ID: 1168641411

View in Genome Browser
Species Human (GRCh38)
Location 19:58034142-58034164
Sequence CACCGCGCGCGGGCTTCGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168641411_1168641423 25 Left 1168641411 19:58034142-58034164 CCGAGCGAAGCCCGCGCGCGGTG 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1168641423 19:58034190-58034212 CCGCCCGCCAGAGCGTCCATCGG 0: 1
1: 0
2: 0
3: 6
4: 44
1168641411_1168641424 26 Left 1168641411 19:58034142-58034164 CCGAGCGAAGCCCGCGCGCGGTG 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1168641424 19:58034191-58034213 CGCCCGCCAGAGCGTCCATCGGG 0: 1
1: 0
2: 0
3: 4
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168641411 Original CRISPR CACCGCGCGCGGGCTTCGCT CGG (reversed) Exonic
904773317 1:32893102-32893124 CACCGAGCGCGGGCCGCCCTGGG + Intronic
910773378 1:90851550-90851572 AGCCGCGCGGGGACTTCGCTGGG + Intergenic
910897054 1:92080391-92080413 CACCGCGGTCCGGCTTCTCTGGG + Exonic
911548839 1:99255080-99255102 CACCGCGCCCGGCCTGGGCTGGG - Intergenic
918282772 1:183023017-183023039 CTCCCCGCGCGGGAGTCGCTGGG - Intergenic
919403233 1:197146369-197146391 CCCCGCGGGCGGCCTCCGCTCGG + Exonic
920458302 1:206117344-206117366 CAGAGCGAGCGGGCTTGGCTGGG - Exonic
921029733 1:211326861-211326883 CTCGGCGCGCGGGCTCCGCGAGG - Exonic
921201418 1:212810219-212810241 CACCGCGCCCTGCCTTCACTCGG - Intronic
923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG + Intronic
1065531597 10:26675703-26675725 CACCGCGCCCGGCCTTAACTAGG - Intergenic
1078986735 11:16605286-16605308 CGCCGGGCGCGGACTTCGCCAGG - Intronic
1079251530 11:18791266-18791288 AACCGCGCACGGGCTTCGTGGGG + Intronic
1081518059 11:43853048-43853070 CACCGCGCCCGGCCGTCTCTGGG - Intronic
1081995414 11:47360537-47360559 CACCGCGCGCGGCCCTGGCTGGG - Intronic
1083951802 11:65960692-65960714 CACCGCGCCCGGCCTGCACTGGG + Intergenic
1096365735 12:51026886-51026908 CACCGCGCCCGGCCTTTGCTTGG - Intronic
1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG + Intronic
1101131811 12:101697812-101697834 CGCCAGGCGCGGGCTGCGCTCGG + Exonic
1103756970 12:123215947-123215969 CACCGCGCCCGGCCTTCTCTTGG - Intronic
1103785661 12:123430985-123431007 CACCGCGCCCGGCCTACGCCTGG + Intronic
1110119378 13:71864828-71864850 CTCCGTGCGCGCGCTTTGCTGGG + Intronic
1122130841 14:99604010-99604032 CCCCGCGCCGGGGCTCCGCTGGG + Exonic
1124082595 15:26515799-26515821 CACCGCGCCCGGCCTGTGCTGGG - Intergenic
1129349714 15:74948382-74948404 CACCGCGCCCGGCCTCCTCTGGG - Intergenic
1130565157 15:84987763-84987785 CACCGCGCCCGGCCTTGGATTGG + Intronic
1131828844 15:96341690-96341712 CACCGCGCCCCAGCTCCGCTCGG - Intergenic
1136507504 16:30714350-30714372 CACCGCGCCCGGCCTACGCCCGG + Intronic
1136926620 16:34380949-34380971 CACCCTGCGCTGGCTTTGCTTGG + Intergenic
1136977954 16:35030858-35030880 CACCCTGCGCTGGCTTTGCTTGG - Intergenic
1138105868 16:54286928-54286950 CCCCGCGCGCGGGATCCGCGGGG - Intergenic
1142050038 16:87951880-87951902 AACCGCGCCCGGGCTCCTCTGGG + Intronic
1143496430 17:7315249-7315271 CACCGCGCGCGGGCGGCGCCGGG + Intronic
1149803156 17:59589507-59589529 CACCGCGCCCGGCCCTTGCTGGG + Intronic
1149843332 17:59985982-59986004 CACCGCGCCCGGCCCTTGCTGGG - Intergenic
1149896911 17:60435487-60435509 AGCGGCGCGCGGGCTTTGCTCGG + Intergenic
1152024418 17:77799394-77799416 CACCGCGCCCGGCCTTTGCGGGG - Intergenic
1158277045 18:55780186-55780208 CACCCCGCGCGGACTTGGCTGGG + Intergenic
1158301521 18:56058050-56058072 CACCGCGCCCGGCCTCCTCTGGG + Intergenic
1160719063 19:589748-589770 CCCCGCGCGCCGCCTCCGCTCGG - Intergenic
1161357594 19:3827561-3827583 CACCCCGCGCGGGCTCCCGTTGG + Exonic
1161942184 19:7412301-7412323 CACCGCGCCCGGCCTATGCTAGG + Intronic
1162555939 19:11385601-11385623 CACCGCGCCCGGCCTACGCCTGG - Intronic
1162706762 19:12560891-12560913 CACCGCGCCCGGCCTTCTGTAGG + Intronic
1168641411 19:58034142-58034164 CACCGCGCGCGGGCTTCGCTCGG - Exonic
925625412 2:5837906-5837928 CACCGCGCCCGGCCTAGGCTTGG + Intergenic
930375328 2:50558769-50558791 CACTGCGCTCGGCCTTCACTTGG - Intronic
931292150 2:60882384-60882406 CACCGCGCCCGGCCTACACTTGG - Intronic
931348916 2:61471071-61471093 CAGAGCGCTCGGGCTGCGCTCGG + Intergenic
948824659 2:240568423-240568445 CGCCCCGCTCGGGCTCCGCTCGG - Intronic
1170879609 20:20284571-20284593 CACCGCGCCCGGCCTTCAATTGG + Intronic
1173471786 20:43329657-43329679 CACCGCGCCCGGCCTTTTCTTGG - Intergenic
1173968326 20:47130799-47130821 CACCTCGCCCGGGCTTTGCATGG - Intronic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1177718909 21:24879017-24879039 CACCGCGCCCGGACTTAGATTGG + Intergenic
1178518986 21:33271438-33271460 CACCGCGCCTGGCCTTCACTAGG - Intronic
1178662542 21:34519683-34519705 CACCGCGCCCGGCCTGTGCTTGG + Intronic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1185245462 22:49770703-49770725 CACAGTGGGTGGGCTTCGCTAGG + Intergenic
956148155 3:66213109-66213131 CACCGCGCCTGGGCTGCGCCAGG - Intronic
966222605 3:177565683-177565705 CACCGCGCCCGGCCTCCTCTAGG + Intergenic
967811008 3:193761120-193761142 CACCGCGCCCGGCCTGCGCCAGG - Intergenic
987178921 5:15346133-15346155 CACCGCGCCCGGCCTCCGATAGG - Intergenic
997625301 5:135327132-135327154 CAGCCCGCGCGGGCTTCTCTGGG - Intronic
999295704 5:150458365-150458387 CACCGCGCCCGGCCTGAGCTGGG - Intergenic
999868554 5:155728007-155728029 CACCCCGCCCGCGTTTCGCTGGG + Intergenic
1004216962 6:13711865-13711887 CGCTGCGCGCGGGCGGCGCTAGG + Intergenic
1015402302 6:132800104-132800126 CACCGCGCCCGGCCCTCACTGGG - Intergenic
1019711460 7:2519965-2519987 CAGCGCGCGCCGGCCGCGCTCGG - Exonic
1020275132 7:6619556-6619578 CACCGCGCCCGGCCATCCCTTGG + Intronic
1026025459 7:66740741-66740763 CACCGCTCGCCCGCTTCGCCCGG - Intronic
1029723634 7:102387532-102387554 CACCGCGCCCGGCCTACGCCTGG - Intronic
1030676769 7:112392778-112392800 CACCGCGCGCGGCCTGTGCCAGG - Intergenic
1033306888 7:140231466-140231488 CACGGCCCGCGGGCTTCCATTGG - Intergenic
1035190449 7:157163095-157163117 CACCGCGCCCGGCCATCTCTGGG - Intronic
1037269857 8:17114829-17114851 CACCGCGCCCGGCCTCCTCTGGG - Intronic
1042560496 8:70069912-70069934 CACCGCGCGGGAGCTTCCCGGGG + Intronic
1049636830 8:143693581-143693603 CACCGCGCCCGGCCTCCTCTGGG + Intronic
1053238107 9:36474023-36474045 CACCGCGCCCGGTCTGTGCTAGG - Intronic
1057470109 9:95349597-95349619 CAGCGCCCTCGGGCTGCGCTGGG + Intergenic
1057588686 9:96352608-96352630 CACCGCACCTGGGCTTCACTTGG + Intronic
1061370654 9:130195710-130195732 CACCGCGCTCGGGCGCAGCTAGG + Intronic
1192773428 X:74217047-74217069 CACCGCGCCCGGCCTTAGTTTGG + Intergenic
1197594532 X:128450199-128450221 CACCGCGCCCGGCCGTCTCTGGG + Intergenic