ID: 1168643519

View in Genome Browser
Species Human (GRCh38)
Location 19:58045371-58045393
Sequence TCTCCTGGATGGTGTCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 2, 2: 1, 3: 29, 4: 361}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168643519_1168643527 5 Left 1168643519 19:58045371-58045393 CCTCCAGGACACCATCCAGGAGA 0: 1
1: 2
2: 1
3: 29
4: 361
Right 1168643527 19:58045399-58045421 TTGAAGAACGAGGCAGCCAAGGG 0: 1
1: 1
2: 0
3: 15
4: 164
1168643519_1168643524 -5 Left 1168643519 19:58045371-58045393 CCTCCAGGACACCATCCAGGAGA 0: 1
1: 2
2: 1
3: 29
4: 361
Right 1168643524 19:58045389-58045411 GGAGATGGCCTTGAAGAACGAGG 0: 1
1: 1
2: 0
3: 13
4: 167
1168643519_1168643526 4 Left 1168643519 19:58045371-58045393 CCTCCAGGACACCATCCAGGAGA 0: 1
1: 2
2: 1
3: 29
4: 361
Right 1168643526 19:58045398-58045420 CTTGAAGAACGAGGCAGCCAAGG 0: 1
1: 1
2: 0
3: 16
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168643519 Original CRISPR TCTCCTGGATGGTGTCCTGG AGG (reversed) Intronic
901813127 1:11778943-11778965 TCCCCTGGAGAGTGTCCGGGAGG - Exonic
903243289 1:21998454-21998476 GCATCTGGATGGTGTCCTGATGG - Intronic
903949466 1:26987157-26987179 TCTTCTGGCTGCTGTCCTGGAGG + Intergenic
904897912 1:33831084-33831106 TCTCCTGGATAGTATCCTGCAGG - Intronic
905319423 1:37105446-37105468 TCTCCAGGGTGCTGTCCTTGAGG + Intergenic
905413497 1:37788677-37788699 GCACCTGGATGTTGTCCTGTGGG + Intergenic
905414718 1:37795828-37795850 TCACCTGGATGCTGTACTGATGG - Exonic
905541361 1:38763038-38763060 TTTCCTGGAACATGTCCTGGGGG - Intergenic
906104139 1:43281779-43281801 GCTCATGGAAGGTGTCTTGGAGG + Intergenic
906120283 1:43385273-43385295 TCTCCCTGAAGGTGTCCAGGAGG + Intronic
907053851 1:51346744-51346766 GATCCTGGATGGCTTCCTGGAGG - Intergenic
908657302 1:66401863-66401885 TCTCCTAAATGGAGTCCTGGTGG + Intergenic
911342221 1:96652844-96652866 TCTCCTGGATAATATCCTGAAGG - Intergenic
912491745 1:110066266-110066288 GCTCCTGGTGTGTGTCCTGGAGG + Intronic
912933989 1:113986929-113986951 TCGTCTGGAAGGTGTCGTGGAGG - Intergenic
915163424 1:153934883-153934905 GCTCCGGAATGTTGTCCTGGGGG - Exonic
915780209 1:158541637-158541659 TCTGCTTGATGGTGTCCCGTGGG + Intergenic
917424569 1:174900860-174900882 TCTCCTGGATGATATCCTGAAGG + Intronic
918802093 1:188985539-188985561 TCTCCTGGATAATATCCTGAAGG + Intergenic
919845619 1:201640341-201640363 CTTCCTGGATGAGGTCCTGGAGG + Intronic
920391885 1:205610169-205610191 TCTTCTGGATGGGGTCGGGGAGG - Exonic
920704517 1:208241955-208241977 TCTCCTTGGTGGTGGCCTGGAGG - Intronic
921842279 1:219840896-219840918 TCTCCTGGATAATATCCTGAAGG - Intronic
921846465 1:219888266-219888288 TCTCCTGGATAATATCCTGAAGG - Intronic
922046715 1:221952201-221952223 TGTCCTGGATGCTGGTCTGGTGG - Intergenic
922700345 1:227755804-227755826 TCTGCTGGTTGGTGGCCTGCAGG - Intronic
923384719 1:233454745-233454767 TCTCCAGGCTGGTCTCCTTGAGG + Intergenic
924816677 1:247448097-247448119 ACTCCAGGCTGGGGTCCTGGGGG + Intronic
1063486563 10:6425916-6425938 TCTCCTGGTAGGGGTCCTGTTGG + Intergenic
1064897465 10:20254263-20254285 TCTTCTGGCTTGTTTCCTGGTGG - Intronic
1064976065 10:21117173-21117195 TCTCCTGGTGGGTCTCATGGTGG - Intronic
1066699038 10:38106928-38106950 TCTCCTGGATAATATCCTGAAGG - Intronic
1066993326 10:42538276-42538298 TCTCCTGGATAATATCCTGAAGG + Intergenic
1070318977 10:75340127-75340149 TCACCTGAATGGGGGCCTGGTGG + Intergenic
1070455460 10:76610070-76610092 TCTCCTGGATAATATCCTGAAGG - Intergenic
1072024622 10:91442651-91442673 TCTCCTGGATAATATCCTGAAGG + Intronic
1072025075 10:91446944-91446966 TCTCCTGGATAATATCCTGAAGG - Intronic
1073732419 10:106305561-106305583 AATCCTGGATGGAGTCTTGGGGG + Intergenic
1073762820 10:106648951-106648973 TCTCCTGGTCGGTGGCCTGCTGG - Intronic
1074156251 10:110802476-110802498 TCTCCTGGATTCTTCCCTGGGGG + Intronic
1076607963 10:131701613-131701635 TCTCCTCACTGGTGTCCTGATGG - Intergenic
1076727221 10:132419470-132419492 TCTCCTGGTGGGGGGCCTGGAGG + Intergenic
1076727278 10:132419585-132419607 TCTCCTGGGGGGGGGCCTGGAGG + Intergenic
1077250869 11:1560126-1560148 TGTTCTGGAAGGTGTCCTCGGGG - Intronic
1077423058 11:2461933-2461955 TCTGCTGTCTGCTGTCCTGGGGG + Intronic
1077907238 11:6544131-6544153 TTTCCTGGATGGAATCCTGCAGG - Exonic
1078356245 11:10633751-10633773 TCTCCTGGATGTGGTCCTTTTGG - Intronic
1078834663 11:15015769-15015791 TCTCCTGGATGATATCCTGCTGG - Intronic
1079193834 11:18306267-18306289 TTTCCTGGAAGATGTTCTGGGGG - Exonic
1082876957 11:57998729-57998751 TCTCCTGGATAATATCCTGCCGG + Intergenic
1083147088 11:60767753-60767775 TCTCCTAGGTGGGGGCCTGGAGG + Intronic
1083811123 11:65107573-65107595 TCTTCCGGATGGTGTCTAGGAGG - Exonic
1084537349 11:69764843-69764865 CCTCCTACATGGGGTCCTGGGGG + Intergenic
1084608802 11:70187788-70187810 TCTGCTGGCTGATGTCCTTGGGG - Exonic
1084815072 11:71640848-71640870 GCTCCTGGATGCTGTCTGGGAGG + Intergenic
1085264627 11:75229922-75229944 TCCCCTGCATGGTGTCCCGTGGG + Intergenic
1085645423 11:78219322-78219344 ACTCCTGCATGGTGTTCTGCAGG + Exonic
1085702441 11:78756917-78756939 TCTCCTGGATGATGTCCAGAGGG + Exonic
1086129369 11:83384544-83384566 TCTCCTGGATAATATCCTGAAGG - Intergenic
1089209412 11:116790343-116790365 TCTGCAGGTAGGTGTCCTGGCGG + Exonic
1090586812 11:128222014-128222036 TCTCCTGTATTGTCTCCTTGAGG + Intergenic
1090770067 11:129912135-129912157 GCACCTGGATGGCGTGCTGGGGG + Exonic
1091150436 11:133323649-133323671 TCTCCTGCCTGGTGGCCTAGTGG - Intronic
1091354435 11:134924737-134924759 TCTCCTGGATGAGATGCTGGAGG - Intergenic
1091593805 12:1861350-1861372 TGTCCTGGAAGATGTCTTGGGGG + Intronic
1094120091 12:26963566-26963588 TCTCCTGGATGCTGTCTATGTGG + Intronic
1094286796 12:28803202-28803224 TCTGCTGGCTGGTGGCCAGGTGG + Intergenic
1094758020 12:33494146-33494168 TCTCCTGGATAATATCCTGAAGG - Intergenic
1095186760 12:39209304-39209326 TCTCCTGGATAATGTCCTGAAGG - Intergenic
1095952513 12:47789535-47789557 TGATCTGCATGGTGTCCTGGGGG + Exonic
1096044753 12:48552767-48552789 TCTCCTGGATAATATCCTGCAGG + Intergenic
1096071637 12:48778617-48778639 TCTCCTGGGTGCTGTCCTTAAGG - Intronic
1096587204 12:52630455-52630477 CCTCCAGGATGGTGTCTTGCAGG + Intergenic
1096796095 12:54078436-54078458 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1098680707 12:73349921-73349943 TCTCCTGGATAATATCCTGAAGG + Intergenic
1101162416 12:101993019-101993041 TCTCCAGGATTGGTTCCTGGTGG + Intronic
1101552739 12:105777503-105777525 TCTCCTGGATAATATCCTGCAGG - Intergenic
1102674034 12:114644272-114644294 TCTCTTGGAATGTATCCTGGGGG + Intergenic
1102945842 12:116987224-116987246 TCTTCTGGACCGTGTTCTGGAGG + Intronic
1103025998 12:117574569-117574591 TTTCCTGCATGCTGTCCTTGTGG - Intronic
1103833192 12:123797204-123797226 TCTCCTGGATGGGATCGGGGAGG - Intronic
1105826271 13:24126186-24126208 TCTCCAGGATGAAGTCATGGGGG + Intronic
1105870237 13:24498115-24498137 CCTCCTGGATGATGGCATGGAGG - Exonic
1106080651 13:26497750-26497772 CATCCTGCAGGGTGTCCTGGGGG - Intergenic
1108438054 13:50420772-50420794 ACTCCTGGATGGAGACCAGGTGG + Intronic
1108463850 13:50694913-50694935 TCTAGTGGATGAGGTCCTGGAGG + Intronic
1110818678 13:79888627-79888649 TCTCCTGGATAATATCCTGAAGG - Intergenic
1113227616 13:108176371-108176393 TCTCCCTGATGGGTTCCTGGGGG - Intergenic
1113867538 13:113537060-113537082 GCACCTGGGTGTTGTCCTGGCGG + Intronic
1116602851 14:46949264-46949286 TCTTCTGGATGATGTACTGTGGG - Intronic
1117859531 14:60075034-60075056 TCTCCTGGATAATATCCTGAAGG - Intergenic
1117900492 14:60527820-60527842 TCTCCTGGATAATATCCTGAAGG + Intergenic
1118104101 14:62638115-62638137 TCTCCTGGATAATATCCTGCAGG - Intergenic
1118483207 14:66188297-66188319 TCTCCTGGATAATGTCCTGCAGG + Intergenic
1120553952 14:85906485-85906507 TCTCCTGGATAATATCCTGAAGG + Intergenic
1121112393 14:91321203-91321225 GCCCCTGGATGGTGCTCTGGAGG + Exonic
1121528865 14:94638710-94638732 GTTCCTGGAAGGTTTCCTGGAGG - Intergenic
1122603439 14:102932497-102932519 TCTGCTGGATGGGCACCTGGGGG - Exonic
1122788897 14:104176229-104176251 TGCCCTGGATGGTTCCCTGGGGG + Exonic
1122928841 14:104924022-104924044 CCTCCTGACTGGTGTCCTGCAGG + Intergenic
1124423305 15:29540915-29540937 TATCCTAGATGATGTCCTAGTGG + Intronic
1124586344 15:31012752-31012774 TCTGCTGGATGGTGTTCTACAGG + Intronic
1124724532 15:32144483-32144505 TCTCCTGGATAATATCCTGAAGG + Intronic
1126168730 15:45676181-45676203 GCTCCTGGATGATCTCCTGCAGG - Exonic
1126554247 15:49967697-49967719 TCTCCTGGATAATATCCTGAAGG - Intronic
1127049449 15:55065428-55065450 TCTCCTGGATAATATCCTGCAGG - Intergenic
1129316781 15:74750005-74750027 CCTGCCGGATGGTGTCCAGGCGG - Exonic
1130834944 15:87640854-87640876 GCTCCTGGAGGGGATCCTGGAGG - Intergenic
1131435258 15:92416842-92416864 TTTCATGGATGGAGTGCTGGGGG - Intronic
1133970555 16:10564738-10564760 CCTCCTGGAGGCTGCCCTGGTGG - Intronic
1134205513 16:12234523-12234545 TTTTCTCGATGGTGTCCTTGAGG + Intronic
1134213582 16:12298343-12298365 TCCCCTGGATGGTTTTCTGCAGG + Intronic
1134833056 16:17338897-17338919 ACTCCTGGAAGGCTTCCTGGAGG - Intronic
1137326166 16:47439258-47439280 TCTCCTGGATAATATCCTGCAGG - Intronic
1137611758 16:49822723-49822745 TCTCCAGGAAGTTTTCCTGGGGG + Exonic
1138780858 16:59783802-59783824 TATCCTGGATGGGATCTTGGAGG - Intergenic
1139915959 16:70428604-70428626 TTTCCTGGATTGTGTCCAAGAGG - Intronic
1140474587 16:75233499-75233521 TGGCCGGGATGGTGTCCTGTGGG - Intronic
1140476022 16:75239622-75239644 GCTCCTGGATTGGGACCTGGGGG - Intronic
1141579043 16:84984742-84984764 TCACGGGCATGGTGTCCTGGGGG + Intronic
1144055893 17:11540234-11540256 GCTCCTGGATGCTGACCTGTGGG + Intronic
1145940711 17:28742079-28742101 TCTCCTGGATTGTGTCATCATGG + Exonic
1148339498 17:46864873-46864895 GCTCCTGGAAGGTGTCCTGGAGG - Intronic
1149115130 17:53084726-53084748 TCAACTGGGTGGTTTCCTGGAGG + Intergenic
1149650048 17:58271099-58271121 CCTCCAGCATGGTGCCCTGGAGG - Intronic
1150266104 17:63833327-63833349 ATTCCTGGATGAAGTCCTGGGGG + Exonic
1150440924 17:65190731-65190753 TCTCCTAGATGATGTCCTATGGG - Intronic
1151882978 17:76905938-76905960 TCTCCTGGCCGGTGCCCCGGGGG + Intronic
1152071926 17:78138342-78138364 TCTTCAGGAGGGTGTACTGGGGG - Exonic
1152170282 17:78741802-78741824 TCTGCCGGAGGCTGTCCTGGAGG - Intronic
1156855499 18:41776452-41776474 TCTCCTGGATAATATCCTGCAGG - Intergenic
1157404449 18:47411313-47411335 TATCCTGGAGGGCTTCCTGGAGG + Intergenic
1157995988 18:52556684-52556706 TGTTCTGGGTGGTCTCCTGGGGG - Intronic
1158168882 18:54574067-54574089 TCTCCTGGATAATATCCTGCAGG + Intergenic
1158218824 18:55129005-55129027 TCTGCAGGATGGGGTCCTTGAGG + Intergenic
1160298352 18:77657687-77657709 CCTCCTGAGTGGTTTCCTGGGGG - Intergenic
1160964696 19:1741953-1741975 TCTCCCAGCTGGTGTCCTTGGGG - Intergenic
1161127300 19:2565573-2565595 TCTCATGGATTCAGTCCTGGAGG - Intronic
1161777343 19:6270744-6270766 TCACCTGGACGGTGCACTGGAGG + Exonic
1162003926 19:7765231-7765253 GCTCTTGGCTGGGGTCCTGGTGG + Exonic
1162175061 19:8824184-8824206 TCTCCTGGATGTTGCTCTAGAGG + Exonic
1163218538 19:15897927-15897949 GCTCCTGGGTGCTGGCCTGGAGG - Intronic
1163516026 19:17764369-17764391 TCTCCTCGATGGTGGCCCTGGGG - Exonic
1163700491 19:18784413-18784435 TCTCCAGGAAGGTGTCTAGGGGG - Intronic
1163995882 19:21046901-21046923 TCTTCTGGATGATATCCTGAAGG + Intronic
1164053906 19:21606172-21606194 TCTCCTGGTTGGCCTCCTAGAGG - Intergenic
1164246480 19:23434700-23434722 TCTCCTGGATAATATCCTGCAGG + Intergenic
1165002692 19:32778243-32778265 AATCCTGGGTGGTGTCCTGTGGG - Intronic
1165090894 19:33387952-33387974 CCTCCTGGATGAGGCCCTGGCGG - Exonic
1165123593 19:33578994-33579016 TATCCTGGATATTGTCCTGTGGG - Intergenic
1166154153 19:40898274-40898296 TGTCCTGGATGATGTTGTGGGGG - Exonic
1166975278 19:46601910-46601932 GCTCCTGGATGGGGTGGTGGAGG + Intronic
1167117790 19:47498148-47498170 CCTTCTGGAGGGAGTCCTGGAGG + Intronic
1167301140 19:48678446-48678468 TCTGCAGGCTGGTGACCTGGAGG - Intergenic
1167301505 19:48680491-48680513 ACTCCTGGAGGATCTCCTGGCGG - Intergenic
1167305061 19:48703436-48703458 ACTCCTGGAGGATCTCCTGGCGG - Exonic
1167471932 19:49680266-49680288 TCCCCTGGATGGTGCTCTGGGGG + Intronic
1167510956 19:49895165-49895187 CCTCCAGGATGGTGACCTGAGGG + Exonic
1168252761 19:55149738-55149760 TCACCAGGATGGAATCCTGGCGG - Intergenic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925731610 2:6922963-6922985 TCACCTGGCTGGTGATCTGGTGG + Intronic
926434930 2:12827931-12827953 TCTGCTGGTTGGTGGCCTGCCGG + Intergenic
926943812 2:18166754-18166776 TCTCCTGGATAATATCCTGAAGG + Intronic
926972498 2:18480782-18480804 TCTCCTGAATTCTCTCCTGGAGG + Intergenic
927089623 2:19700647-19700669 TCTGCTGGGTGGTGGCCTGGTGG - Intergenic
927280215 2:21298415-21298437 TTTCCCGGATGGTATCCTGTGGG + Intergenic
928127456 2:28626421-28626443 TCTCCAGGTTGATGTCCTGAGGG - Exonic
929584153 2:43102868-43102890 TCTGCTTGATGCTGTGCTGGTGG - Intergenic
929688951 2:44058870-44058892 TCTTCTGGAAAGTTTCCTGGAGG + Intergenic
930090329 2:47527187-47527209 TCCCCTGGCTGTGGTCCTGGAGG - Intronic
930290012 2:49481898-49481920 TCTCCTGGATAATATCCTGCAGG - Intergenic
931564072 2:63595464-63595486 TGTCCTGGACGGTGTCCTAATGG + Exonic
931694986 2:64864986-64865008 TCTCCGGGGTGGGGTCCTGGGGG - Intergenic
932593238 2:73079617-73079639 CCTCCTGGACAGTGTTCTGGGGG + Intronic
934113565 2:88764577-88764599 TCTTTTGGATGCTGTCCAGGTGG - Intergenic
934719567 2:96564197-96564219 TCTCCTGCCTGGTTCCCTGGAGG + Intergenic
934751474 2:96796896-96796918 TCACCAGGATGGGGTCATGGTGG - Intronic
935826733 2:106959491-106959513 ATTCCTGGATGGCTTCCTGGAGG + Intergenic
938016853 2:127874395-127874417 TCTCCTGGTCTGTGACCTGGAGG - Intronic
938220729 2:129565066-129565088 TGTCCTGGATTGTATCATGGAGG - Intergenic
939072132 2:137556115-137556137 TCTCCTGGATAATATCCTGCAGG - Intronic
939374184 2:141342796-141342818 TCTCCTGGATAATATCCTGAAGG - Intronic
940080436 2:149795178-149795200 TCTCCTGGATAATATCCTGCAGG + Intergenic
942958573 2:181803115-181803137 TCTCCTGGATAATATCCTGAAGG + Intergenic
943233865 2:185292503-185292525 TCTCCTGGATAATATCCTGAAGG - Intergenic
946410839 2:219514466-219514488 TCTCCTCGATCGTCTCCTTGTGG - Exonic
946914358 2:224501701-224501723 ACTCTTAGATGGTGTACTGGGGG + Intronic
947086200 2:226455502-226455524 TCTCCTGGATAATATCCTGAAGG - Intergenic
947908982 2:233789532-233789554 CCTGCTGGATGATGTCCTGGAGG - Exonic
948851660 2:240711315-240711337 TCTCCTGGCTGGGGGCCTGGCGG + Intergenic
1169067799 20:2704278-2704300 ATTCCTGGAGGGTGTCCTAGGGG + Intronic
1170270995 20:14527134-14527156 TCTGCTGGTTGGTGGCCTGCTGG + Intronic
1171042567 20:21778982-21779004 TCTCCTGGCCAGTGTCCTGTGGG - Intergenic
1171847599 20:30286474-30286496 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1173447765 20:43135478-43135500 TCACATTGATGGTCTCCTGGTGG + Intronic
1173776880 20:45715908-45715930 TCTCCTGGATGATATCCTGAAGG - Intergenic
1177332142 21:19678689-19678711 TCTCCTGGATGATATCCTGAAGG + Intergenic
1178898935 21:36583726-36583748 TCCCCTGGATGGGATCCTGTGGG - Intergenic
1180160187 21:45995729-45995751 TCTCTAGGCTGCTGTCCTGGAGG + Intronic
1181037070 22:20174809-20174831 GCTCCTGGCTGGGGTCCAGGTGG + Intergenic
1181114509 22:20622789-20622811 CAGCCTGGATGGTGTCCTTGTGG - Intergenic
1181322601 22:22019756-22019778 TCTGGTGGATGGTGGCCTGTGGG + Intergenic
1182017889 22:27056128-27056150 GCTCCTGGTTGGAGTCCTGCAGG + Intergenic
1182392798 22:30013334-30013356 TCTCCTGGATGCTTCCCTGCAGG + Exonic
1183424964 22:37734520-37734542 GGTCCTGGCTGATGTCCTGGGGG - Exonic
1184258346 22:43300123-43300145 TCTCCTGGGTGGATACCTGGGGG + Intronic
1184285030 22:43465675-43465697 GCTCTTGGAAGGTGTCTTGGAGG + Intronic
1185005927 22:48277019-48277041 AGTCCTGGATGGGGCCCTGGAGG - Intergenic
1185019444 22:48365603-48365625 TCTGCTGGACAGTGTCCAGGAGG + Intergenic
1185152651 22:49174082-49174104 TCTACTGAATATTGTCCTGGAGG - Intergenic
949456485 3:4244815-4244837 TCTCCTGGATAATATCCTGAAGG + Intronic
949873569 3:8609144-8609166 TCTCCTGTATCCTCTCCTGGTGG + Intergenic
950430400 3:12947642-12947664 TGTCCTGGATGGGCCCCTGGTGG + Intronic
950569060 3:13788791-13788813 TTTCCTGGATTTTGTCCTTGGGG + Intergenic
950579677 3:13854038-13854060 GCCCCAGGATGGTGTCCTGGGGG - Intronic
950900930 3:16496820-16496842 TCTCCTGGAAGGTGTTTGGGCGG - Intronic
951157658 3:19375174-19375196 TCTCCTGGATAATATCCTGCAGG + Intronic
951311064 3:21126437-21126459 TCTCCTGGATAATATCCTGAAGG - Intergenic
952401622 3:32968687-32968709 TCTCCTGGTTGGCCTCCTAGAGG - Intergenic
952848828 3:37711323-37711345 TCTCCTGGATGGTTTCATTGGGG - Intronic
953381728 3:42477414-42477436 TCTCCTGGATGGAGCTCTGTAGG - Intergenic
953716614 3:45321468-45321490 TCTTATAGATGGTGCCCTGGGGG + Intergenic
954692266 3:52401873-52401895 TCTCCTAGGAGCTGTCCTGGTGG - Exonic
957048973 3:75396957-75396979 TCTTTTGGATGGTTTCCAGGTGG + Intergenic
959218400 3:103482742-103482764 TCTCCTGGATAATATCCTGCAGG + Intergenic
960818326 3:121697813-121697835 TCTCCTCGATGGTTTGTTGGAGG + Exonic
961015368 3:123464412-123464434 CCACCAGGATCGTGTCCTGGTGG + Intergenic
961500099 3:127326321-127326343 TCCCCTAGAGAGTGTCCTGGTGG - Intergenic
961643388 3:128379199-128379221 TCTCCTGGAAGCCGTCCTGACGG + Intronic
961862490 3:129927743-129927765 TCTCCTCTGTCGTGTCCTGGCGG - Intergenic
962188689 3:133287461-133287483 TCTTCTGTAGGTTGTCCTGGAGG + Intronic
962989298 3:140564052-140564074 TCTCCTGGATGAAGTGCTGGTGG - Exonic
963643651 3:147886973-147886995 ACTGCTGGAATGTGTCCTGGGGG + Intergenic
965323746 3:167276667-167276689 TCTCCTGGATAATATCCTGCAGG - Intronic
965435190 3:168641812-168641834 TCTCCTGCTTGGTGTCCTCAGGG - Intergenic
967481128 3:189974593-189974615 TCTCCTGGATAACGTCCTGTCGG - Exonic
967638772 3:191836026-191836048 TCTCCTGGATAATATCCTGAAGG - Intergenic
968272174 3:197411481-197411503 TCTCCTGGATAATATCCTGCAGG - Intergenic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
969140326 4:5065483-5065505 TCAGCGGGATGGTGTCCAGGGGG - Intronic
969909026 4:10426676-10426698 TCTCCTGGATAATATCCTGAAGG + Intergenic
970864233 4:20740158-20740180 TCTCCTGGATAATATCCTGAAGG - Intronic
971441843 4:26695432-26695454 TCTCCTGGATAATATCCTGCAGG - Intronic
975154673 4:71058402-71058424 TCTCCTGGATAATATCCTGCAGG + Intergenic
976147830 4:82060008-82060030 TCTCTTGGATGGCATCCTAGTGG + Intergenic
976837396 4:89390767-89390789 TCTCCTGGATAATATCCTGCAGG - Intergenic
977110159 4:92943138-92943160 TCTCCTGGATAATATCCTGCAGG + Intronic
977183228 4:93903914-93903936 TCTCCTGGATGTAGTGCTGCTGG - Intergenic
977668884 4:99672382-99672404 TCTCCTGGATGATATACTGACGG - Intergenic
978280967 4:107013584-107013606 TCTCCTGCATTTTTTCCTGGTGG - Intronic
981618262 4:146665048-146665070 TCTCCTGGATAATATCCTGCAGG - Intergenic
982068590 4:151675460-151675482 ACTCCTGGCTGGAGTCCAGGAGG + Intronic
982651089 4:158088812-158088834 TCTCCTGGATAATATCCTGCAGG + Intergenic
982843894 4:160224951-160224973 TCAGCTGGATGCTGTCATGGGGG + Intergenic
983173101 4:164558065-164558087 TCTCCTGGATAATATCCTGCAGG + Intergenic
983326724 4:166266961-166266983 TCTCCTGGATAATATCCTGCAGG - Intergenic
983716464 4:170787555-170787577 TCTCCTGGATAATATCCTGCAGG + Intergenic
983896065 4:173083393-173083415 TCTCCTGGATAATTTCCTGAAGG + Intergenic
984844871 4:184100646-184100668 TCTCCTGCAATGTGTGCTGGAGG + Intronic
984878303 4:184388925-184388947 CCTCTTTGATGGTGACCTGGAGG + Exonic
985260041 4:188106593-188106615 TCTCCTGGCCGGTCACCTGGAGG - Intronic
988038122 5:25853566-25853588 TCTGCTGGTTGGTGGCCTGCTGG + Intergenic
988264309 5:28928841-28928863 TCTTTTGGATGGTTTCCAGGTGG + Intergenic
989111032 5:37906847-37906869 GCTCCTTGGTGGTGTCCTGGGGG + Intergenic
990369051 5:55098094-55098116 TCTCCTGGATAATATCCTGAAGG - Intergenic
991538959 5:67705232-67705254 TCTCCTGGATTATATCCTGCAGG - Intergenic
991543817 5:67759110-67759132 TCTCCTGGATAATATCCTGCAGG - Intergenic
992284124 5:75215118-75215140 TCTCCCGGATGATTTCCTGCTGG - Intronic
993380692 5:87203760-87203782 TCTCCTGGATAATATCCTGAAGG + Intergenic
994142694 5:96359901-96359923 TCTCCTGGATAATATCCTGAAGG + Intergenic
994721408 5:103384758-103384780 TCTCCTGGATAATGTCCTTAAGG + Intergenic
997284450 5:132668182-132668204 TCTCCTGGGTGCTGGCCTGCAGG + Intergenic
997443136 5:133922813-133922835 TCTCCTGAAAGGTGGGCTGGAGG - Intergenic
997915139 5:137917116-137917138 TCTACTTGATGGTGTCCTGCAGG + Intronic
997976693 5:138445350-138445372 AGTCCTCGATGGTGTCCAGGAGG - Exonic
999699108 5:154211845-154211867 TCTCTTGGATGGTGTGCTCTGGG - Intronic
1000159711 5:158585785-158585807 TCTCCAGGATTGGTTCCTGGTGG + Intergenic
1002925319 6:1602359-1602381 GCCCCGGCATGGTGTCCTGGAGG + Intergenic
1003118177 6:3297271-3297293 TCTCTTGGACGATGGCCTGGAGG + Intronic
1003939910 6:11014242-11014264 TCTCTTGGATGGATACCTGGGGG - Intronic
1005806474 6:29478275-29478297 GCTCCTGCTTGGTGCCCTGGTGG - Intergenic
1006860857 6:37170707-37170729 TCTCCTGGGTGGGGAGCTGGCGG + Intronic
1007325387 6:41055511-41055533 ACTCCAGGAGGGAGTCCTGGGGG - Intronic
1009290259 6:61871431-61871453 TCTCCTGGATAATATCCTGAAGG - Intronic
1010319050 6:74485441-74485463 TCTCCTGGATAATATCCTGCAGG - Intergenic
1010755538 6:79662714-79662736 TCTCCTGGATAATATCCTGAAGG + Intronic
1012714427 6:102650042-102650064 TCTCCTGGATTGGTCCCTGGTGG - Intergenic
1013939758 6:115646737-115646759 TCTCCTGGATAATATCCTGAAGG - Intergenic
1014982098 6:127956715-127956737 TTTCCTGGCTGGTGTCCTTCAGG + Intergenic
1015627528 6:135195930-135195952 TATCCAGAATGGTGCCCTGGTGG - Exonic
1019137328 6:169918429-169918451 TGTCCTGGACGGTGGCCAGGAGG + Intergenic
1019463957 7:1176234-1176256 TGTCCCGGAAGCTGTCCTGGCGG - Intergenic
1019996523 7:4728063-4728085 TCCCCTGGTTGCTGTCCCGGGGG - Intronic
1020688282 7:11322909-11322931 TCTCCTGGATGGAGGCCTAGAGG + Intergenic
1022334030 7:29406035-29406057 TCTCATGGCTGGTGTCCCCGTGG + Intronic
1023826291 7:44012146-44012168 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1023846924 7:44127062-44127084 TCTGCTTGATGGTGTCCCGCAGG + Intergenic
1023873423 7:44274710-44274732 TCTGCTGGCGGGTGGCCTGGAGG + Intronic
1024319040 7:48047029-48047051 TCTTCTGTATGAAGTCCTGGTGG + Intronic
1024633170 7:51265597-51265619 TCTCCTGGTTGGGGTTCTGTGGG - Intronic
1024995177 7:55268745-55268767 TCTCCTGGAGGGACTCCTGGAGG - Intergenic
1026089868 7:67291011-67291033 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1026627766 7:72011448-72011470 CTTCAGGGATGGTGTCCTGGAGG - Intronic
1026746586 7:73017850-73017872 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1026750238 7:73045993-73046015 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1026753885 7:73074103-73074125 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1026757536 7:73102139-73102161 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG + Intronic
1027032689 7:74902408-74902430 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1027089868 7:75291347-75291369 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1027093513 7:75319275-75319297 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1027097156 7:75347242-75347264 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1027119460 7:75506330-75506352 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1027272365 7:76529281-76529303 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1027322192 7:77020428-77020450 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1027325822 7:77048347-77048369 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1028508045 7:91591215-91591237 TCTCCTGGATAATATCCTGCAGG - Intergenic
1029398265 7:100324243-100324265 GCTCCTGGCTGGTTTCCTGTAGG - Intergenic
1029718036 7:102343702-102343724 GCTCCTGGCTGGTTTCCTGTAGG + Intergenic
1029754578 7:102565543-102565565 GCTCCTGGCTGGTTTCCTGTAGG - Intronic
1029772529 7:102664627-102664649 GCTCCTGGCTGGTTTCCTGTAGG - Intronic
1030121660 7:106116005-106116027 TTTCCTGGATTGGATCCTGGGGG - Intergenic
1032445827 7:131982909-131982931 TCTCCTGGATAATATCCTGCAGG + Intergenic
1034321228 7:150184578-150184600 TCTCTAGGATGCTGTCCTGCCGG - Intergenic
1034330069 7:150274888-150274910 TCTCCTGGATGACGTTCTGGCGG + Intronic
1034545560 7:151786496-151786518 GCTCCTGGACGGAGACCTGGAGG - Exonic
1034667985 7:152834970-152834992 TCTCCTGGATGACGTTCTGGCGG - Intronic
1034703754 7:153121600-153121622 TCTCCTGGATAATATCCTGCAGG + Intergenic
1035079808 7:156206477-156206499 GCTCCTGAATGTTGTCCTGCCGG - Intergenic
1036242822 8:7093397-7093419 GCTCCTGGATGCTGTCTGGGAGG + Intergenic
1036257980 8:7220631-7220653 GCTCCTGGATGCTGTCTGGGAGG - Intergenic
1036259229 8:7227629-7227651 GCTCCTGGATGCTGTCTGGGAGG - Intergenic
1036307398 8:7611892-7611914 GCTCCTGGATGCTGTCTGGGAGG + Intergenic
1036310029 8:7679227-7679249 GCTCCTGGATGCTGTCTGGGAGG - Intergenic
1036311282 8:7686224-7686246 GCTCCTGGATGCTGTCTGGGAGG - Intergenic
1036358241 8:8059876-8059898 GCTCCTGGATGCTGTCTGGGAGG + Intergenic
1036359506 8:8066875-8066897 GCTCCTGGATGCTGTCTGGGAGG + Intergenic
1036486999 8:9188461-9188483 TCTTCTGAATGGTGTGGTGGCGG + Intergenic
1036688039 8:10924700-10924722 TCTCCAGGAAGGTCTCCAGGAGG + Exonic
1036891450 8:12600077-12600099 GCTCCTGGATGCTGTCTGGGAGG - Intergenic
1036892708 8:12607067-12607089 GCTCCTGGATGCTGTCTGGGAGG - Intergenic
1037513875 8:19610585-19610607 TCTGCTGGTTGGTGGCCTGCTGG - Intronic
1039319449 8:36412686-36412708 TCTCCTGGATAATATCCTGCAGG + Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045177421 8:99740396-99740418 TCTCCTGGATAATATCCTGCAGG - Intronic
1046871028 8:119206158-119206180 GCTCATGGTTAGTGTCCTGGAGG + Intronic
1046898735 8:119500968-119500990 TCTGCTGGCTGTTCTCCTGGCGG + Intergenic
1047855783 8:128910117-128910139 TCTCCTTGAAGGTGTCCTACAGG - Intergenic
1048472405 8:134714853-134714875 TCTCTTGGAGGCTCTCCTGGAGG - Intergenic
1049203081 8:141351278-141351300 TCTCCTGGAGGGTGTGGTGCTGG - Intergenic
1049257053 8:141619788-141619810 TCTCTTGGGAGGGGTCCTGGAGG - Intergenic
1049311145 8:141934592-141934614 TGTCCTAGATGCTGTCCTTGTGG - Intergenic
1049656675 8:143802167-143802189 TGTCCTTGAGGGAGTCCTGGTGG - Intronic
1051292605 9:15560296-15560318 TCTCCTGGATGATATCCTGAAGG + Intronic
1051484641 9:17594721-17594743 TCTCCTTGATGGTATCCTCTAGG + Intronic
1051958412 9:22727505-22727527 TCTCCTGGATAATATCCTGCAGG - Intergenic
1052160284 9:25248911-25248933 TCTGCTTGATGGTGTCCTACAGG - Intergenic
1052515170 9:29471312-29471334 TCTCCTGGATGGTACTCTGAAGG + Intergenic
1052537201 9:29761977-29761999 GCTCCAGGCTGGTGTACTGGGGG - Intergenic
1053070004 9:35095658-35095680 TCTCCAGGAAGGTTTCCGGGAGG - Intronic
1053288875 9:36867043-36867065 TGTCCTGGATGGGGTGGTGGGGG + Intronic
1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1054076809 9:60545343-60545365 TCTTTTGGATGGTTTCCAGGTGG - Intergenic
1054159330 9:61663067-61663089 TCTCCTAGCTGGTTTCCTAGAGG - Intergenic
1054449275 9:65394123-65394145 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1054479104 9:65594072-65594094 TCTCCTAGCTGGTTTCCTAGAGG - Intergenic
1056331035 9:85521496-85521518 GCCCCTGGAAGGCGTCCTGGTGG - Intergenic
1056707258 9:88961742-88961764 TGTCCTGGACATTGTCCTGGAGG - Intergenic
1056791528 9:89628326-89628348 TCTCCTGTGGGGTGTCCTGTGGG + Intergenic
1057213167 9:93212371-93212393 TCTCTGGGATGCTGTCCTGCTGG - Intronic
1058224107 9:102338782-102338804 TCTCCTGGATAATATCCTGCAGG - Intergenic
1058408624 9:104705030-104705052 TCTCCTGGATGATATCGTGAAGG - Intergenic
1059513526 9:114871254-114871276 TCTCCTGGATAATATCCTGAAGG - Intergenic
1059528119 9:115011972-115011994 TCACCTGAAGGGTGTCCAGGTGG + Intergenic
1060472546 9:123960524-123960546 CCTCCTGTATGTTGTACTGGGGG + Intergenic
1062086221 9:134650328-134650350 TCTGCTGGCGGGTGGCCTGGGGG + Intronic
1187480524 X:19650834-19650856 TCTCCAGAATGGTGTGCTGAGGG + Intronic
1190218520 X:48495947-48495969 TCTCCTGGATGGCAACATGGGGG - Intergenic
1192845325 X:74901318-74901340 TCTCCTAGGTTGTTTCCTGGAGG + Intronic
1192984424 X:76381294-76381316 TCTCCTGGATAATATCCTGAAGG - Intergenic
1193243172 X:79196846-79196868 TCTCCTGGATAATATCCTGAAGG - Intergenic
1193528256 X:82620149-82620171 TCTCCTGGATGATACCCTGAAGG - Intergenic
1196474624 X:116068464-116068486 TCTCCTGGATAATATCCTGCTGG + Intergenic
1196883370 X:120220704-120220726 GCTCCTGGATGGGAACCTGGAGG + Intergenic
1196944803 X:120813084-120813106 TCTCCTGGATAATATCCTGCAGG - Intergenic
1197649164 X:129045803-129045825 TCTCCTGGATAATATCCTGCAGG - Intergenic
1197813405 X:130471101-130471123 TCTCCAGCATGGTGTCCAGGGGG - Intergenic
1200977111 Y:9224827-9224849 TCTCCTTGATCGTGTCCTACTGG - Intergenic
1201541430 Y:15109350-15109372 TCTCCTGGATAATATCCTGAAGG + Intergenic
1202032182 Y:20588652-20588674 TCTCTTTGATGGTGTCATGAGGG - Intronic
1202036525 Y:20642047-20642069 TCTCCTTGATGGTGAACAGGAGG - Intergenic
1202041888 Y:20694445-20694467 TCTCCTGGATAGTATCCTGAAGG + Intergenic
1202071098 Y:20992282-20992304 TCTCCTGGTTGGTCTCCTAGAGG - Intergenic
1202133986 Y:21641152-21641174 TCTTCTTGATGGTGTCCTACTGG + Intergenic