ID: 1168648542

View in Genome Browser
Species Human (GRCh38)
Location 19:58077548-58077570
Sequence TCCTGGGATGGGGCCACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168648542_1168648549 -6 Left 1168648542 19:58077548-58077570 CCAAGTGTGGCCCCATCCCAGGA 0: 1
1: 0
2: 2
3: 19
4: 252
Right 1168648549 19:58077565-58077587 CCAGGAGCCTCTCAGGTTGAAGG 0: 1
1: 0
2: 3
3: 22
4: 187
1168648542_1168648551 26 Left 1168648542 19:58077548-58077570 CCAAGTGTGGCCCCATCCCAGGA 0: 1
1: 0
2: 2
3: 19
4: 252
Right 1168648551 19:58077597-58077619 TAATAAATCACTGACTTCACTGG 0: 1
1: 0
2: 0
3: 14
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168648542 Original CRISPR TCCTGGGATGGGGCCACACT TGG (reversed) Intronic
900031437 1:375700-375722 TCCAGACCTGGGGCCACACTTGG + Intergenic
900051988 1:603900-603922 TCCAGACCTGGGGCCACACTTGG + Intergenic
900127563 1:1075324-1075346 GCCTGGGGGGGTGCCACACTGGG + Intergenic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
901773216 1:11541564-11541586 GCTTGGGAGGGGGCCACACAGGG + Intergenic
901833814 1:11910684-11910706 TCCTGGGAGACGGCAACACTGGG - Intergenic
902040785 1:13490809-13490831 GCCTGGGAGGGAGCCACAGTGGG - Intronic
903179296 1:21597367-21597389 CCCTGGGAGGGGCCCACCCTTGG + Intronic
903502312 1:23807856-23807878 AGCTGGGATGGGGCCCCTCTAGG + Intronic
904944505 1:34189492-34189514 CACTGGGCAGGGGCCACACTGGG + Intronic
904978290 1:34475596-34475618 TCCTGAGATGGGGCCTTTCTTGG - Intergenic
905637938 1:39567913-39567935 TCCTGGTCTGGGGCCACCCTTGG - Intronic
906668663 1:47639211-47639233 TGCTGGGAGGGGGCCAGCCTAGG - Intergenic
907401517 1:54227551-54227573 CCCTGGGGTGGGGCCAGTCTGGG + Intronic
907409352 1:54273774-54273796 TCCTGGGAGTGGGACACTCTGGG - Intronic
907426171 1:54380597-54380619 TCCTGGGCTGGGACCACGATGGG - Intronic
909535306 1:76728991-76729013 TACTGAGATGGGGAAACACTGGG - Intergenic
910543590 1:88388896-88388918 TCCTGGGGTGGGGCAACAGGTGG + Intergenic
910644626 1:89500176-89500198 TCCAGGGCTGCTGCCACACTGGG + Intergenic
914454022 1:147818703-147818725 TTCTGGGTTGGGGCCAAATTTGG - Intergenic
918500777 1:185193481-185193503 TCCTGAGATGGAGTCTCACTTGG + Intronic
919220674 1:194624909-194624931 CCCTGGGATGGAGCCCCAGTGGG + Intergenic
919841743 1:201614355-201614377 GCCGGGGTTGGGGGCACACTGGG - Intergenic
920431891 1:205924032-205924054 TCCTGGGGTGGGGTCCCATTTGG + Intronic
922883937 1:229003664-229003686 TTTTCTGATGGGGCCACACTGGG + Intergenic
922892608 1:229073232-229073254 TTCTAGGATGGCACCACACTGGG + Intergenic
923493868 1:234507925-234507947 TCCTGACATTGGGCCACAATGGG + Intergenic
923602963 1:235419785-235419807 TCCTTGAAAGGGGGCACACTTGG + Intronic
924629585 1:245724226-245724248 CCCTGGGATGGAGCCACTGTGGG + Intergenic
924708786 1:246518217-246518239 TCCAGGGATGGGGACTCAGTGGG - Intergenic
1062963517 10:1591135-1591157 GCCTGGGCTGGGGCCTCACCGGG + Intronic
1063364244 10:5480206-5480228 TCCTGGGTCAGGGCCACTCTGGG - Intergenic
1069248910 10:66244483-66244505 TCCAGTGATGTGGCCACAGTGGG + Intronic
1070772216 10:79089128-79089150 ACCTGGGCTGGTGCCACACTTGG + Intronic
1072790293 10:98312839-98312861 ACCTGGGCTGGGGCCCAACTTGG - Intergenic
1075007429 10:118840951-118840973 CCCTGGGGTGAGCCCACACTTGG - Intergenic
1076353803 10:129838128-129838150 TCCTGAGGTGGGGGCACACGTGG + Intronic
1076378778 10:130011099-130011121 TGCTGAGATGGGCCCACAGTTGG + Intergenic
1076750443 10:132539482-132539504 TCCAGAGATGGGGGCACCCTGGG - Intronic
1076794128 10:132790574-132790596 AGCTGGGGTGGGGCCACAGTGGG + Intergenic
1076871654 10:133197735-133197757 TCTGGGGCTGGTGCCACACTGGG - Exonic
1077299829 11:1841773-1841795 GCCTGGGAGGAGGCCACACGGGG + Intergenic
1077343831 11:2037459-2037481 TCCTGGGCAGGGGCCACACCTGG - Intergenic
1077810081 11:5628064-5628086 TGCTGGGCTTGAGCCACACTGGG + Intronic
1078008443 11:7550349-7550371 TCCTGGGGTCTAGCCACACTTGG - Intronic
1078552388 11:12289583-12289605 TCTTGAGATGGGGTCTCACTTGG + Intronic
1083411039 11:62492551-62492573 TCCTGGGATGGTGTTAGACTTGG - Intronic
1084055068 11:66626674-66626696 TCCTGGGATGGGGCACCACAGGG + Exonic
1084556548 11:69879401-69879423 GCCTGGGATGTGGCCACAGGTGG - Intergenic
1084717049 11:70880654-70880676 TGCTGGGATGGGGAGACCCTGGG + Intronic
1085460493 11:76690232-76690254 TCCTGGGAAGGGACCACAGTTGG - Intergenic
1085728280 11:78974443-78974465 TCCTGGGTTGGAGCCCCACTTGG - Intronic
1087224255 11:95580280-95580302 TCATGTGATGGGGACACACACGG - Intergenic
1088810863 11:113391174-113391196 TCCTGAGGTGGGACCACACTGGG + Intronic
1090360000 11:126165599-126165621 CCCTGGGATGGGGCCCCAGAGGG + Intergenic
1090979209 11:131702186-131702208 ACCAGGGATCGGCCCACACTTGG + Intronic
1091327088 11:134699615-134699637 TCCAGGAATGGTGCCACACTGGG - Intergenic
1202826817 11_KI270721v1_random:92648-92670 TCCTGGGCAGGGGCCACACCTGG - Intergenic
1093942460 12:25069361-25069383 TCCTGGGCTGGGGCCACTTGTGG - Exonic
1099163695 12:79275543-79275565 TCCTGGGATGGGGGCATGATAGG + Intronic
1104761701 12:131300761-131300783 ACAGGGGATGGGGCCTCACTGGG + Intergenic
1104818072 12:131660024-131660046 ACAGGGGATGGGGCCTCACTGGG - Intergenic
1105729724 13:23200841-23200863 CCCTGAGGTGGGGTCACACTTGG + Intronic
1105806132 13:23952745-23952767 TTCTGGGATGGGTGCAGACTTGG - Intergenic
1107410776 13:40156759-40156781 TCATGGGATGGGGTCCCACAAGG + Intergenic
1107618712 13:42201284-42201306 TCCTTGGGTGTGGCCAAACTGGG - Intronic
1108343189 13:49517660-49517682 TCCAGGCAAGGGGCCCCACTAGG - Intronic
1111565037 13:90002988-90003010 TCCTGGGTGGGGGCCACAACAGG + Intergenic
1113678735 13:112226981-112227003 GCCTGGGTTGGGGCCTTACTTGG + Intergenic
1119263910 14:73253301-73253323 TCCTGGGATGGTGGCGGACTTGG + Intronic
1123069491 14:105635502-105635524 TCCTGGGAGATGGCCAGACTTGG + Intergenic
1124193167 15:27597962-27597984 TCCTGGGATGGGCCCACCAATGG - Intergenic
1124588247 15:31030668-31030690 TCCTGGGGTGGGGAGATACTGGG + Intronic
1125766263 15:42138510-42138532 TCCTTGGATGGTGCAGCACTGGG - Intergenic
1125815166 15:42577696-42577718 CTCTTGGCTGGGGCCACACTGGG - Intronic
1127326817 15:57903789-57903811 TCGTGGGATGGAGCCACATCTGG + Intergenic
1128567366 15:68710275-68710297 TCCTGGGTGGGGGACACAGTGGG + Intronic
1129252066 15:74314591-74314613 CCCTGGGATGGGTCCAGACTAGG - Intronic
1129328130 15:74812771-74812793 TCCTGGGATAGGGCCAGGCAGGG - Exonic
1129412348 15:75356884-75356906 TCCAGCGATGGGCCCACACCTGG + Exonic
1130557073 15:84930243-84930265 AGCTGGGATGGTGCCACACCTGG - Intronic
1132300567 15:100773061-100773083 CCCTGGGCTGGAGGCACACTTGG + Intergenic
1132409068 15:101562857-101562879 TCCTGGAATGAGGCCACCCATGG + Intergenic
1132633146 16:929378-929400 TCAGGGGATGGGGCCAAACTGGG + Intronic
1133627788 16:7588266-7588288 TCCTGGTCTGGGACCACCCTTGG - Intronic
1137511179 16:49102060-49102082 TCAAGGGATGGTGCCACATTGGG + Intergenic
1138196439 16:55055639-55055661 TCCTGGGAAGGGGGCACTGTTGG - Intergenic
1141982965 16:87561167-87561189 TCCTGGGGTGGGTCTACGCTTGG + Intergenic
1142006563 16:87692148-87692170 TCCTTGGAAGTGGCCACCCTGGG + Intronic
1142645656 17:1312496-1312518 TCCTGGGATGGGGCTAGACGTGG + Intergenic
1145992055 17:29085260-29085282 GCCAGGGAGGTGGCCACACTTGG + Intronic
1147362822 17:39942376-39942398 GCCTGGGATAGGGACACCCTGGG + Intronic
1147557293 17:41487523-41487545 TCCTGGGCTGGGGTTACCCTTGG - Intronic
1148440893 17:47711142-47711164 TCATGGCATGGGCCCCCACTGGG + Exonic
1148596833 17:48863277-48863299 CCCTGGGATGGAGCCAACCTGGG + Exonic
1148907243 17:50919336-50919358 TCATGGGATGGGGAGACATTGGG - Intergenic
1149429938 17:56589537-56589559 ACCTGGGATGGGGCTACCCAGGG + Intergenic
1150377054 17:64689989-64690011 GACTGGGATAGGGCCACACAAGG + Intergenic
1151201190 17:72469203-72469225 TCATGGGATGGGTCCATAGTGGG - Intergenic
1151340167 17:73465999-73466021 TCCTGGGAGGGCCCCAGACTGGG + Intronic
1152948216 17:83210013-83210035 TCCAGACCTGGGGCCACACTTGG - Intergenic
1203169453 17_GL000205v2_random:134847-134869 ATCGGGGATGGGGGCACACTGGG + Intergenic
1153124767 18:1777779-1777801 TACTGGGAGAGGGCCAGACTTGG + Intergenic
1153682141 18:7510899-7510921 ACCTGGGGGTGGGCCACACTTGG - Intergenic
1155893345 18:31293285-31293307 TCCTGGGATGCAGCCATACGGGG - Intergenic
1156172761 18:34506232-34506254 TCCTGGGATGGTGTCACAGGTGG - Intronic
1156197961 18:34797213-34797235 TCCTGGGAGGGGGTCACCCAGGG + Intronic
1156490764 18:37494679-37494701 CCCTGAGATGTGGCCACAGTGGG + Intronic
1158278546 18:55795166-55795188 TACTGGAATGGGGGCACACAGGG + Intergenic
1158816902 18:61111270-61111292 ACCTGGGAGGGGTCCACACAGGG + Intergenic
1159564087 18:70028292-70028314 TCGGTGGATGTGGCCACACTAGG + Intronic
1159790904 18:72777893-72777915 TCATGGGGTGGGGCCACCCCAGG - Intronic
1160221791 18:76983475-76983497 TTCTGGGATGTGGCCACAAGAGG - Intronic
1160403479 18:78628666-78628688 GCCTGAGATGGGGTCACACCAGG - Intergenic
1160581255 18:79885711-79885733 ACATGGGATGGGGACACACCGGG + Intronic
1160726227 19:618951-618973 CACTGGGATGGTGGCACACTGGG + Intronic
1161011428 19:1961163-1961185 GCCAGGGCTGGGGTCACACTGGG - Intronic
1161336317 19:3715673-3715695 CTCTGGGATGGGGCCATTCTGGG + Intronic
1161363805 19:3867515-3867537 GCAGGGGATGGGGACACACTGGG - Intronic
1161427215 19:4210208-4210230 ACCTGGGATGGGGCAACCTTAGG + Intronic
1161480293 19:4506979-4507001 CTCTGGGGTGGGGCCACCCTGGG + Intronic
1161494604 19:4580528-4580550 CCGCGGGAGGGGGCCACACTCGG + Intergenic
1161658383 19:5530101-5530123 GCCTGGGGTGTGGCCTCACTGGG - Intergenic
1163307301 19:16488767-16488789 AACTGGGAAGGGACCACACTGGG - Intronic
1163426251 19:17242607-17242629 CCCTGGGAAGAGGCCCCACTAGG + Intronic
1163643037 19:18472660-18472682 CCCTTGGCTGGGGCCACACCAGG - Intronic
1163648025 19:18501393-18501415 GCCTGGGATGGGCCCACTGTTGG + Intronic
1164145375 19:22509679-22509701 CCCTGGGATGGGGGCAGCCTGGG + Intronic
1164260495 19:23564924-23564946 TCCTGGGACCTGTCCACACTGGG - Intronic
1167293127 19:48635423-48635445 TCGTGGGAGGGGGCCAGATTCGG - Intronic
1167492644 19:49801291-49801313 TCCTGGGACGGGTCCATCCTAGG + Intronic
1167932027 19:52873756-52873778 TCCTGGGAAGGGCTCACACCAGG - Intronic
1167987295 19:53329294-53329316 TCCTGGGGCGGGGCGAAACTAGG - Intergenic
1168065073 19:53914646-53914668 TCCTGGGAGGGGGCAGGACTAGG + Intronic
1168152995 19:54458993-54459015 ACCTGTGTTGAGGCCACACTGGG + Intronic
1168648542 19:58077548-58077570 TCCTGGGATGGGGCCACACTTGG - Intronic
925917392 2:8616329-8616351 TCCTGGGATTGGGGCACAGACGG + Intergenic
925999782 2:9321431-9321453 TCCTGGGTGGGGGCCTCCCTGGG - Intronic
926332286 2:11835397-11835419 TCCTGTGAGGGTGCCACACAGGG - Intergenic
928883377 2:36122354-36122376 TCCTGGGATGGAGCCACTGGAGG - Intergenic
930037194 2:47093931-47093953 TCCTCGGATGGGGCAGCAGTGGG - Intronic
931193235 2:60025375-60025397 TCCAGGGAAAGGGCCTCACTGGG - Intergenic
931706660 2:64951850-64951872 TCCAGGGATGGGGCTACACTAGG + Intergenic
932418658 2:71588555-71588577 TCCTGGGAACTGGCCACTCTGGG + Intronic
937543497 2:122988488-122988510 TGCTGTGATGGGGCCAGGCTGGG + Intergenic
938033266 2:128013881-128013903 TTTTGAGATGGGGCCTCACTGGG - Intronic
938164843 2:129017569-129017591 ACCTGGGATTGGGGCCCACTGGG - Intergenic
942226551 2:173821800-173821822 TCCTGGGACGGGGTCATCCTGGG - Intergenic
948879911 2:240851362-240851384 CCCTGTGGTGGGGCCACAGTCGG + Intergenic
949023811 2:241755604-241755626 TCCAGGGTTGGAGCCACACCTGG + Intronic
1168806063 20:672996-673018 CCCTGGGGTGCGGCCAGACTGGG - Intronic
1172965535 20:38831676-38831698 TCTTGGTATGGGGCCACAGTGGG - Intronic
1175374993 20:58518013-58518035 CCTTGTGATGGGGCGACACTTGG + Intergenic
1176402304 21:6324302-6324324 ATCGGGGATGGGGGCACACTGGG - Intergenic
1176434853 21:6664802-6664824 ATCGGGGATGGGGGCACACTGGG + Intergenic
1176459115 21:6991872-6991894 ATCGGGGATGGGGGCACACTGGG + Intergenic
1178369002 21:32011547-32011569 ACCTGACATGGGGCCACAATGGG + Intronic
1178417905 21:32418689-32418711 TACAGGGATGGGGCCAGGCTGGG + Intronic
1179217828 21:39382343-39382365 TTCTGGGATGGGGCCAGGCGTGG - Intronic
1179655076 21:42839764-42839786 CCCTGGGCTGGGGCCACTCCAGG - Intergenic
1180832625 22:18913704-18913726 TGCTGGGAAGAGGCCTCACTGGG - Intronic
1181067239 22:20312689-20312711 TGCTGGGAAGAGGCCTCACTGGG + Intergenic
1181573176 22:23778888-23778910 TCTGGGGGTGGGGGCACACTGGG - Intronic
1182428952 22:30289189-30289211 CCCTGGGAGGGGGCCTCACGGGG + Intronic
1183502391 22:38188774-38188796 CCTTGGGATGGGAACACACTTGG - Intronic
1183743800 22:39682052-39682074 TTCTGGGAAGGGGTCACTCTGGG + Intronic
1184212359 22:43043552-43043574 TCTGGGGATGGGGTCAGACTGGG - Intronic
1185098528 22:48825167-48825189 TGCTGGCATGGAGCCACACAGGG - Intronic
1203282711 22_KI270734v1_random:139009-139031 TGCTGGGAAGAGGCCTCACTGGG - Intergenic
950950761 3:16995991-16996013 CTCTAGGATGGGGCCACATTTGG + Intronic
954914749 3:54139234-54139256 GGGTGGGATGGGGGCACACTGGG - Intronic
955791512 3:62593124-62593146 TCTTGGGATGGGGCTTCATTTGG + Intronic
957147289 3:76440742-76440764 TTCTGGTATGGAGGCACACTTGG - Intronic
959743694 3:109751462-109751484 TACTGGGGTGAGACCACACTAGG + Intergenic
959912065 3:111774540-111774562 TCCTGGGAAAGGGCACCACTGGG + Intronic
960845432 3:122000440-122000462 TCCTGGGAGGGTGGCACACCTGG + Intronic
961101367 3:124201961-124201983 CCCTGTGATGGGGCCAGGCTGGG + Intronic
961331021 3:126138047-126138069 TGCTGGGATGGAGCCTCTCTGGG - Intronic
961899828 3:130199797-130199819 TCCTGGAATGAGGCCACCCATGG + Intergenic
964704296 3:159601881-159601903 TCCTGGGATGGGGAGATACAAGG + Intronic
968911593 4:3479294-3479316 TCTCGGGATGGGGTCACCCTGGG - Intronic
969301992 4:6302519-6302541 TGTCGGGCTGGGGCCACACTGGG - Exonic
969323539 4:6427401-6427423 TCCTGGGAAGGGCCCCCACGTGG - Intronic
969443205 4:7229192-7229214 TGCAGAGATGGGGCCACCCTTGG - Intronic
973028283 4:45302382-45302404 TCCTGGGATGGGGTCAGAGAAGG - Intergenic
975891419 4:79033124-79033146 TGGTGGGATGGGGGCACTCTGGG + Intergenic
976808467 4:89074241-89074263 AGCTGGGATGGGGCCATAGTTGG - Intronic
985494383 5:196512-196534 CCCCGGGTTGGGGACACACTCGG - Intergenic
985494398 5:196549-196571 CCCTGGGGTGGGGACACACTCGG - Intergenic
985494451 5:196676-196698 CCCTGGGGTGGGGACACACTCGG - Intergenic
985494469 5:196718-196740 CCCTGGGGTGGGGACACACCTGG - Intergenic
985494647 5:197849-197871 CCCTGGGGTGGGGACACACTCGG - Exonic
985657903 5:1141534-1141556 TCCTGGGATGGAGGCTCCCTGGG + Intergenic
985712898 5:1439954-1439976 CCCTGGGAAGGGCACACACTAGG - Intronic
986387361 5:7247767-7247789 GCCTGGGGAGGGGCCACAGTGGG + Intergenic
986422661 5:7600060-7600082 TCCTGGGATGCTGACTCACTGGG + Intronic
986915409 5:12613559-12613581 CCCTGGGATGGAGCCACCATGGG - Intergenic
987963083 5:24835840-24835862 CCCTGGGATGAGTGCACACTGGG - Intergenic
990680633 5:58239985-58240007 TCCTGGGAAGAGTCCACAGTGGG - Intergenic
992887212 5:81170488-81170510 TCCTGGGCTGCAGCCATACTGGG + Intronic
994125031 5:96159295-96159317 TGCTGGGATGGTGCCAGAGTGGG + Intergenic
999078282 5:148818177-148818199 TCCTAGGATCAGGCAACACTGGG + Intergenic
999229619 5:150053996-150054018 TCCATGGATGGGGCGACACGGGG - Exonic
1001491893 5:172161897-172161919 GCCTGGGATGCCTCCACACTGGG + Intronic
1002043932 5:176531834-176531856 CCCGGGGAAAGGGCCACACTGGG - Intronic
1002161964 5:177319536-177319558 TCCTGAGATTGGGCCAAGCTTGG - Intergenic
1002232942 5:177782248-177782270 CCCTGGGATGGGGCCTCAGAGGG - Exonic
1002742383 5:181443168-181443190 TCCAGACCTGGGGCCACACTTGG - Intergenic
1003298666 6:4856685-4856707 TTCTGGGCTGGGGCCATCCTGGG - Intronic
1003340458 6:5214992-5215014 TCCTGGGAGGGGAACTCACTGGG + Intronic
1003625816 6:7740299-7740321 GTCTGGGATGGGACCACACTTGG - Intronic
1004681394 6:17898850-17898872 TCCAGAGATGGGGTCTCACTTGG + Intronic
1005836079 6:29710609-29710631 TGCTGGGGTGGGGCCAAACGAGG + Intergenic
1005842566 6:29753149-29753171 GTCTTTGATGGGGCCACACTCGG - Intergenic
1006440982 6:34053477-34053499 GCCTGGCCTGGGGCCACACAGGG + Intronic
1006448642 6:34093269-34093291 CCCAGGGATAGGGACACACTAGG - Intronic
1006510829 6:34520232-34520254 GCCTGGCTTGGGGCCACACAGGG - Intronic
1006897474 6:37480186-37480208 TCCTGAGATGGGGCCACCTGGGG + Exonic
1007067997 6:39012511-39012533 TCTTGGGATTCGTCCACACTGGG + Exonic
1009060067 6:58387753-58387775 CCCTGGGATGGAGCCCCAGTGGG + Intergenic
1009230848 6:61059639-61059661 CCCTGGGATGGAGCCCCAGTGGG - Intergenic
1011051487 6:83155490-83155512 TCTTGGGATGGGAGCACGCTTGG + Intronic
1011726870 6:90218595-90218617 TCCTGGGAGGGCTCCAGACTTGG - Intronic
1013168001 6:107611018-107611040 TTCTGGGTTTGGGCCCCACTGGG - Intronic
1016726023 6:147368320-147368342 TCCTGGGATTAGGTCTCACTTGG - Intronic
1017002298 6:150005009-150005031 TCGGGGGCTGGGGCCAAACTTGG - Intergenic
1017989513 6:159473794-159473816 TCCTGGGATGGGACCCAACAAGG + Intergenic
1018715571 6:166530242-166530264 CTCTGGGAGGGGGGCACACTTGG - Intronic
1018864479 6:167736099-167736121 TCCTGGAATAGGGCAACACCTGG + Intergenic
1019247519 6:170718907-170718929 TCCAGACCTGGGGCCACACTTGG - Intergenic
1019336592 7:485779-485801 AGCTGGGCTGGGGCCAGACTTGG - Intergenic
1020264459 7:6551161-6551183 TCCTGGGCCGGGGCCACCGTCGG + Exonic
1021994827 7:26169451-26169473 TCATGGGATGTGGGCACACTGGG + Intronic
1022155915 7:27662265-27662287 CCTTGGGTTGGGGACACACTTGG - Intronic
1024112452 7:46161123-46161145 CCCTGGGCTGGGGCCAAATTTGG + Intergenic
1024526468 7:50353931-50353953 TCCTGGCTTGGGGCCTCCCTGGG - Intronic
1024669841 7:51584480-51584502 CCCTGGGCTGGGGCCGCAGTGGG + Intergenic
1027189329 7:75988561-75988583 TCCCGGGGTGGGGGCACACATGG - Intronic
1029706221 7:102277789-102277811 GCCTGTGGTGGGGCCACAGTGGG + Intronic
1030909481 7:115229017-115229039 TCCTGAGATGGGGACACACTGGG + Intergenic
1033564064 7:142561603-142561625 TCCTGGTAAGGACCCACACTGGG + Intergenic
1033564447 7:142564915-142564937 TCCTGGTAAGGACCCACACTGGG + Intergenic
1034436924 7:151066870-151066892 TCCTGGGGTGCGGCGGCACTTGG + Exonic
1034885884 7:154798581-154798603 TCCTGGGATGGAGCGTCCCTGGG + Intronic
1035056386 7:156039367-156039389 TCCTGCGATGGGGCCGCCCGTGG + Intergenic
1035500618 8:89029-89051 TCCAGACCTGGGGCCACACTTGG + Intergenic
1036248783 8:7143733-7143755 TCCTGGAATGAGGCCACCCATGG - Intergenic
1038499373 8:28030687-28030709 TCCTGGAATGGGCCCTCTCTGGG + Intronic
1045542776 8:103102349-103102371 GGCTGGGAGGAGGCCACACTGGG + Intergenic
1049763132 8:144339727-144339749 TCCTGGGTTGGAGCCTCAATAGG - Intergenic
1053876459 9:42551365-42551387 TACTGGTATGGGGACACACGCGG - Intergenic
1053896212 9:42743319-42743341 TACTGGTATGGGGACACACGCGG + Intergenic
1054235239 9:62550356-62550378 TACTGGTATGGGGACACACGCGG + Intergenic
1054826376 9:69577906-69577928 GCCTGGGTTGCTGCCACACTGGG - Intronic
1056595787 9:88006848-88006870 TCCAGGGACTGGGCCACCCTGGG - Intergenic
1057686190 9:97237324-97237346 TCCAGGGATGGGGGCAGAATGGG - Intergenic
1057950287 9:99364417-99364439 CCCTAGGATGGGGCCATTCTAGG - Intergenic
1061020512 9:128011329-128011351 TTCGGGGGTGGGGCCAGACTCGG - Intergenic
1061372642 9:130206423-130206445 TCCTGAGATGGAGTCTCACTCGG + Intronic
1062121760 9:134837608-134837630 TCCTGGGATAGGGTCAAGCTGGG + Intronic
1203436683 Un_GL000195v1:143845-143867 ATCGGGGATGGGGGCACACTGGG - Intergenic
1203608292 Un_KI270748v1:74387-74409 TCCAGACCTGGGGCCACACTTGG - Intergenic
1186523806 X:10229156-10229178 GCATGGGAGGGGGCCTCACTGGG + Intronic
1188852007 X:35143608-35143630 TCAAGGGATGGTGCCATACTGGG + Intergenic
1188982423 X:36738982-36739004 TCCTGGGATGGGTGCTCCCTTGG + Intergenic
1190277672 X:48909785-48909807 ACCAGGGATGGGGCTGCACTGGG - Intronic
1191105182 X:56768116-56768138 CCCTTGGCTGGGGCCACAGTGGG - Intergenic
1191106175 X:56773518-56773540 CCCTTGGCTGGGGCCACAGTGGG - Intergenic
1191107168 X:56778920-56778942 CCCTTGGCTGGGGCCACAGTGGG - Intergenic
1191107866 X:56783359-56783381 CCCTTGGCTGGGGCCACAGTGGG - Intergenic
1195046376 X:101058142-101058164 TCCTGGGTCGGGACCACAGTAGG + Intergenic
1195996018 X:110732369-110732391 TCCTGGCCTGGGACCTCACTGGG - Intronic
1197884875 X:131208164-131208186 TCCTGGGATAGGGCCAGATTTGG + Intergenic
1200922218 Y:8623346-8623368 TCCTGAGATAGGGCAACCCTGGG - Intergenic