ID: 1168647018

View in Genome Browser
Species Human (GRCh38)
Location 19:58065975-58065997
Sequence CCTGCCATGAAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 1, 2: 10, 3: 47, 4: 481}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168647005_1168647018 27 Left 1168647005 19:58065925-58065947 CCAGGTCATGGCTGTGCAGAGAG 0: 1
1: 1
2: 1
3: 18
4: 257
Right 1168647018 19:58065975-58065997 CCTGCCATGAAGGAGGAGGAGGG 0: 1
1: 1
2: 10
3: 47
4: 481
1168647012_1168647018 -5 Left 1168647012 19:58065957-58065979 CCAGGGCAAAAAGAGAGTCCTGC 0: 1
1: 0
2: 1
3: 21
4: 181
Right 1168647018 19:58065975-58065997 CCTGCCATGAAGGAGGAGGAGGG 0: 1
1: 1
2: 10
3: 47
4: 481
1168647004_1168647018 28 Left 1168647004 19:58065924-58065946 CCCAGGTCATGGCTGTGCAGAGA 0: 2
1: 0
2: 0
3: 19
4: 252
Right 1168647018 19:58065975-58065997 CCTGCCATGAAGGAGGAGGAGGG 0: 1
1: 1
2: 10
3: 47
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168647018 Original CRISPR CCTGCCATGAAGGAGGAGGA GGG Intronic
900093412 1:930287-930309 CCAGGCTTGAAGCAGGAGGATGG + Exonic
900243007 1:1625768-1625790 CCAGCCCTGAAGGAAGGGGAGGG + Intronic
900393215 1:2442900-2442922 GCAGCCATGAAGGAGGAGGCGGG - Intronic
900609195 1:3537282-3537304 CCTGGCATGAAACAGGGGGAAGG + Intronic
901665832 1:10825716-10825738 CCTGCCATCCAGGAGGCTGAAGG + Intergenic
902836376 1:19049545-19049567 CCTGCCAAGAAGCAGGGGAATGG + Intergenic
902994392 1:20212468-20212490 CGTGCCCTGAAGGTGGAGAAGGG - Intergenic
903241313 1:21984393-21984415 ACTGCCTGGAAGGTGGAGGAAGG + Intronic
903244819 1:22007577-22007599 ACTGCCTGGAAGGTGGAGGAAGG + Intronic
903360576 1:22774431-22774453 GCTGCCAGGAAGAAGGAAGAAGG + Intronic
903935664 1:26893176-26893198 CCTTTCTTGGAGGAGGAGGAGGG - Intronic
904296347 1:29521972-29521994 CCTGCCCTGTAGGAGGAGCGTGG - Intergenic
904409977 1:30319473-30319495 CCTGTCCTGCAGGAGGAGCACGG + Intergenic
905320876 1:37116240-37116262 CCTACCATGATGGAACAGGAGGG + Intergenic
906129943 1:43450081-43450103 CCTGCAGTGAAAGATGAGGAGGG - Exonic
906901816 1:49843920-49843942 CCTGCCAGGAAGCAGGAGGAAGG + Intronic
907256153 1:53180641-53180663 CCTCCCGAGAAGGAGGAGCAAGG + Intergenic
907331936 1:53677278-53677300 CCTTCCATGAAGGACCAGCAGGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907666235 1:56435978-56436000 CTTGCCAGGCTGGAGGAGGAGGG - Intergenic
908022400 1:59911763-59911785 GCTGTCCTGAAGGTGGAGGAAGG + Exonic
908324251 1:63007647-63007669 TCTGCCAGGAGGGAGGAAGAAGG + Intergenic
908402503 1:63784734-63784756 CCTACCATGACAGAGGGGGAAGG + Intronic
908757882 1:67485685-67485707 CCTGCCATGTGGGAGCAGTAGGG + Intergenic
909483610 1:76151164-76151186 CCACCAATGAAGGCGGAGGAAGG - Intronic
910676209 1:89819689-89819711 ACTGCCAAGAAGGAGGTGTATGG - Intronic
912149393 1:106838852-106838874 GGTGCCATGAAGGAGAAGAATGG - Intergenic
914813748 1:151048139-151048161 TCCGCCATTAACGAGGAGGATGG + Exonic
915509488 1:156378710-156378732 CCAGCGAGGAGGGAGGAGGAGGG - Intronic
915584438 1:156836615-156836637 CCCACCATGAAAGAGGAGGGAGG - Intronic
915633793 1:157172500-157172522 CCAGCAGTGAAGGAGGAGGCTGG + Intergenic
916211694 1:162364988-162365010 CATGCCATGTTGGAGGTGGAAGG - Intronic
917591707 1:176482916-176482938 CATGTAATGAGGGAGGAGGATGG + Intronic
918295479 1:183152291-183152313 GCTGGTTTGAAGGAGGAGGAAGG + Intergenic
918569301 1:185969813-185969835 GATGCCCTGGAGGAGGAGGAGGG + Intronic
919663932 1:200274305-200274327 TCTGCCCTGAAGGAGGAGAGAGG - Intergenic
919792976 1:201304210-201304232 GTGGCCAGGAAGGAGGAGGAGGG - Intronic
919800923 1:201354207-201354229 ACTCCCAAGAAGGAGGAGGCTGG + Intergenic
919839970 1:201601880-201601902 GCTGCCATGAGGGAGTAGAAAGG - Intergenic
920003192 1:202813102-202813124 CCTGCCAGGAAAGAGGAAAAAGG - Intergenic
920460709 1:206137633-206137655 CATTCCCTGAAGGAGGAGAAAGG - Intergenic
920500576 1:206482593-206482615 CCTCCCATCAAGGAGGAGGATGG + Intronic
921157384 1:212449188-212449210 CCTGGGATGAAGAAGGAGGGAGG + Intergenic
921889434 1:220339079-220339101 CAAACCAGGAAGGAGGAGGATGG - Intergenic
923464699 1:234237811-234237833 ACTGCTATGAGGTAGGAGGAAGG - Intronic
924123690 1:240828123-240828145 CCTGCCCTTAAGGAAAAGGAAGG - Intronic
1063353487 10:5376903-5376925 CCTTCCCTGACAGAGGAGGAGGG - Intergenic
1063631221 10:7735231-7735253 CCTGCCAGCTGGGAGGAGGATGG + Intronic
1064310545 10:14208518-14208540 CCTGCCTTGGGGAAGGAGGAGGG + Intronic
1065149822 10:22811295-22811317 CATTCCATGAAGTAGGAGAAGGG + Intergenic
1065315952 10:24464350-24464372 CCTGGCAGGAAGGAAGAGAAGGG + Intronic
1065779431 10:29153175-29153197 CCAGCCATGAAGCAGGATGCTGG + Intergenic
1067429151 10:46231428-46231450 CCTCCCTTGAGGGATGAGGAAGG + Intergenic
1067444532 10:46332560-46332582 CCTCCCTTGAGGGATGAGGAAGG - Intergenic
1069865755 10:71501827-71501849 CCGGCCAGCCAGGAGGAGGAGGG + Intronic
1069927107 10:71858393-71858415 TCTGCCATGAATGAGGAAGCAGG - Intergenic
1070323176 10:75370289-75370311 CCTGCCCTGAAGGGGTAGGGTGG - Intergenic
1070921090 10:80186820-80186842 CCTGCCATGGAGGAGCGTGACGG - Intronic
1071201304 10:83222581-83222603 CCAGCCAGGAAGGGAGAGGAGGG + Intergenic
1071855273 10:89618146-89618168 CCTGCCTTGTAGGTGGAGAAGGG - Intronic
1073083628 10:100874862-100874884 GCAGACATGAATGAGGAGGAAGG + Intergenic
1074197694 10:111203742-111203764 CCTGCTCTGAATGAGGAAGAGGG + Intergenic
1074914397 10:117941540-117941562 CTGGCCTTGAAGGTGGAGGAAGG - Intergenic
1075086069 10:119415266-119415288 CATGCCATGAAGGGGTGGGAAGG + Intronic
1075388510 10:122075326-122075348 GGTGCCATGAAGGATGGGGAAGG + Intronic
1075648847 10:124114513-124114535 ACCTCCTTGAAGGAGGAGGAGGG + Intergenic
1076069797 10:127479375-127479397 CCTGCCCTCAAGGAGAAAGACGG - Intergenic
1076323714 10:129604147-129604169 CATGCAAACAAGGAGGAGGATGG - Intronic
1076518152 10:131061718-131061740 CCAGCTCTGCAGGAGGAGGATGG - Intergenic
1076563482 10:131382419-131382441 ACTGCTCTGAAGGTGGAGGATGG - Intergenic
1076864222 10:133159507-133159529 CCTGGCTTGAAGGAGCAGCAGGG - Intergenic
1077306128 11:1869428-1869450 GCTGCCTTGAAGGAGGAGGGAGG + Intronic
1077353053 11:2101587-2101609 CGTGCCATGAGGCAGCAGGAAGG - Intergenic
1077524182 11:3054266-3054288 CCTCCCAGTAAGGAGGAAGATGG - Intronic
1077832549 11:5890332-5890354 CCTGCAATGAAGGAGCAGGTGGG + Intronic
1078332957 11:10441025-10441047 ACTCCCCTGAAGAAGGAGGAGGG + Intronic
1078362206 11:10677778-10677800 CCTGCCAGAAAGGAGGAACAGGG - Intronic
1078892064 11:15566530-15566552 CCTACCATGAAGGAGAAAGAGGG - Intergenic
1079392986 11:20038542-20038564 CGTGATATGAGGGAGGAGGATGG - Intronic
1080740058 11:35055633-35055655 CCTTCCATGAAGGGGGATTATGG - Intergenic
1080806930 11:35662617-35662639 CGTGCCTTGGAGGAGGAGGAGGG - Intergenic
1082641057 11:55662196-55662218 CATGCCATGAAGGTGGCTGATGG + Intergenic
1083384909 11:62300458-62300480 GCTGCCACCAAGGAGGGGGAGGG + Intergenic
1084174214 11:67415346-67415368 GCTGCCATGAAGAAAGAGGGAGG - Intronic
1084274115 11:68043145-68043167 CCGGGCCTGAAGGAGGAGGCGGG - Intronic
1084654385 11:70506677-70506699 CCCTCCATGAAGCAGGAGGGAGG - Intronic
1085020674 11:73204942-73204964 CCGGCCCTGAAAGAGGAAGATGG - Intergenic
1085766540 11:79288064-79288086 TCTTCCTTGAAGGAGAAGGATGG + Intronic
1085834138 11:79934428-79934450 ACTGCCATCTAGGTGGAGGAGGG + Intergenic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1087153763 11:94881671-94881693 CCTGCCCTGAAGGTAGACGAGGG + Intergenic
1087325205 11:96713153-96713175 CCAGCCATCAAGGAAGAGCAAGG - Intergenic
1087844838 11:102961257-102961279 CCTTCCTTGACAGAGGAGGAAGG - Intergenic
1088723199 11:112612447-112612469 CCTGCAAGGAGGGAGGAGGGAGG + Intergenic
1089295441 11:117464610-117464632 CGTGCCAGGAAGAAGGAGGAAGG + Intronic
1089781437 11:120875728-120875750 CCTGCAATGATGGAGCAGGCAGG - Intronic
1090068672 11:123525494-123525516 GGTGCCAGGAAGGAAGAGGAGGG - Intergenic
1091309338 11:134561486-134561508 GCAGCCCTGAGGGAGGAGGAAGG - Intergenic
1091900632 12:4141282-4141304 CCCACCAGGAAGCAGGAGGATGG - Intergenic
1092533332 12:9363425-9363447 CCTGCTGTGGAGGAGGAGGGTGG - Intergenic
1092818512 12:12331703-12331725 TCTGACAGGGAGGAGGAGGAGGG + Intronic
1093675136 12:21929981-21930003 CCTGTCATGAGGTAGGGGGAGGG - Intronic
1093896221 12:24577463-24577485 GCTGGCATGTAGGAGGAGAAAGG + Intergenic
1094209909 12:27878106-27878128 CCTTCCTTGAAGGAGGAGCTGGG + Intergenic
1094368165 12:29706247-29706269 CCAGCTATGCAGGAAGAGGAAGG + Intronic
1095531051 12:43186996-43187018 CCTGTCATGAGGTAGGGGGAGGG - Intergenic
1095976417 12:47943400-47943422 CCTGCCCTGAGGAAGGAGGCGGG + Intergenic
1096424095 12:51486349-51486371 CCTTCCTTGAAGGGGGAGAATGG + Intronic
1097144636 12:56931741-56931763 CCTTGCATGAAGGAGCTGGAAGG - Intronic
1099050290 12:77774304-77774326 GCTTCCATGAAGCAGTAGGATGG + Intergenic
1099914690 12:88877526-88877548 CCTGTCAGGAGGCAGGAGGAGGG + Intergenic
1099978180 12:89568480-89568502 CCTGCCAGGGAGGAGGCTGAGGG - Intergenic
1101632649 12:106510731-106510753 CCTGCCATGAGGGCTGAGGAAGG - Intronic
1101994287 12:109513798-109513820 CCTGCAATCACGGAGCAGGAAGG - Intronic
1102027214 12:109720340-109720362 CCTCCCTTGGAGGAGGAGGGAGG + Intronic
1102494571 12:113310617-113310639 TCTGCCATGAAGGTGGAAGAGGG - Intronic
1102787097 12:115613862-115613884 CTGGCCTTGAAGGTGGAGGACGG + Intergenic
1102940406 12:116936546-116936568 CTGGCCTTGAAGGTGGAGGAAGG + Intronic
1103330605 12:120151330-120151352 CCAGCCATCAAGGAGGATGCTGG - Exonic
1103946339 12:124528769-124528791 CCTAGCCTGAAGGAGGAGAAAGG + Intronic
1104015622 12:124959931-124959953 CCTGCCCTGGAGCAGGGGGAGGG + Intronic
1104152688 12:126099194-126099216 CCTGCCAGGAAGGAAGAATATGG - Intergenic
1104233877 12:126912638-126912660 CTTGCCCTGAAGGAGGAAAATGG + Intergenic
1104248414 12:127065093-127065115 CTTGCCATGGAGATGGAGGAAGG - Intergenic
1104297669 12:127532140-127532162 TCTGCAAGCAAGGAGGAGGAAGG + Intergenic
1104373212 12:128242662-128242684 AGGCCCATGAAGGAGGAGGATGG + Intergenic
1105239214 13:18595557-18595579 CCTGCCTTGGAGAAGAAGGAAGG + Intergenic
1105609267 13:21954031-21954053 CCTGAAAAGAAGGAGCAGGAAGG - Intergenic
1106354778 13:28970735-28970757 GCTGCCACGATGGAGGGGGATGG - Intronic
1108557999 13:51614588-51614610 CCAGGCAGGAAGGAGGAGAAGGG + Intronic
1109721383 13:66280790-66280812 CCTGCCATGAGGTGGGTGGATGG - Intergenic
1110493906 13:76142680-76142702 CCTGCTATGAAGGAGGACAGTGG + Intergenic
1111002966 13:82208659-82208681 CCCACCATGGTGGAGGAGGAGGG - Intergenic
1111831548 13:93336517-93336539 CCAACCTTGAAGGAGGAGAATGG - Intronic
1113800279 13:113082859-113082881 CCTGCCCAGCAGGATGAGGAGGG - Intronic
1114796169 14:25717674-25717696 CCTGTCATGGAGTAGGGGGATGG - Intergenic
1116129746 14:40839740-40839762 GCTGAGAAGAAGGAGGAGGAGGG - Intergenic
1118009218 14:61592369-61592391 CCAGCTTTGAAGGTGGAGGAAGG - Intronic
1118780225 14:69003051-69003073 TTGGCCATGAAGGAGGAGGGAGG - Intergenic
1119095805 14:71829638-71829660 TCAGCCAGCAAGGAGGAGGAAGG - Intergenic
1119474658 14:74920141-74920163 CCAGCCAGGAAGGAGGAGGAAGG + Intronic
1121693617 14:95895118-95895140 CCTGCCTTGAAGCTGGACGAGGG + Intergenic
1121988105 14:98528136-98528158 CCTGCCCTGTAGGAGGAGTGGGG - Intergenic
1122601276 14:102923120-102923142 CCTGGTGTGAAGGCGGAGGAGGG - Intronic
1122880263 14:104687712-104687734 CCTGCCCTGATGGGGGAGGGAGG - Intergenic
1122939123 14:104973428-104973450 CCTGCCAAGCAGCAGGAGCAGGG + Intronic
1123043842 14:105501884-105501906 CCTGCCTTGAGGGATGAGGCTGG + Intergenic
1123492037 15:20788527-20788549 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1123548541 15:21357617-21357639 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1123791497 15:23725168-23725190 GCTGTCATGACGGGGGAGGAGGG - Intergenic
1125481208 15:40082247-40082269 CCAGCCATCCAGGAGGAGAAGGG - Intergenic
1125526281 15:40377365-40377387 CCAGCCAAGATGGAGGAGCAGGG + Intergenic
1127611893 15:60645213-60645235 CGTGGCATGAGGGAGGGGGAAGG + Intronic
1127630895 15:60826661-60826683 TTTCCCATGGAGGAGGAGGAGGG + Intronic
1128155465 15:65389047-65389069 TGTTCCATGAAGGAGGAAGAAGG - Intronic
1128316279 15:66661432-66661454 CCTGCTATGATGGTGGATGAAGG + Intronic
1128532978 15:68467591-68467613 CCTGTCATGAAGGAGGCTAAGGG - Intergenic
1129254902 15:74328738-74328760 CCTGCCATGCAGCAGGTGGGAGG + Intronic
1129780443 15:78266573-78266595 CCTTCCATGAAGGTAGAGGAAGG - Intronic
1130093817 15:80841433-80841455 CCTGCCCTTTAGGAGGAGCAGGG - Intronic
1130229993 15:82089426-82089448 CCTGCCAGGAAGGAAGGGAAAGG + Intergenic
1130714155 15:86315101-86315123 CTTGCAATGAACAAGGAGGATGG - Intronic
1130821623 15:87502146-87502168 CCTGGCCTGGAGGAGGTGGAGGG - Intergenic
1131094641 15:89647702-89647724 CCTGCCCTATAGGAGGATGAGGG - Exonic
1131163951 15:90128824-90128846 CCTTCCAAGAAGGAGAAAGACGG + Intergenic
1132083711 15:98888969-98888991 CCAGCCAGCAAGGAGGAGGATGG + Intronic
1132230698 15:100181722-100181744 TCTCTCCTGAAGGAGGAGGAAGG + Intronic
1132330695 15:101010428-101010450 CCTGCGATGGAGAAGAAGGAAGG - Exonic
1202956875 15_KI270727v1_random:84848-84870 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1132652653 16:1028635-1028657 GGTGCCATGCAGGAGCAGGATGG - Intergenic
1133292137 16:4729265-4729287 TCTGCCATGGAGGAGGAGAGAGG - Intronic
1133294316 16:4743469-4743491 TCCCCCAGGAAGGAGGAGGAGGG - Intronic
1133364112 16:5197439-5197461 GCTGGCTTGAAGGTGGAGGAAGG + Intergenic
1133738092 16:8630810-8630832 CCTGCCCTGACGGAGGAGAGTGG + Intronic
1133758677 16:8781172-8781194 GCTTCCATGATGGAGGATGATGG + Intronic
1134066716 16:11233114-11233136 CCCCCCATGAAGAGGGAGGAGGG - Intergenic
1134280231 16:12810562-12810584 GCTCCCATGAAGGAGGAGCCTGG - Intergenic
1135024621 16:18989554-18989576 CCACCCTTGGAGGAGGAGGAAGG + Intronic
1135712401 16:24729372-24729394 GCAGCAAAGAAGGAGGAGGAGGG + Intergenic
1137365519 16:47856161-47856183 CCAGCCTTAAAGGAGGAGTAGGG - Intergenic
1137520554 16:49191544-49191566 GCTTACATGAGGGAGGAGGAGGG + Intergenic
1137525988 16:49236756-49236778 CCGGCTATGAAGATGGAGGAGGG + Intergenic
1138420072 16:56893114-56893136 CAGGCCAGGAAGGAGAAGGAAGG - Intronic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1139548938 16:67662873-67662895 CCTGCAATCAAGCAGCAGGAGGG + Intergenic
1139790848 16:69433529-69433551 GCTGTGGTGAAGGAGGAGGAGGG - Intronic
1139804696 16:69554735-69554757 CATGCTAGGCAGGAGGAGGAAGG - Intergenic
1139813648 16:69647042-69647064 CCGCCCATGGAGGAAGAGGAGGG - Exonic
1140375380 16:74441344-74441366 ACTGTCAAGAAGAAGGAGGAAGG - Intergenic
1140480329 16:75258955-75258977 CCTGGGAAGGAGGAGGAGGAGGG + Intronic
1140705849 16:77628448-77628470 CCTACCATGAAGAATGATGAAGG - Intergenic
1140879526 16:79185319-79185341 CCTGCCACCAAAGCGGAGGATGG - Intronic
1141090327 16:81125867-81125889 CATGCCCTGAAGGTGGTGGAGGG + Intergenic
1141664359 16:85458265-85458287 CCTGCCCTCAAGGAGCAGGGAGG + Intergenic
1141987011 16:87586646-87586668 TCTGCCAGGAGGAAGGAGGATGG + Intergenic
1142244018 16:88960586-88960608 CCAGGCAGGAAGGAGGAAGAAGG - Intronic
1203141663 16_KI270728v1_random:1771309-1771331 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141710 16_KI270728v1_random:1771452-1771474 GCTGGGATGGAGGAGGAGGAGGG - Intergenic
1203141744 16_KI270728v1_random:1771553-1771575 GCTGGGATGATGGAGGAGGAGGG - Intergenic
1142470842 17:162486-162508 CCCGCTGTGAAGGTGGAGGAAGG + Intronic
1143114775 17:4576325-4576347 CCTGCTTTGGAGGAGGAAGATGG + Intergenic
1144577242 17:16436818-16436840 CCTCCCAAGGAGGATGAGGATGG + Exonic
1144740579 17:17580072-17580094 CCTGCCCTGAAGGGAGGGGAAGG + Intronic
1144851899 17:18248033-18248055 CCTGGCAGGAAGGATGAGCATGG + Exonic
1146373640 17:32280477-32280499 CAGGCTGTGAAGGAGGAGGAAGG + Intronic
1146672713 17:34752796-34752818 ACTGACATGAAGGAGAGGGAAGG - Intergenic
1146673596 17:34758222-34758244 CCTCCCAGGGATGAGGAGGAAGG - Intergenic
1146912149 17:36655683-36655705 CTTGGCATGAAGGTGGTGGAGGG + Intergenic
1147166567 17:38596564-38596586 CCTGGCATGAAGGAGGCAGGCGG - Intronic
1147324553 17:39663985-39664007 CCAGCCGGGAGGGAGGAGGAAGG - Intergenic
1148443693 17:47725357-47725379 CCTGCCTTTGAGGAGGAAGATGG + Intergenic
1149296430 17:55265767-55265789 CCTTTCATGGAGGAGGAGGAAGG - Intronic
1149430383 17:56592776-56592798 CCGGCCAAGGAGGAGGAGGATGG + Intergenic
1149650811 17:58275335-58275357 CCTGCGAAGAAGGAGAGGGAAGG + Intronic
1151042734 17:70882640-70882662 TCTTCCAAGAGGGAGGAGGAGGG + Intergenic
1151325399 17:73376867-73376889 TCTGGGGTGAAGGAGGAGGAAGG - Intronic
1151396160 17:73824403-73824425 CCTCCCAAGAAGCAGTAGGACGG - Intergenic
1151449561 17:74189859-74189881 CCAGCCAACAGGGAGGAGGAAGG + Intergenic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1151887908 17:76933936-76933958 CCAGCCAACAAGGAGAAGGAAGG + Intronic
1152357360 17:79813592-79813614 CCTGCAATGCAGCAGGGGGAGGG - Intergenic
1152418083 17:80175877-80175899 CCTGCCAGGAAGCAGGAGGAGGG - Intronic
1152820550 17:82435667-82435689 CCTGCAAGGAAGGAGCAGGACGG - Exonic
1153473455 18:5471065-5471087 CCTGCCATGCAGGAGCAGAGTGG + Intronic
1153695202 18:7633453-7633475 CCTGCCAGGAATGAGGGGAAGGG - Intronic
1154259179 18:12814734-12814756 GCAGACATGAAGGAGGCGGAAGG - Intronic
1155512936 18:26595517-26595539 TCTGCCAGCAAGAAGGAGGAAGG - Intronic
1156635101 18:39018413-39018435 CCTGCCATAAAGGAGCAAGAAGG - Intergenic
1157545430 18:48543181-48543203 CAGGTCATGAAGGAGGAGGCAGG + Intronic
1157622322 18:49023786-49023808 CCAGGCATGGAGGAGGAGGAAGG - Intergenic
1157941893 18:51938156-51938178 CCTGTCAGGAAGGTGGAGGGAGG - Intergenic
1158099856 18:53818947-53818969 CCTGGGCTGGAGGAGGAGGAAGG + Intergenic
1158411807 18:57212197-57212219 CCTGGCATGATGAAGGAGCATGG - Intergenic
1159569695 18:70098791-70098813 CCTGTCATGGGGTAGGAGGAGGG - Intronic
1160238704 18:77106721-77106743 CATGCCATGAAGCATGGGGAAGG - Intronic
1160425792 18:78778273-78778295 CCCTCCATGAAGCCGGAGGACGG + Intergenic
1160955634 19:1690474-1690496 CCTGGTAGGAAGGAGGAGGTTGG + Intergenic
1161202072 19:3020558-3020580 ATTGTCATGAAGGTGGAGGAGGG - Intronic
1161391559 19:4023869-4023891 CCGCCCAGGAAGGAGGATGAGGG - Intronic
1161998915 19:7731043-7731065 GGTGCCCTGAAGGAGGAGGTCGG - Exonic
1162050701 19:8030846-8030868 CTGGCCGTGAAGGTGGAGGAAGG + Intronic
1163048266 19:14661289-14661311 CCTGCAGTGAAAGAGAAGGAAGG + Intronic
1163105142 19:15119082-15119104 CTTCACACGAAGGAGGAGGAAGG - Intronic
1163262511 19:16199694-16199716 CCTTCCAAGAAGGCGGGGGAGGG - Intronic
1163481884 19:17561433-17561455 ACTTCCAAGAAGCAGGAGGAAGG + Intronic
1163938868 19:20475054-20475076 CCTGCCATTTAGGCAGAGGATGG - Intergenic
1164236234 19:23337138-23337160 CCTGACATGAAAGAGTAAGAAGG - Intronic
1164308791 19:24028888-24028910 CCTAACATGGAGGAGGAGGCAGG - Intergenic
1164526533 19:29017321-29017343 CCCTCCATGGAGAAGGAGGATGG - Intergenic
1164563396 19:29309314-29309336 CCTGCCCTGAATGAGCAGGCTGG + Intergenic
1166039268 19:40192026-40192048 TCCCCCATGGAGGAGGAGGAGGG + Exonic
1166195731 19:41204507-41204529 TCTGCAGTGAAGGTGGAGGAGGG - Intronic
1166288150 19:41845145-41845167 CCGGCTAAGAGGGAGGAGGACGG - Intronic
1167139037 19:47636903-47636925 CCTGCCTTGAAGGAAGAGGTTGG - Intronic
1167474543 19:49692144-49692166 CTGGGTATGAAGGAGGAGGAGGG + Intronic
1168191387 19:54740910-54740932 CCAGCTTTGAAGGTGGAGGAAGG + Intronic
1168193656 19:54757538-54757560 CCAGCTTTGAAGGTGGAGGAAGG + Intronic
1168200671 19:54813191-54813213 CCAGCGATGAAGGAGAAAGAAGG - Intronic
1168236894 19:55069206-55069228 CCAGCCTGGCAGGAGGAGGAGGG - Intronic
1168238181 19:55076330-55076352 CCTGCATTGAGGGAGGAGGCTGG + Intronic
1168647018 19:58065975-58065997 CCTGCCATGAAGGAGGAGGAGGG + Intronic
1168720031 19:58549771-58549793 CCTGACCTGAAGGAGGAGGATGG + Exonic
925349994 2:3194302-3194324 CCTGCCCTGCAGGAAGAGGCTGG + Intronic
926894387 2:17668943-17668965 CCTGCCAAAATGGTGGAGGACGG + Intronic
926905116 2:17798377-17798399 CCTGCCATGCAGGATGAAGGAGG - Intronic
926918509 2:17916329-17916351 GAGGCCATGAAGGAGGAAGAGGG + Intronic
927275027 2:21255226-21255248 ACTGCCATCAAGCAGGGGGAGGG - Intergenic
928299250 2:30111019-30111041 CCAGCCAGGATGGAGCAGGACGG + Intergenic
931097470 2:58957453-58957475 CCAGGCAGGAAGAAGGAGGAGGG - Intergenic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931641322 2:64383200-64383222 CCTGCCCTGAATGAGGGAGACGG + Intergenic
931657761 2:64525003-64525025 CCTGTCACGAGGGAGGGGGAAGG - Intronic
932439730 2:71726298-71726320 CCTACCCTCAAGGAGGAGGATGG - Intergenic
932475625 2:72004002-72004024 CCTGCCTGGAAGGAGGGGTAAGG + Intergenic
933999531 2:87696160-87696182 GCTGCCATGAAGCTGGAGAAAGG - Intergenic
934121648 2:88845955-88845977 CCAGCCCTGTTGGAGGAGGATGG + Intergenic
934568682 2:95354581-95354603 CCTCCCAGGATGGAGGAGCAAGG - Intronic
934573617 2:95386553-95386575 CCTGGGAGGAGGGAGGAGGAGGG + Intergenic
934934931 2:98458603-98458625 ACAGCCATGAAGGGGCAGGAAGG - Intronic
935038790 2:99405385-99405407 CCTGCATGGAAGGAGGCGGAAGG - Intronic
935095631 2:99941708-99941730 CCTGATAGGAAGGAGGAAGAAGG - Intronic
935863212 2:107356928-107356950 CCTTCCCTGGAGCAGGAGGAAGG - Intergenic
937045298 2:118848046-118848068 CCCGGCCTGAAGGAGGGGGAGGG - Intergenic
938128386 2:128690682-128690704 CCAGCCATGAAGGAGCAAGAAGG - Intergenic
939894656 2:147776844-147776866 CTTTCCCTGAAGGAGGAGGTGGG - Intergenic
940939208 2:159538455-159538477 TTTGCCAAGAAGCAGGAGGAAGG - Intronic
940970687 2:159893687-159893709 GGTGTCATGGAGGAGGAGGAGGG - Intronic
941346661 2:164377481-164377503 CCTGCCCAGAAGCAGGGGGATGG + Intergenic
941966930 2:171310077-171310099 TCTCCCAGGAAGGAGGAGGGTGG - Intergenic
942260223 2:174152971-174152993 CCTGTAATGAGAGAGGAGGAAGG - Intronic
942277039 2:174330851-174330873 CCTGCCATGAACAAGGGAGAAGG - Intergenic
942899944 2:181103344-181103366 TATGCCCTGGAGGAGGAGGAAGG - Intergenic
945058129 2:205885761-205885783 CCCGCCATGAAGGACTAGGCGGG - Intergenic
945703617 2:213201648-213201670 CCTATAAAGAAGGAGGAGGAGGG - Intergenic
946346221 2:219112646-219112668 CCAGATATGAAGGAGGAGAAAGG + Intronic
946399043 2:219459243-219459265 CCAGCCAGGAAGGAGGGGGCAGG - Intronic
946431551 2:219629296-219629318 CCTCCCATCCAGGAGGAGGGGGG + Exonic
947603299 2:231467852-231467874 CCTGCCATGTAGGCCGAGCAGGG + Intronic
947634263 2:231672290-231672312 CCTGTTATGAAGGCGGGGGAGGG - Intergenic
948227023 2:236319115-236319137 GCTGCGATGAAGAAGGAGGAGGG - Intergenic
948281103 2:236748579-236748601 CTTGCATTGAAGGAGGAAGAGGG - Intergenic
948384999 2:237575706-237575728 CAGGCCCTGCAGGAGGAGGAAGG - Intronic
948561582 2:238857174-238857196 CCTCCCATGAGAGAGGAAGAGGG + Intronic
948578658 2:238969935-238969957 CATGGCATGAAGGCAGAGGAAGG - Intergenic
948979112 2:241483748-241483770 CCTGGAATGAAGAAGGAGGCTGG - Intronic
1169152079 20:3297273-3297295 CCTGCCAAGAAGCAGAGGGATGG + Intronic
1169198739 20:3697407-3697429 CCAGCCTGGAAGGAGCAGGAAGG + Intronic
1169569476 20:6890510-6890532 AATGGCCTGAAGGAGGAGGAGGG - Intergenic
1170788785 20:19490900-19490922 ATTGCCATGAGGGAGGAGCAGGG - Intronic
1170940860 20:20846786-20846808 CCAGCCCTGAAGGAGGAGGAGGG - Intergenic
1171374204 20:24681081-24681103 AATGCAATGACGGAGGAGGATGG + Intergenic
1171490017 20:25510286-25510308 CGTGCCAGGAAGGAGGTGCAGGG + Intronic
1172109875 20:32538494-32538516 CCAGCCATGAAGGAGGAGGGAGG - Intronic
1172204834 20:33155880-33155902 CCTGCCCTGAAGAGGGAGGCAGG - Intergenic
1172838434 20:37887709-37887731 CCTGCCAAGAAGGAGGCCAAGGG + Intergenic
1173413422 20:42835986-42836008 CCTGGCATGAAGGAGGAGTTTGG + Intronic
1173811519 20:45958773-45958795 CCAGGCAGGAAGCAGGAGGAAGG - Intronic
1173849163 20:46207091-46207113 CCTGGCATGGAGGAGGAGCTGGG + Intronic
1173854801 20:46243208-46243230 CCTGCCACGCAGGAGGAGCCGGG + Intronic
1174200232 20:48801966-48801988 CATGCCATGATGCAGCAGGAAGG + Intronic
1175194851 20:57236020-57236042 GGTGCCAGGAGGGAGGAGGAGGG - Intronic
1175764141 20:61581458-61581480 CTGGCCATGAAGATGGAGGAGGG - Intronic
1175934346 20:62508190-62508212 CCAGCCCTGCAGGTGGAGGAGGG + Intergenic
1176446586 21:6827306-6827328 CCTGCCTTGGAGAAGAAGGAAGG + Intergenic
1176824756 21:13692336-13692358 CCTGCCTTGGAGAAGAAGGAAGG + Intergenic
1177108649 21:16995439-16995461 CCAGCCATGAAGGAGTAATAGGG + Intergenic
1178787391 21:35666414-35666436 CTTGGTGTGAAGGAGGAGGAAGG - Intronic
1179073502 21:38095359-38095381 CCAGCCCTGAATTAGGAGGAAGG - Intronic
1179182490 21:39057629-39057651 CTGGCTTTGAAGGAGGAGGAAGG - Intergenic
1179708667 21:43197194-43197216 CCAGCCATGAAGGAGTAGCTAGG + Intergenic
1179837808 21:44049032-44049054 CCTGAGATGAAGCAAGAGGAGGG - Intronic
1180199534 21:46216035-46216057 CCTGCCATGGGGAAGAAGGAGGG - Intronic
1180201458 21:46227286-46227308 GTTGCCTTGAGGGAGGAGGAAGG - Intronic
1180967984 22:19800449-19800471 CCTGCCAGGCTTGAGGAGGAGGG + Intronic
1181266568 22:21634241-21634263 GCTGCCATGAAGACGGAGGCTGG + Exonic
1181573027 22:23778127-23778149 CCTGCACTGAAGGAGAGGGATGG - Intronic
1181743501 22:24939814-24939836 TGTGCCATGAAGAAGGTGGAGGG - Intronic
1182792696 22:32966216-32966238 CCTGCCTGGATGGAGGGGGAGGG + Intronic
1183191116 22:36322581-36322603 CCTGCCTGGAAGGGGGACGATGG + Intronic
1183516543 22:38270182-38270204 CCACCTATGAAGGAGAAGGAGGG - Intronic
1183637028 22:39070371-39070393 CCTGGGAAGGAGGAGGAGGAAGG - Intronic
1183715547 22:39531257-39531279 CTTGCCATGAAGCAGGAGTGTGG - Intronic
1183979039 22:41529095-41529117 ACTGCAGTGAAGGAGGAGCAGGG + Exonic
1184254616 22:43280050-43280072 CCAGCCAGTCAGGAGGAGGAAGG + Intronic
1184465438 22:44666724-44666746 CTTGCCAGGAGGGAGGAGGGAGG + Intergenic
1184788047 22:46681218-46681240 CGGGCCATGGAGGAGGCGGAGGG + Intergenic
1185004556 22:48268061-48268083 CCGGCCATGAGGAAGGAGGAGGG + Intergenic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
949779013 3:7664836-7664858 CCAGCCATAAAGCAGGAGGGAGG - Intronic
950224674 3:11223972-11223994 ACTGTCAGCAAGGAGGAGGATGG + Intronic
950467075 3:13161985-13162007 CCAGCCCTGGGGGAGGAGGATGG - Intergenic
950680801 3:14583852-14583874 CCTCCCAAGATGGAGGAGGAGGG - Intergenic
950764557 3:15263750-15263772 CCTGCCTTGAAGAAAGAGGAGGG + Intronic
951145068 3:19216877-19216899 CTTGCCAGGAAGGGTGAGGAAGG + Intronic
952707459 3:36393715-36393737 CCATCCATGAACCAGGAGGAAGG + Intronic
953023420 3:39130400-39130422 CCAGCAGGGAAGGAGGAGGACGG + Intronic
953636721 3:44670730-44670752 CCTGTGAGGAAGGAGCAGGATGG + Intergenic
954444654 3:50540268-50540290 CCTGCCCTGGAGGGGGAGAATGG - Intergenic
954707222 3:52487470-52487492 CCAGACGTGGAGGAGGAGGAGGG + Exonic
955160271 3:56458673-56458695 CCTGACAGGAAGCAGGAGGTTGG - Intronic
955409636 3:58647326-58647348 CCTGCCCAGAAGGAGGAGAAGGG - Intronic
956254584 3:67270536-67270558 CCTGAGATGAAGGAGGAGTTGGG - Intergenic
956653098 3:71523198-71523220 CCTGCCAGGAGGTAGGAGAAGGG + Intronic
957003747 3:74918645-74918667 CCTGTCATGGGGCAGGAGGAGGG - Intergenic
957275541 3:78086293-78086315 CCAGGCAGGAAGGAGCAGGATGG - Intergenic
959944355 3:112111553-112111575 CCTGCCATGGGGGATTAGGATGG + Intronic
960899266 3:122538256-122538278 CCTGACATGTAGGAGGAGCTTGG - Intronic
961745152 3:129059760-129059782 TTGGCCATGCAGGAGGAGGAAGG + Intergenic
962594321 3:136924721-136924743 ACTGCCATTAGGCAGGAGGAGGG + Intronic
963472550 3:145760246-145760268 TCAGCCAGGAAGGAAGAGGATGG + Intergenic
963945259 3:151138911-151138933 TCTGCCCTCAAGGAGGGGGATGG - Intronic
964612036 3:158625162-158625184 CCTGCCATGAGCAAGGTGGAGGG + Intergenic
965632786 3:170750434-170750456 CATGCCAAGATGGAGCAGGAAGG - Intronic
966225901 3:177597687-177597709 CCAGCCATGAAGCATGAGGCTGG - Intergenic
966329506 3:178794893-178794915 CTTGCCATAAAGGAGTATGATGG - Intronic
967881089 3:194302174-194302196 CCTGTCCTTAAAGAGGAGGAAGG - Intergenic
968874417 4:3257836-3257858 CCTGCCGAGAAGCAGAAGGAAGG + Intronic
969409890 4:7021053-7021075 GCTGTCGTGAAGGAGGAAGACGG - Intronic
969467436 4:7366140-7366162 CCTGCCAAGGAGGAGGAGGGTGG - Intronic
969568816 4:7996026-7996048 CTGGGCATGAAGGAGGAGGAAGG - Intronic
969657894 4:8508587-8508609 CCGGCCATGAAGGCTGAGGATGG - Intergenic
971422910 4:26490362-26490384 CCTGCCGTGGAGGAGCAGGGAGG + Exonic
973709789 4:53617527-53617549 CATGTCATGAAGCAGAAGGATGG - Intronic
973980393 4:56303885-56303907 ACTGCGATGAAAGAGGAGAATGG - Intronic
975814777 4:78206279-78206301 TGTGCCATGAAGGTGGAGGAAGG + Intronic
980001315 4:127492129-127492151 CCTACATTGAAAGAGGAGGAAGG + Intergenic
981007251 4:139888632-139888654 CCTCCCATGAAGGAGGACAGTGG + Intronic
981643304 4:146969482-146969504 CCTGCCAGCAAAGAGAAGGAGGG + Intergenic
984126266 4:175814975-175814997 ACTGCCATCAAACAGGAGGAAGG - Intronic
985339556 4:188934715-188934737 CCTGCCCTGAAGGAGAAAGAAGG + Intergenic
985824100 5:2180214-2180236 CCTGCCGTGAAGGTGGTGGGGGG - Intergenic
985824111 5:2180251-2180273 CCTGCCGTGAAGGTGGTGGGGGG - Intergenic
985824122 5:2180288-2180310 CCTGCCGTGAAGGTGGTGGGGGG - Intergenic
986192522 5:5510248-5510270 CCTGCCAGGGTGGAGGGGGAAGG - Intergenic
986221994 5:5776354-5776376 CCTGGGATGCAGGAGGAGGGAGG + Intergenic
988350266 5:30095687-30095709 CCTGTCAGGGAGGAGGAGGAGGG - Intergenic
988700903 5:33673627-33673649 CCTGCCAACAGTGAGGAGGATGG - Intronic
990382711 5:55232546-55232568 CCTGCCGGGAAGGAGGGGGGAGG + Exonic
991257354 5:64629745-64629767 CCTGACAGGAGGGAGGAGGGAGG + Intergenic
992247936 5:74846898-74846920 CCTGCCATGACGTAGTAGGGTGG - Intronic
992572479 5:78073835-78073857 CTTACCACAAAGGAGGAGGAAGG + Intronic
993267489 5:85744625-85744647 CCTTCCTTGAAGCAGAAGGAAGG + Intergenic
994255377 5:97587249-97587271 CCTGCTAAGAAGGAGGCGGAAGG + Intergenic
995213979 5:109573611-109573633 CCTACAATGAAAGAGGAGGCAGG + Intergenic
997251415 5:132391592-132391614 CCTGGCATGTTTGAGGAGGAGGG + Intronic
997981830 5:138472444-138472466 CCTTTCAGGTAGGAGGAGGAAGG - Intergenic
998401591 5:141851448-141851470 CATGCCCTGAAGTAGGGGGATGG + Intergenic
999361892 5:150992540-150992562 CCGGAGCTGAAGGAGGAGGAGGG + Intergenic
999424783 5:151477762-151477784 CCTTCCAAGAAGGAAGAGGCAGG + Intronic
999854530 5:155579822-155579844 CCTACCCTCAAGGAGGAGGATGG + Intergenic
1000248272 5:159468468-159468490 CCGGCCTTGAAGATGGAGGAAGG + Intergenic
1000592593 5:163176557-163176579 CCTGATGTGAAAGAGGAGGAGGG + Intergenic
1001041354 5:168337856-168337878 CTAGCCATGCAGGAAGAGGATGG + Intronic
1001413122 5:171524690-171524712 CCTGCCATGCAACGGGAGGAGGG + Intergenic
1001618321 5:173059905-173059927 CCTGCCATGACAGAGAATGATGG - Intronic
1001706508 5:173744757-173744779 CCGGTCATTACGGAGGAGGAGGG - Intergenic
1001784087 5:174396763-174396785 CCAGCCATGGAGGTGAAGGAGGG + Intergenic
1002884100 6:1278571-1278593 CCTGCCACAGTGGAGGAGGAGGG + Intergenic
1003521677 6:6863440-6863462 CCTGACTGGAAGGAGGAGGAAGG - Intergenic
1003527793 6:6912418-6912440 CATACCTGGAAGGAGGAGGAGGG + Intergenic
1004522772 6:16377990-16378012 CTTGCCATGAAGTAGGCAGAAGG - Intronic
1005530937 6:26705214-26705236 TCTGCAAAGAAGGAGGAGAAAGG - Intergenic
1005539859 6:26796422-26796444 TCTGCAAAGAAGGAGGAGAAAGG + Intergenic
1006401950 6:33822832-33822854 CCTGGCCTGAGGGAGGAGGAGGG - Intergenic
1006876628 6:37303196-37303218 CCTGTCACCAAGGAGGAAGAAGG + Intronic
1007408224 6:41646914-41646936 CCTGCAATGAGGCAGCAGGATGG + Intronic
1007514457 6:42400339-42400361 CATGCCAAGAAGGAGGAGTAAGG + Intronic
1008164628 6:48120978-48121000 CCTTCCATGAAGGAGAAGGAAGG + Intergenic
1009010676 6:57838563-57838585 TCTGCAAAGAAGGAGGAGAAAGG + Intergenic
1010044123 6:71420614-71420636 CCGGCCCGGCAGGAGGAGGAGGG + Intergenic
1012988883 6:105904524-105904546 CCATCCCTGATGGAGGAGGATGG + Intergenic
1016733938 6:147455627-147455649 TCTGTTATGGAGGAGGAGGAAGG + Intergenic
1017557057 6:155583066-155583088 TCTGCCATGGGGAAGGAGGATGG + Intergenic
1018684889 6:166296724-166296746 CCAGCCCTGGAGGAAGAGGAAGG - Intergenic
1018850822 6:167589084-167589106 GCTCCTCTGAAGGAGGAGGATGG - Intergenic
1018935811 6:168273516-168273538 CCTGGCTTCCAGGAGGAGGAAGG + Intergenic
1019137887 6:169922526-169922548 GCTGCCTGGGAGGAGGAGGAAGG + Intergenic
1020107925 7:5430768-5430790 CCTGGCATGAGGAAGGAGGGGGG + Intergenic
1020429879 7:8107904-8107926 CCTGCCATGATGCAGTGGGACGG - Intergenic
1020463058 7:8444783-8444805 ACTGCAATGAAGGAGGAGTTAGG - Intronic
1022388317 7:29922478-29922500 CCTGCCAAGAATGATGAGGCAGG + Intronic
1022464861 7:30646825-30646847 TCTGCAATGAAGGGGGAGGGGGG + Intergenic
1022466469 7:30655851-30655873 TCTGCCAGGAAGCAGGGGGACGG + Intronic
1022518008 7:30987967-30987989 CCAGCCATGAAGGTGGGGAAGGG + Intronic
1022580231 7:31545681-31545703 CCTGCCATTTAGGAGCAGGCTGG - Intronic
1023167707 7:37359184-37359206 CCTGCAAGGAAGGAGTAGGAAGG - Intronic
1024235824 7:47397020-47397042 CCTGGCAGGAGGGTGGAGGATGG - Intronic
1024249538 7:47495860-47495882 TCTGCCGAGATGGAGGAGGAAGG - Intronic
1024760658 7:52593165-52593187 CCTGGCAAGAGGGAGCAGGATGG + Intergenic
1024963369 7:55001750-55001772 AGTGCCAGGAAGGAGGAGGAAGG - Intergenic
1025620520 7:63166091-63166113 CCTTCCTTGAAAGATGAGGAAGG + Intergenic
1026831059 7:73610420-73610442 CCAGTCATGGAGGAGGGGGACGG - Intronic
1026869577 7:73842210-73842232 CCTCCTCTGAAGGGGGAGGAGGG - Intronic
1026895821 7:74009593-74009615 CCTGACTTGAGGCAGGAGGAAGG - Intergenic
1027581798 7:80005932-80005954 ATTGCCCTGAAGGAGGAGGGAGG + Intergenic
1029183559 7:98721988-98722010 CCTGGCAGGAGGGAGGAAGAGGG - Intergenic
1029419806 7:100466774-100466796 CCAGCCTTGATGGAGGAGGGAGG - Exonic
1029518512 7:101043988-101044010 CCTGCCATGGGGTAGGGGGATGG - Intronic
1029599073 7:101553332-101553354 CCTGGCGTGAAGGGGGAAGAAGG + Exonic
1030303014 7:107993011-107993033 CATGCCAAGAAGGAGCAGGCAGG + Intronic
1030435460 7:109513843-109513865 TCTGCCCTGAAGGAGGTAGAAGG - Intergenic
1030681240 7:112436639-112436661 AATAGCATGAAGGAGGAGGAGGG + Intronic
1031348848 7:120703315-120703337 CCTGTCATGAAGTAGCAAGATGG - Intronic
1031999298 7:128254385-128254407 ACTGCTATGCAGGAGGAAGAGGG - Exonic
1032993065 7:137415156-137415178 CCTGCGTTGAAGGACAAGGAAGG + Intronic
1033504885 7:141989965-141989987 TGTTCCATGTAGGAGGAGGAAGG + Intronic
1034407544 7:150915226-150915248 CCTGCCATGACAGAGGTCGAGGG - Intergenic
1034411704 7:150945546-150945568 GAGGCCATGGAGGAGGAGGAAGG + Intronic
1035122229 7:156578471-156578493 CCTGCCAGGGAGGAAAAGGAGGG + Intergenic
1035160341 7:156945194-156945216 CCTGTCTTGGAGGAGGAGGAGGG - Intergenic
1036017124 8:4797332-4797354 CCTGGAATGAAGCAGGAGAAAGG + Intronic
1036747261 8:11418607-11418629 ACTGCCATCACGGTGGAGGAGGG + Intronic
1037893512 8:22636663-22636685 CCTGCCAAGGAGGAGGAGAAAGG + Intronic
1037950251 8:23014916-23014938 CCTGGCATGGAGGAGGAGATGGG - Intronic
1037988053 8:23301982-23302004 CCAGCCCTGCAGGGGGAGGAGGG - Intronic
1038578411 8:28725378-28725400 CCTGGCTTGATGGAGGTGGATGG + Intronic
1039271516 8:35886268-35886290 CATGCCTTAAAGGAGGAGTAAGG - Intergenic
1039371052 8:36984243-36984265 CCTGACAGGCTGGAGGAGGAGGG + Intergenic
1041000598 8:53446663-53446685 CCTGTCATGGAGTAGGGGGAGGG + Intergenic
1041715366 8:60927248-60927270 CCTTCCAGGAATGGGGAGGAGGG - Intergenic
1042091630 8:65165531-65165553 ACTGACATGAGGGAGAAGGAGGG + Intergenic
1043934750 8:86130628-86130650 AGTTCCAGGAAGGAGGAGGAAGG + Intronic
1045007996 8:97932677-97932699 CCTGCCCTCCCGGAGGAGGAAGG - Intronic
1045187252 8:99851665-99851687 CCTGGCATCAAGGAGGAGCAGGG + Intronic
1045243719 8:100424749-100424771 CCTGTAATGAATGAGGTGGAGGG - Intergenic
1045504531 8:102769179-102769201 TCTGATTTGAAGGAGGAGGATGG - Intergenic
1045542932 8:103103548-103103570 CATGCCAGGTAAGAGGAGGAAGG - Intergenic
1047026081 8:120826047-120826069 CATGCTATGAAGCAGAAGGAAGG - Intergenic
1047288248 8:123506658-123506680 ACTGCCTTGAGGGTGGAGGACGG - Intronic
1047818497 8:128492181-128492203 CCTGGCTTGAAAGTGGAGGAAGG + Intergenic
1048664916 8:136650143-136650165 CCTGTCATGAGGTAGGGGGATGG + Intergenic
1048846338 8:138606571-138606593 CCTCCCATGATGGAGGGGCATGG + Intronic
1049157429 8:141075525-141075547 CCGGCCAAGAAGGAGGAAGGAGG - Intergenic
1049216588 8:141411114-141411136 CCTGGCATACAGGAGGAGGGTGG - Intronic
1049228558 8:141470120-141470142 CCTGCCCTGAAGGCAGAGGCAGG - Intergenic
1049368883 8:142254079-142254101 TCTGCCAAGAAGAAGGTGGAAGG - Intronic
1049431315 8:142566592-142566614 CCTGGCAGGAAGGAGGCGGCAGG + Intergenic
1049584811 8:143427988-143428010 CCTGAATTGAAGGAAGAGGAGGG - Intronic
1050898102 9:10909636-10909658 CGTGACATGAAGGAGTAAGATGG + Intergenic
1051840457 9:21391951-21391973 GCTGCGAAGCAGGAGGAGGAAGG + Intergenic
1053107789 9:35427144-35427166 CCTGCCATGAAGAAAGAAGAAGG - Intergenic
1055398018 9:75893378-75893400 CATGCCATGATGAAGGAGGAAGG + Intronic
1056531629 9:87493156-87493178 CATGAGATGAAGGAGAAGGAAGG - Intergenic
1057045323 9:91881817-91881839 CCTGAGATGAAGAAGGATGAGGG + Intronic
1057558464 9:96108286-96108308 CCTTCCAGGGAGGAGTAGGATGG - Exonic
1057717141 9:97503669-97503691 CCTACCCTGAAGGAGGGAGAAGG - Intronic
1058911313 9:109522359-109522381 CCTGGCCTGATGGAGGATGATGG + Intergenic
1059466120 9:114469909-114469931 CCAGCCTTGAAGATGGAGGATGG - Intronic
1060788676 9:126470510-126470532 ACTGCCCTGAAGGAGGAGGTGGG + Intronic
1060926321 9:127457684-127457706 CCAGGCAAGAAGGAAGAGGAGGG + Intronic
1061035795 9:128113782-128113804 GCTGGCTTGAAGGTGGAGGAAGG + Intergenic
1061083863 9:128387914-128387936 CCTTCCCTGAAGCAGGTGGAGGG + Intronic
1061210099 9:129186512-129186534 GCTGCCATGAGGAAGGATGAAGG - Intergenic
1061678119 9:132229658-132229680 CCAGACATGGAGGTGGAGGAAGG + Intronic
1062164555 9:135100984-135101006 CCTGGGAAGAGGGAGGAGGAAGG - Intronic
1062222229 9:135422874-135422896 CCTCCTATGAAGGAGCAGAAAGG + Intergenic
1062634149 9:137481135-137481157 CCAGGCACCAAGGAGGAGGAAGG + Intronic
1203772083 EBV:54557-54579 CCGCCAAAGAAGGAGGAGGAGGG - Intergenic
1203522604 Un_GL000213v1:57225-57247 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1185550610 X:980616-980638 GCTGCCATGGAGGAGGAGGAGGG + Intergenic
1185550642 X:980720-980742 GCTGCCATGGAGGAGGAGGAGGG + Intergenic
1185617976 X:1434931-1434953 CTTGGCTTGAGGGAGGAGGACGG - Intronic
1186206772 X:7208920-7208942 CCAGCCTTGAAGATGGAGGAAGG - Intergenic
1186596689 X:10989368-10989390 CCTGTCATAAAGGAAGGGGAGGG + Intergenic
1186726262 X:12362354-12362376 CCTGTCATGGAGTGGGAGGAGGG - Intronic
1187047338 X:15660164-15660186 CCTGCCACCAAAGAGGAGAAAGG - Intronic
1189454803 X:41176260-41176282 CAGACCATGAAGGAGGAGGAGGG - Intronic
1189973378 X:46439821-46439843 CCAGCATTGAAGGTGGAGGAGGG + Intergenic
1191633603 X:63351552-63351574 ACCGCCAGAAAGGAGGAGGAGGG - Intergenic
1191980093 X:66916117-66916139 CCTGGCAGGAAATAGGAGGATGG + Intergenic
1192168118 X:68838595-68838617 CCTGCCCAGAAGGAAGAAGATGG - Exonic
1192920254 X:75698573-75698595 CCTGTCATGAGGTGGGAGGAGGG + Intergenic
1193755957 X:85408827-85408849 CCTGCCCTCAAGCAGAAGGAAGG + Intergenic
1195368349 X:104148676-104148698 CCTGTCATGGGGTAGGAGGACGG + Intronic
1196113208 X:111969416-111969438 CCTGCCCTGAAACAGAAGGATGG - Intronic
1198674267 X:139115456-139115478 CCAGTCAGGAAGGAGGAGGATGG - Intronic
1198836894 X:140815333-140815355 CCTGCTCTGATGGAGGAGGCAGG + Intergenic
1199666016 X:150097130-150097152 CTTGCCTTGAAGATGGAGGAAGG - Intergenic
1200137783 X:153883360-153883382 TCTGCCTAGAAGGAGGAGGAAGG + Intronic
1200887219 Y:8281671-8281693 CTGGCCAAGAAGGAGGAGGATGG - Intergenic