ID: 1168644466

View in Genome Browser
Species Human (GRCh38)
Location 19:58051231-58051253
Sequence CACAATGGCCCCCAGTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168644462_1168644466 12 Left 1168644462 19:58051196-58051218 CCAAGGTGGGTGAAGTAGGGAAG 0: 1
1: 0
2: 1
3: 25
4: 241
Right 1168644466 19:58051231-58051253 CACAATGGCCCCCAGTAGCCAGG 0: 1
1: 0
2: 0
3: 17
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168644466 Original CRISPR CACAATGGCCCCCAGTAGCC AGG Intronic
904461132 1:30680475-30680497 CACAGTGGCACCCAGAAGCTTGG - Intergenic
904774258 1:32896992-32897014 AATAATGGCCCCCAGTTGCTGGG + Intronic
907290108 1:53408181-53408203 CCCAGTGGCACTCAGTAGCCTGG + Intergenic
908552258 1:65221360-65221382 CACAATGGCACCCAGGAGTTGGG - Intronic
916047716 1:161013250-161013272 CACAAGACCCCCCAGTTGCCAGG + Intronic
919817297 1:201449424-201449446 AACAATGGGACCCAGCAGCCTGG - Intergenic
919838528 1:201592974-201592996 CACAGAGGCCCCCAGTAATCAGG - Intergenic
919923832 1:202181960-202181982 CACCATGGCCCCCACAAGGCAGG - Intergenic
924637592 1:245803490-245803512 CACAAAGCCCCCCAGTGGCTGGG + Intronic
1070949890 10:80422545-80422567 AACAATGGCCCCTACTTGCCAGG - Intronic
1073134886 10:101215029-101215051 CCCAATGGCCCCATGTACCCAGG - Intergenic
1073871452 10:107869503-107869525 CACAATGGTTCCAAGGAGCCAGG + Intergenic
1074452711 10:113572095-113572117 CTCAGTGGCCCCAGGTAGCCAGG - Intronic
1075776921 10:124995171-124995193 CACAATGGCTCCCTGCAGGCTGG + Intronic
1076530478 10:131141356-131141378 CACACTGGACCCCAGGAGGCAGG - Intronic
1076558577 10:131346285-131346307 CACAGTGTCCTCCAGTAGCCTGG + Intergenic
1077311002 11:1889116-1889138 CAGAATGGCCCCCAGAGCCCAGG - Intronic
1077800550 11:5531726-5531748 CAGAATGGGCCCTAGGAGCCAGG - Intronic
1077938943 11:6818993-6819015 CACAGTGGCACCCAGAAGCTTGG - Intergenic
1078169909 11:8921756-8921778 CACTACAGCCCCCAGTAGCTGGG + Intronic
1083540403 11:63508202-63508224 CACCCTGGTCCCCAGAAGCCTGG - Intronic
1083616440 11:64028760-64028782 CACAGGTGCCCCCAGCAGCCAGG - Intronic
1083916194 11:65745103-65745125 CACAGTGGCACCCAGAAGCTTGG - Intergenic
1085518475 11:77124710-77124732 CCCAAAGGCCCCCAGCTGCCTGG - Exonic
1086099271 11:83082258-83082280 CACAAGGTCCCACAGTAGGCTGG + Intergenic
1090929556 11:131283348-131283370 CACCTCAGCCCCCAGTAGCCTGG - Intergenic
1091708920 12:2723451-2723473 GACAATGGCCCCCAGTGGTTGGG - Intergenic
1092226063 12:6749020-6749042 CACATCGGCCTCCAGGAGCCAGG - Intronic
1096193035 12:49632535-49632557 CCCAGTGGCCCCCAGGACCCAGG - Intronic
1096409282 12:51365467-51365489 CACGCTGGCCCCCAGCAGCCGGG + Exonic
1097129851 12:56804060-56804082 CACATTGGCACCCAGAAGCTCGG + Intergenic
1098519558 12:71420477-71420499 CACCATGGCACCCAGAAGCTTGG + Intronic
1099049675 12:77767701-77767723 CACAGTGGCGCCCAGGAGCTTGG + Intergenic
1100672722 12:96834610-96834632 CACAGTGGTGCCCAGAAGCCTGG + Intronic
1101922368 12:108943300-108943322 AAGAATGGACACCAGTAGCCGGG + Intronic
1103922437 12:124405895-124405917 AACCATGGCCCCCAGTGGCCCGG - Intronic
1109262739 13:60163606-60163628 CCCAGTGGCCCCGAGGAGCCTGG - Exonic
1110014663 13:70386204-70386226 CACAATGGTACCCAGAAGCTTGG + Intergenic
1111597385 13:90428515-90428537 CACAGTGGTGCCCAGAAGCCTGG - Intergenic
1113388174 13:109870349-109870371 CACTCTGACCACCAGTAGCCAGG - Intergenic
1113601069 13:111568569-111568591 CACACTGGCCTCCAGGAACCAGG - Intergenic
1121323663 14:93007353-93007375 CACCCTGGCCCACAGTCGCCCGG + Intronic
1122524169 14:102368740-102368762 CACACCTGCCCCCAGAAGCCAGG - Intronic
1123918830 15:25056544-25056566 CACAAAGGCCCCCAACATCCTGG + Intergenic
1132202648 15:99965485-99965507 CACAATGACACTCAGTAGCCGGG - Intergenic
1132474452 16:126714-126736 CACCATGGCCCCTAATACCCAGG + Intronic
1132549333 16:547900-547922 CACAGTGGCCCCCAGGTGCTCGG + Exonic
1132640224 16:974783-974805 GACAATGGCCCCGAGGAGGCGGG - Intronic
1135395232 16:22126308-22126330 CACCCTTGCCCCCAGGAGCCAGG - Intronic
1135432411 16:22396794-22396816 CACAATGGCTCCCAGTACTTTGG + Intronic
1135747615 16:25030662-25030684 GATAATGGCCCCCAGTCGCAAGG + Intergenic
1137552137 16:49444910-49444932 CAAAATACCCCACAGTAGCCTGG - Intergenic
1138434217 16:56988381-56988403 CACCATGCCCCTCAGTGGCCTGG + Intergenic
1139138621 16:64234177-64234199 CACAATGGTGCCCAGAAGCTTGG - Intergenic
1139612622 16:68069864-68069886 CACCATGCCCCCCTGCAGCCAGG + Intronic
1141134483 16:81456767-81456789 CAGAAAGGCCCACAGTGGCCAGG + Intronic
1141204562 16:81923566-81923588 CACAATGTCTCCAAGGAGCCCGG + Exonic
1141524890 16:84604738-84604760 CACAGGGGCCGCCAGGAGCCTGG + Intronic
1142509337 17:384770-384792 CAAAGTGGCCACCAGCAGCCAGG + Intronic
1143159078 17:4857296-4857318 CACCATGGTCTCCAGTGGCCTGG - Intronic
1143870725 17:9955901-9955923 CACAGTGGACCCCAGCAGCTGGG - Intronic
1144640865 17:16935837-16935859 CACATTGGCACCCATAAGCCAGG + Intronic
1144711967 17:17407118-17407140 CACAGTGGCCCACAGCACCCAGG - Intergenic
1144729141 17:17516777-17516799 CACAAGGGCCCCCAGCTGCTGGG - Intronic
1145907259 17:28523333-28523355 CCCAAAGGCCCCCGGTTGCCTGG - Intronic
1148076813 17:44941884-44941906 CACACTGGCCCTCAGGAGGCGGG - Intronic
1148960808 17:51391259-51391281 ACCAATGGCCCTCAGTTGCCTGG + Intergenic
1149661064 17:58334082-58334104 CAGAATGGGACCCAGGAGCCCGG + Intergenic
1151929622 17:77223922-77223944 CACAGAGGACCCCAGGAGCCAGG - Intergenic
1154221196 18:12455698-12455720 CACAATGGCCCCTTGCAGCCTGG - Intronic
1155990231 18:32272376-32272398 CCCACTGGGCCCCAGTAACCAGG - Intronic
1159778636 18:72634681-72634703 CACAGTGGCCTCCTGTGGCCAGG + Intronic
1161737827 19:6002458-6002480 CACAAAGGCCCCCAGCTTCCAGG - Intronic
1162110056 19:8395168-8395190 CATCTTGGCCCCCAGTGGCCTGG + Intronic
1162386379 19:10362548-10362570 CACAGTGGCCCAGCGTAGCCAGG - Exonic
1163849407 19:19654855-19654877 CACAGATGCCCCCAGAAGCCAGG + Intronic
1165372157 19:35415352-35415374 CACAATGGCCCCCAGAAGAGAGG - Intergenic
1165908960 19:39212179-39212201 AGCAATGGCCCTCAGCAGCCTGG - Intergenic
1166862931 19:45820079-45820101 CACACAGGCCACCAGGAGCCAGG - Intronic
1167367705 19:49063783-49063805 CACAGGGGCCCCCCGAAGCCTGG - Intronic
1168216458 19:54929675-54929697 AACAATGGCCCCCAGTGACCTGG - Intronic
1168644466 19:58051231-58051253 CACAATGGCCCCCAGTAGCCAGG + Intronic
925987732 2:9229869-9229891 CACAAATGCCCCCAACAGCCTGG - Intronic
927996939 2:27493508-27493530 CAGTATGGACCCCAGTAACCTGG - Intronic
930313538 2:49771301-49771323 CACGATGGTGCCCAGAAGCCTGG + Intergenic
931079429 2:58752779-58752801 TACAATGGCCCCTTTTAGCCAGG - Intergenic
932451523 2:71813619-71813641 CAGCATGGCCCCCAGGAACCAGG - Intergenic
937233492 2:120416283-120416305 CACAATCGCTCCCAGCAGCCAGG - Intergenic
941715609 2:168760210-168760232 CACAAGGTCCCACAGTAGGCTGG + Intronic
944875499 2:203960718-203960740 CAAAATGGTCCCCATCAGCCTGG + Exonic
946175920 2:217922038-217922060 CAGAACTGCCCCCAGAAGCCCGG + Intronic
948695582 2:239731660-239731682 CCCAGTGGCCACCAGGAGCCTGG - Intergenic
1169970660 20:11266260-11266282 AACAATGGCTGCCAGTATCCGGG - Intergenic
1176642373 21:9318134-9318156 CACAGTGGCACCCAGAAGCTTGG - Intergenic
1179885675 21:44313321-44313343 CACAAAGGCCCCCCGCGGCCTGG - Intronic
1180193657 21:46181318-46181340 CAGCATGGCCCCCAGGCGCCAGG + Intronic
1180351387 22:11807488-11807510 CACAGTGGCACCCAGAAGCTTGG - Intergenic
1180375673 22:12090915-12090937 CACAGTGGCACCCAGAAGCTTGG - Intergenic
1180386815 22:12184589-12184611 CACAGTGGCACCCAGAAGCTTGG + Intergenic
1182089828 22:27586566-27586588 AACAATGACCCCCACTAGACTGG + Intergenic
1183631830 22:39038007-39038029 AACTTTGGCCCCCAGTGGCCAGG + Intergenic
1183637714 22:39074837-39074859 AACTTTGGCCCCCAGTGGCCAGG + Intronic
1183732992 22:39628789-39628811 GAGAGTGGCCCCCAGTGGCCAGG + Intronic
1184463606 22:44655750-44655772 CTCAGTCTCCCCCAGTAGCCGGG - Intergenic
1184593736 22:45502500-45502522 CCCAGTGCCCCCCAGCAGCCGGG + Intronic
1185059191 22:48597259-48597281 CACCATGGCCCCCATCACCCGGG + Intronic
1185069067 22:48646495-48646517 CAGAGGGGCCCCCAGCAGCCAGG - Intronic
1185208577 22:49554072-49554094 CAGAATGGACCCCAGAAGGCCGG - Intronic
949251749 3:1993391-1993413 CACAATGGCCACAAGTACCATGG + Intergenic
954321020 3:49832085-49832107 CACTGTGGCCCCAAGTAACCAGG - Intronic
956937035 3:74114511-74114533 CACAATTGCCTACAGTATCCGGG + Intergenic
957097739 3:75792513-75792535 CACAGTGGCACCCAGAAGCTTGG + Intergenic
958584384 3:96068504-96068526 CACAGTGGCACCCAGAAGCTTGG + Intergenic
959745684 3:109774590-109774612 CACAAAGTCCCTCAGTAGACTGG + Intergenic
961093821 3:124138037-124138059 CCCAGTGGCCCCCAGCAGGCTGG + Intronic
961637305 3:128341643-128341665 GACAATGGCCCTCTGTGGCCTGG - Exonic
963003016 3:140700830-140700852 GACAACAGCTCCCAGTAGCCTGG - Intronic
965118521 3:164521492-164521514 CACAGTGGCTCCCAGAAGCTTGG + Intergenic
1202744513 3_GL000221v1_random:86884-86906 CACAGTGGCACCCAGAAGCTTGG + Intergenic
973026808 4:45283681-45283703 CACAGTGGCACCCAGAAGCTTGG + Intergenic
975040781 4:69742958-69742980 CACAGTGGCACCCAGAAGCTTGG + Intronic
978210713 4:106132331-106132353 TACATTGGCCCCCTTTAGCCAGG - Intronic
979427965 4:120591392-120591414 CACAATGATCCCCAGTGGCTGGG + Intergenic
980416590 4:132496452-132496474 CACAATGGCCTCCTGGAGCTTGG + Intergenic
1202757271 4_GL000008v2_random:76356-76378 CACAGTGGCACCCAGAAGCTTGG - Intergenic
985698778 5:1358244-1358266 CCCAGGGTCCCCCAGTAGCCTGG - Intergenic
985933985 5:3080520-3080542 CAGCATGGCCCCCAGGAGCCCGG + Intergenic
992838828 5:80667734-80667756 CACAGTGGCGCCCAGAAGCTTGG + Intronic
998140229 5:139695798-139695820 CACACTGGGCTCCAGTAGGCAGG - Intergenic
999709952 5:154309245-154309267 CACACTGGCCTCCACAAGCCAGG - Intronic
1001380278 5:171301660-171301682 GAAAATGGCTCCCAGTGGCCGGG - Intergenic
1002291120 5:178201596-178201618 CACCTTGTCCCACAGTAGCCAGG + Intergenic
1005036232 6:21557490-21557512 CACAATTGCCCTCAGGAGCTGGG + Intergenic
1007446345 6:41909283-41909305 CACAATGGGGCCCAGTGCCCGGG - Exonic
1007712711 6:43834881-43834903 AACAAGGGTCCCCAGCAGCCAGG + Intergenic
1013119891 6:107131891-107131913 CAGAATTGTCCCCAGTAGGCCGG + Intergenic
1017965129 6:159257593-159257615 CAAAATGGCCCTCATTAGACAGG + Intronic
1018199145 6:161379217-161379239 TAGAATGGCACCCAGGAGCCTGG + Intronic
1018392822 6:163353377-163353399 CACAGTGGCCCCCAGTTTCCTGG - Intergenic
1018501422 6:164414485-164414507 CACAACAGCCCCCAGCAGGCAGG + Intergenic
1019162124 6:170075835-170075857 CACCATGGCCCCCAGCCTCCAGG + Intergenic
1019723551 7:2587843-2587865 CACAATGCGCCTCAGCAGCCGGG - Exonic
1022355691 7:29612401-29612423 CCCAGTGGCCCCCAGTGGCTGGG - Intergenic
1022956991 7:35390135-35390157 CACAGTGGACCCCACTTGCCTGG + Intergenic
1023899667 7:44466127-44466149 CACAATGGCCCCTAGAAGCAGGG + Intronic
1024526537 7:50354322-50354344 CACCAGAGCCCCCACTAGCCAGG + Intronic
1028024686 7:85821996-85822018 CACAATGGCACCCAGAAGCTCGG - Intergenic
1029116598 7:98240973-98240995 CCCAGTGGCCCCCATCAGCCTGG + Intronic
1029788622 7:102819133-102819155 CACAATGGCCCCCACAACCCAGG - Intronic
1030007188 7:105131205-105131227 CACAATGGCCACTAGCAGCAGGG - Intronic
1030359549 7:108580346-108580368 CACAGTGGCACCCAGAAGCTTGG - Intergenic
1030513965 7:110518805-110518827 CACAGTGGCACTCAGAAGCCTGG + Intergenic
1032324035 7:130909732-130909754 CACAATTGACCCCAATAGACAGG - Intergenic
1033551430 7:142451569-142451591 CACAGTGGCCCCAAGTGGCCTGG + Intergenic
1033555897 7:142488418-142488440 CAGAGTGGCCCCAAGTGGCCCGG + Intergenic
1035380580 7:158438011-158438033 CACAAATGCCCCCAGGAGACAGG + Intronic
1035728917 8:1841535-1841557 CACTGTGGCCCCCGGTAGCTGGG - Intronic
1036503974 8:9338322-9338344 CACCGTGGCAGCCAGTAGCCAGG + Intergenic
1037458710 8:19087782-19087804 CACAACTGCCCCAAGTAGGCAGG + Intergenic
1039211021 8:35214982-35215004 CACAGTGGCCCCCAGAAGCTTGG + Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1046234060 8:111398196-111398218 CACAATGGGCCCCAGTAAAACGG - Intergenic
1048390445 8:133958688-133958710 CAGCATGGCCCCCAGTGGACTGG - Intergenic
1050484055 9:6115168-6115190 CACAGTGGCACCCAGAAGCTTGG - Intergenic
1051697280 9:19782202-19782224 ATCAACGGCCCCCAGCAGCCAGG + Intronic
1054782558 9:69178571-69178593 CAGAATGGCCCAGAATAGCCAGG + Intronic
1055594109 9:77848124-77848146 CACAGTGGCCCCAAGGAGACAGG - Intronic
1058752282 9:108051315-108051337 TACAAAGGCACCCAGAAGCCAGG - Intergenic
1058836814 9:108864598-108864620 CACAGAGACCCTCAGTAGCCAGG + Intergenic
1059328326 9:113518254-113518276 CCCCATGGCCCCAGGTAGCCAGG - Intronic
1203713145 Un_KI270742v1:116833-116855 CACAGTGGCACCCAGAAGCTTGG + Intergenic
1203538061 Un_KI270743v1:61217-61239 CACAGTGGCACCCAGAAGCTTGG - Intergenic
1185778111 X:2822438-2822460 AACAATGTCCTCCAGTAGCCAGG + Intergenic
1186384217 X:9092736-9092758 CTCAATGGCCCACAGGGGCCAGG - Intronic
1189155048 X:38748449-38748471 CACACTGGCACCAAGTACCCAGG - Intergenic
1190732918 X:53236397-53236419 GACGATGGCCCGCAGTAGCCTGG - Exonic
1195127607 X:101823280-101823302 CACAGTGGCACCCAGAAGCTTGG - Intergenic
1195831187 X:109060841-109060863 CACCATGGCTTCCAGTAGCAAGG - Intergenic
1196314894 X:114211035-114211057 CACATTGGCCCCTTTTAGCCAGG + Intergenic
1197342312 X:125288364-125288386 CACAGTGGCACCCAGAAGCTTGG - Intergenic
1197532952 X:127653293-127653315 CAAAAAGAGCCCCAGTAGCCAGG + Intergenic
1199737530 X:150697565-150697587 AACAATTGCCCCCAGAGGCCGGG - Intronic
1200902988 Y:8451849-8451871 CACAATGTCCCCCTGAAGCATGG - Intergenic