X:33696737-33696759 GAGAGGGAAGAGGGTGCAAGGGG + Intergenic
1189906720 X:45768480-45768502 GAGTGGGATGAGGGTGGGGGAGG - Intergenic
1190065525 X:47239328-47239350 CTGTGGGGCGGGGGTGGAGGTGG - Intronic
1190082168 X:47365186-47365208 CTTTGGGAAGAGGGTGCAGGAGG - Intergenic
1190301304 X:49059111-49059133 CAGTGGGCCCAGGGTGCGAGGGG + Intronic
1192215635 X:69156333-69156355 CAGTGGGACTAGGATGGATGGGG + Intergenic
1194310556 X:92301099-92301121 CAGTGGGGAGAGGGTGCAGTTGG + Intronic
1195144511 X:101999899-101999921 CAGCGGGAGAAGGGTGTAGGTGG - Intergenic
1195289106 X:103414396-103414418 CAGTCGGGGGAGGATGCAGGTGG + Intergenic
1195703816 X:107724225-107724247 CAGTGGCAGGAGGAGGCAGGGGG + Intronic
1196434773 X:115664944-115664966 CAGTAACACGAGGATGCAGGAGG - Intergenic
1196529752 X:116771672-116771694 CAGTAGGATGAGGCTGCAGTGGG + Intergenic
1196577374 X:117335176-117335198 CAGAGGGAGGAGGGAGAAGGGGG - Intergenic
1196666490 X:118322413-118322435 CAGGAGGTCGAGGCTGCAGGGGG + Intergenic
1197093912 X:122571783-122571805 TTGTGGGGGGAGGGTGCAGGTGG - Intergenic
1199640740 X:149858622-149858644 CAGTGGGGAGAGTGTACAGGTGG - Intergenic
1199743445 X:150757079-150757101 GAGAGGGATGAGGGAGCAGGAGG - Intronic
1199762135 X:150913029-150913051 CAGTGGGACCAGGGAGCAGCTGG - Intergenic
1200023630 X:153234631-153234653 CACTGTGACGAGGGAGCAGTGGG - Intergenic
1200312294 X:155089867-155089889 CAGTGGGCAGAGGGTGTGGGTGG + Intronic
1200618839 Y:5415385-5415407 CAGTGGGGAGAGGGTGCAGTTGG + Intronic
1201424376 Y:13832241-13832263 CAGCAGGATGCGGGTGCAGGTGG + Intergenic