ID: 1168637541

View in Genome Browser
Species Human (GRCh38)
Location 19:58008295-58008317
Sequence CAGTGGTCATAGAGGCAATA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168637533_1168637541 16 Left 1168637533 19:58008256-58008278 CCCTGGTGTGAGGGCCTGCCTAG 0: 1
1: 0
2: 2
3: 11
4: 120
Right 1168637541 19:58008295-58008317 CAGTGGTCATAGAGGCAATAAGG 0: 1
1: 0
2: 0
3: 2
4: 139
1168637537_1168637541 2 Left 1168637537 19:58008270-58008292 CCTGCCTAGTCAGCTGCGGGAAC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1168637541 19:58008295-58008317 CAGTGGTCATAGAGGCAATAAGG 0: 1
1: 0
2: 0
3: 2
4: 139
1168637538_1168637541 -2 Left 1168637538 19:58008274-58008296 CCTAGTCAGCTGCGGGAACAACA 0: 1
1: 0
2: 1
3: 3
4: 72
Right 1168637541 19:58008295-58008317 CAGTGGTCATAGAGGCAATAAGG 0: 1
1: 0
2: 0
3: 2
4: 139
1168637534_1168637541 15 Left 1168637534 19:58008257-58008279 CCTGGTGTGAGGGCCTGCCTAGT 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1168637541 19:58008295-58008317 CAGTGGTCATAGAGGCAATAAGG 0: 1
1: 0
2: 0
3: 2
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168637541 Original CRISPR CAGTGGTCATAGAGGCAATA AGG Exonic
901016393 1:6234211-6234233 CATAGGTCACAGAGGCATTATGG + Intronic
902070982 1:13737415-13737437 CAGTGGTGATGGAGACCATATGG + Intronic
902272245 1:15313015-15313037 CAGAGGTCAAAGAGGCAGTGAGG - Intronic
903473925 1:23606581-23606603 CAGTGGTCAGGGAGGCATTCTGG - Intronic
907856539 1:58309079-58309101 CAGTGCTCAAAGAGGCTCTAAGG - Intronic
913689206 1:121262418-121262440 GAGTGGAGATAGAGGCAATTAGG + Intronic
913711017 1:121483523-121483545 CTGTGGTCATAGGTACAATATGG - Intergenic
914148393 1:145017863-145017885 GAGTGGAGATAGAGGCAATTAGG - Intronic
917350628 1:174073666-174073688 CATTGCTCATAAAGGCAATTTGG + Intergenic
919010979 1:191962929-191962951 AAGTGGTCATGGAGGCAAACAGG - Intergenic
920476529 1:206280893-206280915 GAGTGGAGATAGAGGCAATTAGG + Intronic
920933204 1:210407934-210407956 CAGTGGTCAAATAGGGAATTTGG + Intronic
922962956 1:229663794-229663816 CAGTGGTCATGGTGGCAACGGGG - Intergenic
1064994234 10:21282384-21282406 CTTTGGTCACAGAGGCAAAAGGG + Intergenic
1065269544 10:24013471-24013493 CATTGCTCCTAGAGGAAATACGG - Intronic
1066442055 10:35448724-35448746 GAGTGGTCAGAGAGGCAGCAGGG + Intronic
1066519396 10:36198808-36198830 CAGTGGACATAGTGGCAGGAAGG - Intergenic
1069560183 10:69423656-69423678 CAGTGGTCAAGAAGGCCATATGG - Intergenic
1069621453 10:69840039-69840061 CAGTGGTGACAGAGGAAATGGGG + Intronic
1074283599 10:112077069-112077091 CAGTGGACTAAGAGGCTATATGG - Intergenic
1077405686 11:2381566-2381588 CTTTGCTCATAGAGTCAATAAGG + Intronic
1077452484 11:2657102-2657124 CAGTGGTCATTAGGGCAATGTGG - Intronic
1077458433 11:2695013-2695035 CAGTGGTCAGAGAGGTAAGCAGG + Intronic
1077668280 11:4135616-4135638 CAGAGATCCTAGAAGCAATAAGG - Intronic
1080144475 11:28964275-28964297 AATTTGTCATTGAGGCAATAAGG - Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1084079581 11:66812590-66812612 CAGTGGGCACTGAGGCATTATGG - Intronic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088706849 11:112471567-112471589 CTGTGGTCAAGGAGGCAGTATGG - Intergenic
1090492506 11:127177152-127177174 CTGTGGTCCTGGAGGCAATGTGG + Intergenic
1091330377 11:134727295-134727317 CAGTGGTCAAAGAGCCAAGGGGG - Intergenic
1093192322 12:16089298-16089320 AAATGGTTATAGTGGCAATATGG + Intergenic
1095739205 12:45588594-45588616 TAGTTGTCTTAGAGGCAGTATGG - Intergenic
1096953072 12:55495742-55495764 CAGAGGTCCATGAGGCAATAAGG - Intergenic
1104305539 12:127607586-127607608 TAGTGGTGATAGAGGCCAGAGGG + Intergenic
1107524162 13:41213805-41213827 CAGTGGTGGCAGAGGCCATAGGG - Intergenic
1109229878 13:59743672-59743694 CAGTTGTCATAGAATCAAAAGGG - Intronic
1110742038 13:79008777-79008799 AAATGGGCATAGAGGTAATAAGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1115920747 14:38370585-38370607 AATTGGTCTTAGAGGAAATATGG - Intergenic
1116264499 14:42669906-42669928 CAGTGGTTATAGAGGACAAAGGG + Intergenic
1119596867 14:75943122-75943144 TCGTGGTCATAGAGGCAGTGAGG + Intronic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1124879503 15:33628262-33628284 CAATGGTCAGAGAGACAACAAGG + Intronic
1128893579 15:71352756-71352778 CAGGGCTCATAAAAGCAATATGG - Intronic
1131290548 15:91103013-91103035 CTGAGGTCATAGGGGCAACACGG + Intronic
1133697967 16:8282845-8282867 AAGTGGTAATTTAGGCAATAAGG - Intergenic
1137540453 16:49358151-49358173 CTCTGGTCACACAGGCAATAAGG - Intergenic
1138865600 16:60815516-60815538 CAGAGCTTATAGAGGCACTAGGG - Intergenic
1139060390 16:63243641-63243663 CAGAAGTCATTGAGGCCATAGGG - Intergenic
1141621126 16:85236948-85236970 CAGTGGTCATAAATGCACTCAGG - Intergenic
1142691405 17:1608045-1608067 CAGTCGTGACAGAGGCCATATGG - Intronic
1149538047 17:57447631-57447653 CAGTTGTCAAAGAGGGAAAAGGG - Intronic
1149605527 17:57922290-57922312 CAAAGGTCATAGAGGAAACAGGG - Intronic
1153599114 18:6761636-6761658 CAGTGGTCAGTGAGGGAATTGGG + Intronic
1153950038 18:10050778-10050800 CAGTGGTCCTAGAGATAACATGG + Intergenic
1156368681 18:36453208-36453230 CAGTTGCCATGGAGGCATTAGGG + Intronic
1159603704 18:70452903-70452925 CATTGGTCAAAGAGGCTGTAAGG + Intergenic
1160089818 18:75816289-75816311 CAGTGGTCATTGAAGCCACAGGG + Intergenic
1162584005 19:11547930-11547952 CAGAGGTCATAGAGGCCAGGAGG + Intronic
1165471379 19:36006685-36006707 CAGAGGTCATGGAGGCTATGAGG + Intronic
1165659681 19:37566157-37566179 CAATGGTCTTGGAGACAATATGG - Exonic
1166246377 19:41529926-41529948 CAGTTGTCATATGGGCCATATGG + Intergenic
1168637541 19:58008295-58008317 CAGTGGTCATAGAGGCAATAAGG + Exonic
930626713 2:53706926-53706948 CAGTGTTCCTAAAGACAATATGG - Intronic
931980308 2:67687237-67687259 CGGTGGTCATTGAGGTAAAATGG + Intergenic
935461492 2:103341142-103341164 CAGTTTTCATAGAGCCAGTATGG - Intergenic
935896592 2:107745496-107745518 CAGCAGTCATAGATGCACTAAGG - Intergenic
936698697 2:114983873-114983895 CTGTTGTCATACAGGCAGTAAGG + Intronic
939624853 2:144464005-144464027 AAGAGGTCATGGAGGTAATATGG + Intronic
939820115 2:146947156-146947178 CAGTGTTCATGGAAGCAAAATGG + Intergenic
945939880 2:215937744-215937766 CATTTGTAATAGAGGCAAAATGG - Intergenic
948267376 2:236644887-236644909 CTGTGGTCATGGGGGCAAGATGG - Intergenic
1172626118 20:36348038-36348060 TAGAGGTCATACATGCAATATGG - Intronic
1173221286 20:41135094-41135116 CAGTGGGCATGGAGGCTATCTGG - Intergenic
1173702978 20:45089423-45089445 CATGGGTCAGAGAGCCAATATGG - Intergenic
1175326199 20:58130009-58130031 ATGTGGTCATGGAGGCAACAGGG - Intergenic
1182908145 22:33956478-33956500 CAGTGCTCTCAGAGGCATTAGGG - Intergenic
950017718 3:9765959-9765981 CAGTGGTCACAGAACCCATAGGG - Exonic
953325922 3:42012943-42012965 CAGGGGTCATAGAGGACATTGGG - Intergenic
957898924 3:86462651-86462673 GAGTGGTGATAGAGGCAAACAGG - Intergenic
958702842 3:97615718-97615740 CATTGGTTAAAGAGGCAATCTGG - Intronic
959223645 3:103554127-103554149 CAGTGATGATAGAAACAATAAGG - Intergenic
959804000 3:110529187-110529209 CAGCAGTCAGAGAGGAAATAAGG + Intergenic
961343027 3:126242842-126242864 CCGTAGTCATTGAGACAATATGG + Intergenic
961445307 3:126977886-126977908 CAGTGGACGTAGGGGCAAGATGG - Intergenic
972832305 4:42828405-42828427 CAGTGGTCAAAGAGCCCAGATGG - Intergenic
973740742 4:53917072-53917094 CAGTGGGCAGAGAGGCAGTGGGG - Intronic
974312380 4:60229630-60229652 AAGTAGGCATAGAAGCAATATGG - Intergenic
974471200 4:62320077-62320099 CAGAGGACATAGAGGAAAGAAGG + Intergenic
975782486 4:77854128-77854150 TAGTGGTCTTGGAGGAAATAAGG - Intergenic
979077119 4:116285869-116285891 CTTTGGTCCTTGAGGCAATATGG - Intergenic
979446864 4:120823976-120823998 TAGTGGTCAAAGAGGGGATAAGG - Intronic
982959654 4:161821296-161821318 CACTGGTCATCGTGGCAATTTGG - Intronic
983199211 4:164842956-164842978 CCATGGTCATAAAGGCAGTAAGG - Intergenic
984690815 4:182723854-182723876 CAGTCGCCATAGAGACTATATGG + Intronic
986989538 5:13535400-13535422 CAGGGGTCATGGAGGCTAAATGG + Intergenic
991327620 5:65454499-65454521 CAGAGGTCATGGAGGCCATCTGG - Intronic
996117789 5:119636787-119636809 CTGTGGTAATAGAGGAAATTTGG - Intronic
996298170 5:121949123-121949145 CTAAGGTCATAGAGGTAATAAGG - Intergenic
996628755 5:125602443-125602465 TAGTTGTCAGAGAGGCATTATGG + Intergenic
998587973 5:143448325-143448347 CAGAGGTCACAGAGGTCATAAGG + Intergenic
999352851 5:150893314-150893336 CAGTGGTAATTAAGGCAATGTGG - Intronic
1000107107 5:158070247-158070269 CACTGGTCATGGTGGCAACATGG - Intergenic
1001865886 5:175105057-175105079 CAGTTGCCCTGGAGGCAATAAGG - Intergenic
1003819387 6:9878800-9878822 CTGTGGTGCTAGAAGCAATATGG - Intronic
1007818960 6:44545850-44545872 CAGTGGTAATAGAGGGAATCTGG - Intergenic
1008599906 6:53082174-53082196 TAGTGTTAATAGATGCAATATGG + Intronic
1012617904 6:101300424-101300446 CAGTGGTTATAGAACCAAGAAGG - Intergenic
1013573225 6:111451131-111451153 CAGAGGTCATAGAAGAAAAAGGG + Intronic
1014829141 6:126080884-126080906 TAGGGGTCATAGAGCCAATGTGG - Intergenic
1016432682 6:144004124-144004146 TAGTTGTTATAGAGGCCATATGG - Intronic
1016725092 6:147354930-147354952 CATTGGTCAGGGAGGCAATGGGG + Intronic
1018901652 6:168054642-168054664 CAGAGGTCTTTTAGGCAATACGG - Intergenic
1021273176 7:18617322-18617344 GAGAGGTCAGAGAGGGAATAAGG - Intronic
1022798609 7:33753437-33753459 CAGTGGGCAAAGAGGCAGGAGGG - Intergenic
1023560856 7:41471816-41471838 CAGTGGTGATGGAGGACATATGG + Intergenic
1024251118 7:47506378-47506400 CTTTGGTCATAGAGGCCATCGGG + Intronic
1028279857 7:88909853-88909875 CAGTGGACATAAAGGTAATTAGG - Intronic
1028584500 7:92439646-92439668 CAGAGCTCATAGAGACAATTTGG - Intergenic
1028709845 7:93894279-93894301 CTGTGGTCATAGAGGTTTTAAGG - Intronic
1031447835 7:121875886-121875908 CAGTGTTCTTAGAGCCAATGAGG + Intronic
1032144401 7:129366154-129366176 CTGTGGTCATAGAGGAGCTATGG - Intronic
1032275211 7:130448514-130448536 GAGAGGACAGAGAGGCAATAGGG + Intergenic
1036373991 8:8184429-8184451 CAGTGGCCATCGAGGCAGGATGG + Intergenic
1036876912 8:12481210-12481232 CAGTGGCCATCGAGGCAGGATGG - Intergenic
1037166868 8:15840900-15840922 CAGTGCTCATATAGGAATTAAGG + Intergenic
1039603267 8:38859857-38859879 CAGTTGTAACAGAGGCCATATGG + Intergenic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1049130198 8:140832680-140832702 CTGTGGACAAAGAGGCAACAGGG + Intronic
1049249193 8:141579076-141579098 CAGTGGACATAGAGAAAACACGG + Intergenic
1052247991 9:26361635-26361657 CAGTGCGCCTAGAGTCAATAAGG - Intergenic
1055596277 9:77868055-77868077 CCCTTGTCATAGATGCAATAAGG + Intronic
1056237660 9:84611297-84611319 CATTGGACTTTGAGGCAATATGG + Intergenic
1056361623 9:85863369-85863391 CGGTGGTAATTGAGACAATAAGG - Intergenic
1058197692 9:101999118-101999140 AAGTGGCCAGAGAGGCAATAAGG + Intergenic
1058414696 9:104775457-104775479 CAGAGGTCAAAGAGACAAGATGG - Intronic
1060450606 9:123735195-123735217 AAATGGTCATAGTGGAAATAGGG - Intronic
1192672610 X:73161633-73161655 CAGTGGTTGTAGTGGCAACATGG - Intergenic
1200970854 Y:9150850-9150872 CAGTGGTGCTAGAGGAATTAAGG + Intergenic
1202140177 Y:21713463-21713485 CAGTGGTGCTAGAGGAATTAAGG - Intergenic