ID: 1168648968

View in Genome Browser
Species Human (GRCh38)
Location 19:58080683-58080705
Sequence AGGGGCAGCTGGGCTGGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 429}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168648968_1168648974 -7 Left 1168648968 19:58080683-58080705 CCTGAACCAGCCCAGCTGCCCCT 0: 1
1: 0
2: 4
3: 45
4: 429
Right 1168648974 19:58080699-58080721 TGCCCCTGAGGTTAACAAGTGGG 0: 1
1: 0
2: 0
3: 3
4: 80
1168648968_1168648973 -8 Left 1168648968 19:58080683-58080705 CCTGAACCAGCCCAGCTGCCCCT 0: 1
1: 0
2: 4
3: 45
4: 429
Right 1168648973 19:58080698-58080720 CTGCCCCTGAGGTTAACAAGTGG 0: 1
1: 0
2: 1
3: 3
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168648968 Original CRISPR AGGGGCAGCTGGGCTGGTTC AGG (reversed) Intronic
900147921 1:1166480-1166502 AGGGACGGCTGGGCAGGGTCAGG + Intergenic
900389363 1:2427364-2427386 AGGGGCGGCTGAGCTGGGGCGGG - Intronic
901187470 1:7384314-7384336 CGGGGCAGCTGGCCTGGTGCAGG + Intronic
901647105 1:10722763-10722785 GGAGGCAGCTGGGCTGGGGCAGG - Intronic
902311486 1:15584826-15584848 CGGGGCTGGGGGGCTGGTTCCGG + Exonic
902602882 1:17551989-17552011 AGGAGGAGCTGGGCTGCTGCTGG + Intronic
902684374 1:18066473-18066495 AGGGACAGCTGAGCTGGTCCAGG + Intergenic
902746948 1:18480865-18480887 AGGGAGTTCTGGGCTGGTTCTGG - Intergenic
902792822 1:18780724-18780746 AGAGGCAGCTGAGCTGGGGCTGG + Intergenic
903142072 1:21345003-21345025 CAGGGCAGCCGGGCTGGGTCGGG - Intronic
903421045 1:23217759-23217781 GAGGGCAGGTGGGCTGGCTCTGG + Intergenic
904043634 1:27598163-27598185 AGTGGCAGCTGGGCTGAATTGGG + Intronic
904207626 1:28865018-28865040 GGGGACAGCTGGGCTGGAGCAGG - Intergenic
904497816 1:30897067-30897089 ATGGGCAGCTGGGGTGGTCAAGG + Intronic
904702845 1:32368364-32368386 GGGGACAGCTGGGCTGGCTGGGG + Intronic
904808390 1:33147449-33147471 AGCCGCGGCTGGGCTGGATCTGG + Exonic
904912499 1:33945777-33945799 GGGGGCAGCAGGGCAGGTGCTGG - Intronic
905211057 1:36374440-36374462 AGGAGCAGCCGGTCTGGTTCAGG - Intronic
905342636 1:37289773-37289795 GAGGGCAGCTGGGCTGGATTTGG + Intergenic
905670894 1:39789223-39789245 AGGAGCAGCTGAGCAGGTGCCGG - Intergenic
905862588 1:41361336-41361358 CGGGGCACCTGGGCTGGCTGAGG + Intergenic
908021318 1:59901456-59901478 CTGAGCAGCTGGGCTGGTTTTGG - Intronic
908467993 1:64415381-64415403 CGGGGCAGCTGGCCGGGTTGGGG - Intergenic
912557049 1:110524072-110524094 AGGGGCAGTTGGGATGGCTGAGG - Intergenic
914754897 1:150557087-150557109 AGAGGCTGCAGGGCTGGCTCGGG + Intronic
915113201 1:153577879-153577901 AGTGGCTGCTTGGCTGGATCTGG - Intergenic
915234269 1:154468981-154469003 AGGGGCAGGCGGGCCAGTTCAGG + Exonic
915311318 1:155007245-155007267 AGGGGCAGCAGGGCAGGGTGTGG - Intronic
918070163 1:181128700-181128722 AGGGGGAGCTGGCCTCGTACTGG + Intergenic
919795974 1:201321868-201321890 AGAGGCACCTGGGCTGCATCGGG - Intronic
919959416 1:202451823-202451845 CGGGGCAGCTGGCCTGGTGGGGG + Intronic
920563875 1:206958598-206958620 TGGGGCAGCTGGTCTGCTTGGGG + Exonic
921399258 1:214702443-214702465 AAGGACATCTGGGCTGTTTCCGG + Intergenic
922468528 1:225861484-225861506 AGGGGCTGCTGGGCTCCTTACGG - Intronic
922712887 1:227846248-227846270 GGAGGCAGCTGGGCTGGGGCAGG - Exonic
1063474290 10:6315080-6315102 GTGGGCAGGTGGGCTGGGTCTGG - Intergenic
1064418932 10:15173520-15173542 AGGAGCTGCTGGGCTAGTGCTGG - Intergenic
1065242191 10:23717577-23717599 AGTAGCAGGTGGGGTGGTTCAGG + Intronic
1067048744 10:43000199-43000221 AGGGGCAGTGGGGGTGGTTTGGG + Intergenic
1067348783 10:45457021-45457043 AGAGGCAGGTGGGCTGGCTCTGG - Exonic
1068982880 10:63079839-63079861 AGAGCCAGCTTGGCTGATTCTGG + Intergenic
1069667103 10:70170261-70170283 TGGGGCCGCGGGGCTGATTCTGG - Intronic
1069840686 10:71337530-71337552 AGAGGCAGCTGGGCTCCTACCGG - Intronic
1070325113 10:75383808-75383830 ACTGGCAGCTGCCCTGGTTCAGG - Intergenic
1070917959 10:80166993-80167015 AGAGGCAGCAGGGGTGGGTCGGG + Intronic
1071341562 10:84653560-84653582 AGGGGCAGCAGTGATGGTGCTGG + Intergenic
1071488011 10:86115740-86115762 AGGAGCAGCTGGGATGGGGCTGG - Intronic
1071530461 10:86387434-86387456 AGAGGCAGGTGGGCTGATGCAGG - Intergenic
1071995491 10:91144046-91144068 AGGGGTAGCTTAGCTGCTTCAGG - Intergenic
1072294440 10:93995388-93995410 AGGGGGAGGTTGGCTGTTTCAGG - Intronic
1073243582 10:102074071-102074093 TGGGGCAGCTGAGCTAGATCTGG + Intergenic
1073566228 10:104537867-104537889 TGGGTCAGCTGGGCTAGTGCAGG - Intergenic
1074102409 10:110364214-110364236 AGAGGCATCTGGGGTGCTTCCGG + Intergenic
1074401181 10:113142278-113142300 AGGGGATGCTGGGCTGGGTGTGG - Intronic
1076373206 10:129967842-129967864 ACGGGGACCTGGGCTGGTACCGG + Intergenic
1077026673 11:442714-442736 GGCGGCAGCTGGGCAGGCTCTGG + Intergenic
1078086234 11:8234437-8234459 AGGGGCAGCTGGGCTGGGACAGG - Intronic
1078393060 11:10953114-10953136 AGGGGAAGCTGGGCAGGGCCAGG + Intergenic
1080835283 11:35935037-35935059 AGGGGCAGCTGGGGTGATATGGG + Intergenic
1081867582 11:46367922-46367944 AAGGGCAGCTGTGCTGGGGCAGG + Intronic
1083156872 11:60828738-60828760 AGGGTCACATGGGCTGCTTCTGG + Intergenic
1083273304 11:61582895-61582917 AGAGGCAGCTGGGGTGGGTGGGG - Intergenic
1083384900 11:62300444-62300466 GGTGGCAGCAGGGCTGATTCAGG - Intergenic
1083671698 11:64303660-64303682 AGGGGCAGGCAGGCTGGTTGGGG + Intronic
1083865584 11:65451459-65451481 CGGGGCAGCTGGCCAGGTTGGGG - Intergenic
1083883847 11:65561206-65561228 AGGGGCTGCTGCTCTGCTTCAGG - Intergenic
1084971102 11:72772489-72772511 AGGGGCTGCTGGGAAGGTTGTGG - Intronic
1089634549 11:119803901-119803923 AGGGGTAGGTGGGCTGGCCCTGG + Intergenic
1089782521 11:120883529-120883551 AGGGGCAGATGAGCTGGCTTTGG + Intronic
1090236762 11:125154080-125154102 AGGAACAGCTGGGCAGGCTCTGG - Intergenic
1091242940 11:134066565-134066587 AGGGCCAGGTGCGGTGGTTCAGG - Intergenic
1091697292 12:2636451-2636473 AGGAGCTGCTGGACGGGTTCAGG - Intronic
1091830765 12:3549841-3549863 AGGGTCACCTGGGGTGGTCCAGG + Intronic
1092168055 12:6355115-6355137 AGGGGCAGAGGGGCTGGCACTGG - Intronic
1092203709 12:6603148-6603170 GGTGACAGCTGGGCTGATTCGGG - Intronic
1094513976 12:31117557-31117579 AGGGGAAGACGGGCTGGCTCCGG - Intergenic
1095592906 12:43924859-43924881 GGGAGCAGGTTGGCTGGTTCTGG + Intronic
1096167283 12:49436375-49436397 TGGGGCAGCTGGCCGGGTTGGGG + Intronic
1096996558 12:55841849-55841871 AGGGCAAGCTGGGCTGGGACGGG - Intronic
1097058741 12:56267021-56267043 GGCAGCGGCTGGGCTGGTTCGGG - Exonic
1097392387 12:59031519-59031541 AGAGGCAGCTGGGCTGGGGATGG - Intergenic
1100364495 12:93907262-93907284 GGGGGCAGCTGGGCTGGGACCGG - Intergenic
1100774858 12:97962783-97962805 AAGGCCACCTGGGCTGCTTCTGG - Intergenic
1101371805 12:104137810-104137832 AGGGGCCGCGGGGCTGCGTCGGG - Intronic
1102527128 12:113520087-113520109 AGGGGCAGGGGGGCTGCTTGGGG + Intergenic
1102566926 12:113803071-113803093 AGGGGCTGATGGGCTTGCTCAGG - Intergenic
1104149755 12:126071121-126071143 AGGGCCAGCCTGGCTGCTTCAGG + Intergenic
1104689881 12:130817955-130817977 GGGGGCAGCTGGGCTGAAGCAGG + Intronic
1104892881 12:132148769-132148791 AGGGGCAGCTGGGCGGGGGCCGG - Exonic
1105278078 13:18947792-18947814 AGGTGCAGCTGTGCCTGTTCAGG - Intergenic
1105801133 13:23903892-23903914 CGGGGCCGCAGGGCAGGTTCTGG - Intergenic
1105847742 13:24308040-24308062 CGGGGCCGCAGGGCAGGTTCTGG + Intronic
1106286073 13:28319000-28319022 TGGGGCAGCTGAGCTTGTTATGG + Intronic
1107586138 13:41850357-41850379 AGGGCCTGCTGGGCTGGGCCTGG - Intronic
1107958955 13:45542500-45542522 AGGGGCAGCTGTGCCTGTGCAGG - Intronic
1108200460 13:48038076-48038098 AGGGGGCGCTGTGCTGGGTCAGG + Intronic
1109322115 13:60823574-60823596 ATGGGCAGGTGGGTGGGTTCAGG + Intergenic
1109596659 13:64564962-64564984 ATGGGCATTTAGGCTGGTTCAGG + Intergenic
1113927676 13:113950652-113950674 AGAGGCACCTGGGCTGGTCTGGG - Intergenic
1114453021 14:22838646-22838668 AGGGAAAGCTGGGGTGGTGCAGG + Intronic
1116118247 14:40685397-40685419 AATTGCAGCTGAGCTGGTTCAGG - Intergenic
1118764728 14:68902173-68902195 TGAGGCAGCCGGGGTGGTTCTGG - Intronic
1119715409 14:76855592-76855614 AGGGGCATCAGGGCTGGATGTGG - Intronic
1119850952 14:77866505-77866527 GGGGGCAGCTCAGCTGGTTAGGG + Intronic
1119857402 14:77910771-77910793 GGGGGCAGCTAGGCTGGAGCTGG + Intronic
1120758361 14:88265033-88265055 GGAGGCTGCTGGGCTGGTCCAGG - Intronic
1122111204 14:99504049-99504071 AAGGGCAGCTGGGCTGGGCCGGG - Exonic
1122546244 14:102524333-102524355 AAGGGGAGCTGGGCAGGTTCTGG + Intergenic
1122784739 14:104158463-104158485 AGGGGCAGCAGGGCTTGAGCGGG + Intronic
1122987271 14:105218296-105218318 GGGGGCAGCAGGGGTGGTGCAGG - Intronic
1124818702 15:33021214-33021236 AGGTTCAGCTGAGCTGGTTTGGG - Intronic
1125715908 15:41819802-41819824 TGAAGCAGCTGGGCTGGTCCTGG + Intronic
1125747493 15:42006880-42006902 TGGAGCTGCTGGGTTGGTTCTGG - Intronic
1126852255 15:52804575-52804597 AGGGTCAGCTGGGCAGCATCCGG + Intergenic
1127384497 15:58456515-58456537 AGGGGCCTCTGGGCTGCATCAGG - Intronic
1128180553 15:65600015-65600037 AGGGGCACCAGGGCTGGCTATGG + Intronic
1129777793 15:78248190-78248212 CGTGGCTGCTGGGCTGGCTCTGG - Intergenic
1130013908 15:80173171-80173193 AGAGGCAGCAGGGCTGGGTTTGG - Intronic
1130429420 15:83831722-83831744 AGGGGAAGCTGGGCTGCAACTGG - Intronic
1130657308 15:85800706-85800728 AGGAGCAGGAGGGCTGGGTCTGG + Intergenic
1130674720 15:85941537-85941559 AGGGCCAGCCAGGCTGCTTCTGG + Intergenic
1130830026 15:87589946-87589968 AGGTGAAGTTGGGGTGGTTCAGG - Intergenic
1130905084 15:88234584-88234606 AGGGGCAACTGAGCTGGAACTGG - Intronic
1132025968 15:98404577-98404599 TGGGGAAGCTGGGTAGGTTCCGG + Intergenic
1132500541 16:282895-282917 AGGGGCAGCAGGGGAGGGTCTGG - Exonic
1132516589 16:368824-368846 AGGGGCGGCTGTGCTCGCTCAGG + Intronic
1132546978 16:537711-537733 AGGGGCCGTTTGGGTGGTTCCGG + Intronic
1132606951 16:797545-797567 AGGGGCAGCTGGCCTGGGCCAGG + Intronic
1132644139 16:990992-991014 CGGAGCAGCCGGGCTGGTGCTGG + Intergenic
1132659499 16:1055075-1055097 AAGGTCAGCTGGGCTGGTTCTGG + Intergenic
1132703295 16:1231025-1231047 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703308 16:1231058-1231080 ATGGGCAGCTGGGCTGGGGCTGG - Intergenic
1132703332 16:1231124-1231146 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703345 16:1231157-1231179 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703379 16:1231257-1231279 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703392 16:1231290-1231312 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703419 16:1231357-1231379 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703432 16:1231390-1231412 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703445 16:1231423-1231445 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132703472 16:1231490-1231512 ATGGGGAGCTGGGCTGGGGCTGG - Intergenic
1132708031 16:1254877-1254899 AAGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132708058 16:1254944-1254966 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132708071 16:1254977-1254999 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132708082 16:1255009-1255031 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132708092 16:1255041-1255063 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132708105 16:1255074-1255096 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132708163 16:1255239-1255261 ATGGGGAGCTGGGCTGGGGCTGG + Intergenic
1132752554 16:1465482-1465504 GGGGGCAGCAGGGCTGGGACGGG + Intronic
1132906520 16:2285346-2285368 AGGGGCTGCCCAGCTGGTTCCGG + Intronic
1132953498 16:2578334-2578356 AGGGGCTGCAGGGCCGGTGCGGG + Intronic
1132960854 16:2621833-2621855 AGGGGCTGCAGGGCCGGTGCGGG - Intergenic
1133119840 16:3599240-3599262 ATGGGCAGCTGAGCTGGCTCGGG - Intronic
1133773885 16:8883441-8883463 AGGGGCAGCTGGCCAGCTGCGGG - Intergenic
1134096586 16:11422863-11422885 ATGGGCAGCTGGGCTGGCGGTGG - Intronic
1134133150 16:11663373-11663395 AGCGGGGCCTGGGCTGGTTCTGG - Intergenic
1134620635 16:15686446-15686468 CAGGGCAGCTGGGCTGGTACTGG + Intronic
1134863222 16:17579520-17579542 AGGGGGAGCCAGGCTGGGTCAGG + Intergenic
1136402890 16:30028180-30028202 TGGGACAGCTGGGCTGGTGCAGG + Intronic
1136455100 16:30375946-30375968 AGGGCCAGCAGGGCTGCTTTTGG - Intronic
1137634384 16:49973344-49973366 ATGGGCAGGTAGGCTGGTGCTGG - Intergenic
1137791298 16:51176927-51176949 AAGGGCACCAGGGCTGGTACTGG - Intergenic
1138278252 16:55751710-55751732 ACGGGCAGCAGGGCTGGTGTTGG + Intergenic
1138290427 16:55842235-55842257 ACGGGCAGCAGGGCTGGTGTTGG - Intergenic
1138299942 16:55917605-55917627 AGGGGCAACTGGCTTGCTTCAGG + Intronic
1138342265 16:56297811-56297833 GTGTGCAGCTGGGCTGGGTCAGG + Intronic
1138348257 16:56332941-56332963 AGTGGCATCTGGGCAGGCTCTGG - Intronic
1138553862 16:57761105-57761127 AGCGGGAGCTGTGCTCGTTCAGG + Exonic
1138560181 16:57796551-57796573 TGGGGCAGCTGAGCTGGCTGAGG + Intronic
1139576642 16:67846551-67846573 AGGGGCAGCTGGGCCAGCTTGGG + Intronic
1139972980 16:70787639-70787661 AGAGGCAGCTGGGGTGGTCAGGG + Intronic
1140469221 16:75205307-75205329 AGGGGCCGCGGGGCTGCCTCTGG - Intronic
1140472563 16:75223632-75223654 AGGGGCCGCGGGGCTGCCTCTGG + Intronic
1141580446 16:84994556-84994578 AGGCGGAGCTGAGCTGGCTCAGG - Intronic
1141620341 16:85233982-85234004 AGGGGCTGGGGGGCTGGTTCTGG - Intergenic
1142024622 16:87805881-87805903 AGGTGCAGCTCACCTGGTTCTGG + Intergenic
1142247437 16:88976454-88976476 TGGGGCAGGTGGGCTGGTGAGGG - Intronic
1142607380 17:1089632-1089654 AGTGACCACTGGGCTGGTTCTGG + Intronic
1142849190 17:2696129-2696151 AGGGGCTGCGGGGCTGGGTGGGG - Intronic
1143020833 17:3916533-3916555 AGGGGCAGTGGGGCTGGGCCTGG - Intergenic
1143188398 17:5024038-5024060 GGGGGCCGCTGGGCTGGGTAGGG - Exonic
1143627347 17:8118097-8118119 AGGGGCTGCGGGGCTGGGTAGGG + Exonic
1143762694 17:9116448-9116470 AGGGGCAGCTGCGATGGTGGAGG + Intronic
1144667598 17:17112514-17112536 AGGGGCAGCTGGGGAGGGGCTGG - Intronic
1144872633 17:18380512-18380534 AGGGGCAGTTGGGCTGGCTGGGG - Intronic
1145839241 17:27980237-27980259 AGGGGGAGAGGGGCTGGTTGAGG + Intergenic
1145909220 17:28533038-28533060 GGGGGCAGCTGGCCTGGGGCAGG - Intronic
1145973771 17:28972456-28972478 AGGGGCAGCTGGGCAGGGAGAGG + Intronic
1146919828 17:36703148-36703170 AGGGGCTTCTGGTCTGGTGCTGG + Intergenic
1146942004 17:36849896-36849918 AGGGGCAGCTGGTGTGGCCCAGG - Intergenic
1147761322 17:42799198-42799220 CGGGGCGGCTGGGCCGCTTCAGG + Exonic
1148127409 17:45243999-45244021 ATGAGCAGCTGGGCTGTGTCCGG - Exonic
1148155805 17:45424878-45424900 GGGGGCAGGTGGGCTTGTCCTGG + Intronic
1148544071 17:48503627-48503649 AGGGGCAGCAGGGCTGGATGGGG - Intergenic
1149664782 17:58357958-58357980 AGGGGCTGCTGAGTTGGATCTGG + Exonic
1150601459 17:66654483-66654505 AGAGGCAGCTGGGCAGGCTGCGG - Intronic
1151277857 17:73049411-73049433 AGGAGCAGCAGGGCAGGTTTAGG + Intronic
1151558786 17:74860142-74860164 AGGGGCAGGTAGGCAGGTCCGGG - Intronic
1151748623 17:76024510-76024532 AGGGGTAGTTGGGCTGGCTGGGG + Intronic
1152272789 17:79334872-79334894 AGGGTGGGCTGGGCTGGTTGGGG - Intronic
1152494418 17:80660954-80660976 AAGGGCAGCTGGGCTGGGGGTGG - Intronic
1152531281 17:80920676-80920698 AGGCGCTGCTGGGCTGGGGCCGG - Intronic
1152594068 17:81229657-81229679 AGCAGCTGCTGGGCTGGTGCTGG + Intronic
1154000130 18:10475759-10475781 CGAGGCAGCTAGGCTGGCTCAGG - Intronic
1154294619 18:13137507-13137529 AGGGGCAGCGGGGCTGCGGCGGG - Intergenic
1157188479 18:45560540-45560562 AGAGGCAGCTGGGCAGGTAGGGG - Intronic
1157275035 18:46304330-46304352 AGGGGCATCTGGCCAGGCTCTGG + Intergenic
1157599530 18:48885606-48885628 AGAGGCAGCCGGGCTTGGTCAGG + Intergenic
1157807028 18:50665722-50665744 AGAGCCAGCTGGGCTGATTTGGG - Intronic
1158156628 18:54432980-54433002 AGGAGCAGCAGTGCTGGTACTGG - Intergenic
1158165259 18:54532714-54532736 AAGGGTCGCTGGGCTGGTGCAGG - Intergenic
1158609342 18:58924408-58924430 AGTGGCAGCAAGGTTGGTTCAGG - Intronic
1158906483 18:62018167-62018189 AGGGAAAGCAGGGCTGGCTCCGG + Intergenic
1159797952 18:72867209-72867231 AGGGGCGGGAGGGCTGGCTCCGG + Intronic
1160538518 18:79607909-79607931 TGGGGCAGCTGTGCTGGGTAAGG + Intergenic
1160555053 18:79719337-79719359 GCGGGCAGCTGGGCCGGTGCGGG + Intronic
1160768793 19:821386-821408 CGGGGCAGCTGCGCCGGCTCCGG + Intronic
1160800058 19:963594-963616 AGAGGCGGCTGGGCTGACTCAGG - Intronic
1161068018 19:2247974-2247996 GGGGGTAGCTGGGGTGGTCCCGG - Exonic
1161089627 19:2353379-2353401 CGGGGCAGCTGGGCTGGGCGCGG - Exonic
1161591591 19:5131538-5131560 AGGGGCAGGTGGGGTGGAGCGGG + Exonic
1161655127 19:5509676-5509698 AGAGGGATCTGGGCTGGTTCCGG + Intergenic
1161663886 19:5563333-5563355 GGGGGCAACTGGGCTGGGCCAGG + Intergenic
1161685855 19:5702268-5702290 TGGGGCAGCTGGCCTGGTGGGGG - Intronic
1161816164 19:6501461-6501483 AGGGGCAGCTGGGAGGGAACAGG - Intronic
1162094356 19:8301956-8301978 AGGGGCAGCAGGGCTGGGGTGGG - Intronic
1162422563 19:10574299-10574321 AGGGTCAGGTGTGATGGTTCAGG - Intronic
1162559170 19:11406139-11406161 AGGGGCAGCTGGGGAGGGGCTGG - Intronic
1162585490 19:11555675-11555697 AGGGACAGGTGGGAGGGTTCTGG + Intronic
1162793100 19:13073118-13073140 AAGGGCAGCTGGGCAGGTGGGGG - Intronic
1162794339 19:13078789-13078811 AGGGGCAGCTGGCCAGGTGAAGG + Intronic
1162967644 19:14163629-14163651 AGGGGCAGCTGGGCAGGGCGTGG - Intronic
1163035042 19:14565145-14565167 GGGGACAGCTGGGCTGGGTGAGG + Intronic
1163408963 19:17141493-17141515 AGAGGCAGCAGAGCTGGTCCTGG - Intronic
1163572314 19:18089836-18089858 AGGGGCAGCTGAGCTGGCCAGGG + Intronic
1163613625 19:18313341-18313363 GGGCACAGCTGGGCTGGTCCTGG + Intronic
1163682750 19:18692703-18692725 AGGGGCTGCAGGGCTGGGTGAGG + Intronic
1163796787 19:19342461-19342483 AGGGGTGGCTGGGCTGGGCCTGG + Intronic
1163815740 19:19463490-19463512 AGGGGCAGCTGAGCAGGAGCGGG + Intronic
1164376342 19:27691429-27691451 AGAGACAGCTGGGCTGCCTCAGG - Intergenic
1164671705 19:30076225-30076247 TGGGGCTGCTGGGCTGTTTGGGG + Intergenic
1165072848 19:33265494-33265516 AGGGGCAGCAGGGCAGGGCCTGG + Intergenic
1165428371 19:35757784-35757806 AGGGGCAGTGGGGCGGGTTGGGG - Intronic
1166046522 19:40233707-40233729 AGGGGCCGCTGGGGTGCGTCTGG + Exonic
1166096277 19:40541423-40541445 AGGGGCAGCTGGGCTCCGTCTGG - Intronic
1167395398 19:49225089-49225111 AAGGGCAGCTGGGCTGGGTGCGG + Intergenic
1167457531 19:49605227-49605249 AGGGCCAGCAGGGCTGGGTGTGG - Intronic
1167926749 19:52827435-52827457 CGGGGCAGCTGGGATTGTTCAGG - Intronic
1168103282 19:54152457-54152479 AGGGGCGGCTGGGCTGAGGCCGG - Exonic
1168177434 19:54635255-54635277 ATCGGCAGCTGGGCTGGACCTGG - Exonic
1168591044 19:57634315-57634337 AGGTGAGGCTGAGCTGGTTCAGG + Intronic
1168648968 19:58080683-58080705 AGGGGCAGCTGGGCTGGTTCAGG - Intronic
925100309 2:1238706-1238728 AAGGGCAGCAAGGCTGGTCCAGG - Intronic
925591310 2:5512684-5512706 AGGGGAATCTGGGCTGGTTATGG - Intergenic
925669688 2:6297633-6297655 AGGGGCTGCTGGGCTGGGTCAGG + Intergenic
927079274 2:19611650-19611672 TGGGGCAGCCGGGCAGGTTCTGG - Intergenic
927704695 2:25289872-25289894 AGGGGCAGGAGGTCTGGGTCTGG - Intronic
927719711 2:25374817-25374839 AGGCCCAGATGGGCTGCTTCAGG - Intergenic
927830120 2:26342771-26342793 CGGGGCAGCTGGGCTGCCTTAGG + Intronic
928455316 2:31415681-31415703 AGGGGCAGTTGGGAGGGTGCTGG - Intergenic
929818748 2:45257107-45257129 CAGGGCAGCTGGGCTGGGCCAGG + Intergenic
930713039 2:54567179-54567201 AGGGGAATCTGTGCAGGTTCAGG + Intronic
931859277 2:66336882-66336904 TGGGTCAGCTGAGTTGGTTCTGG - Intergenic
932288780 2:70557729-70557751 AGCAGTAACTGGGCTGGTTCAGG + Intergenic
932703122 2:74004127-74004149 TGGGGCAGGTGGGCAGGGTCAGG + Intronic
933486150 2:82926490-82926512 TTGGGCAGCTGGGCTGGGACAGG + Intergenic
934154404 2:89182444-89182466 AGCTGCAGCTGGTCTTGTTCTGG + Intergenic
934519275 2:95009701-95009723 AGAGGCAACTGAGCTGGTTTGGG + Intergenic
934649903 2:96084814-96084836 AGGGGCTGCTGGGCTGGAGGAGG + Intergenic
934813637 2:97305545-97305567 GGTGGCACCTGGGCTGGGTCTGG + Intergenic
934824058 2:97402935-97402957 GGTGGCACCTGGGCTGGGTCTGG - Intergenic
935351034 2:102151976-102151998 AGGGGCCGATGGGATGGGTCAGG + Intronic
936077748 2:109412411-109412433 TGGGACAGCTTGGCTGTTTCTGG + Intronic
936097377 2:109541445-109541467 AGGGGGAGCTGGGCCGGGGCAGG - Intergenic
936572122 2:113626150-113626172 AGGGGCTCCTGGGAGGGTTCGGG - Intergenic
937155953 2:119719172-119719194 AGGGGCAGGAGGGCAGCTTCTGG - Intergenic
937906347 2:127054707-127054729 AGGGGCTGCTGGGAGGGGTCAGG - Intronic
937973310 2:127566181-127566203 AGGGGCAGTGGGGCTGGGTGGGG + Intronic
942046657 2:172102826-172102848 AGGGGTGGCTGGGCCGGGTCGGG + Exonic
944661679 2:201926575-201926597 AGGGGCAGCTGGGAATTTTCAGG + Intergenic
945183480 2:207115672-207115694 AGGGGTAGATGGGATGGTGCTGG + Intronic
946400923 2:219468142-219468164 AGGGGCATCTGCTCTGGGTCTGG + Intronic
946506315 2:220304660-220304682 AATGGCAGCTAGGCAGGTTCAGG + Intergenic
946745472 2:222841123-222841145 AGGGAAGGCTGGGCTGGGTCGGG + Intergenic
947814486 2:233027007-233027029 ATGGGCATTTGGGCTGTTTCTGG - Intergenic
948094842 2:235325332-235325354 AGGGGCAGCTGGGCAGGAACAGG - Intergenic
948195377 2:236091854-236091876 AAGGGCATCTGGGTTGTTTCTGG - Intronic
948276781 2:236715075-236715097 AGGGGCTGCTGGGCTCCCTCTGG + Intergenic
948429662 2:237911566-237911588 CGGAGAAGCTGGGCTGCTTCTGG + Exonic
948465495 2:238149902-238149924 TGGGGCAGGTGGGCAGGTCCAGG - Intronic
1168806385 20:674758-674780 AGGAGCAGCAGGGTTGGTTCTGG + Intronic
1169066644 20:2697745-2697767 AGGGGAAGATGGGCTGGGGCTGG - Intronic
1169142813 20:3235774-3235796 AGGGGGAGCAGGGCTGGCTCAGG - Intronic
1170617838 20:17968577-17968599 CGGGGCAGCTGGGATGGTGGCGG - Intronic
1170920660 20:20676475-20676497 AGGGGCAGCTCTGCTGGATGTGG - Intronic
1171089175 20:22267906-22267928 AGCGGCAGCGGGGCAGGTCCTGG - Intergenic
1171148980 20:22810322-22810344 AGGGGCAGGAGGGCGGGTTGTGG + Intergenic
1171424439 20:25040813-25040835 TGGGGCATCTGGGCAGCTTCTGG - Intronic
1172764300 20:37342975-37342997 AGGGTGAGCTGGGCTGGGGCTGG + Intergenic
1173166297 20:40689225-40689247 CGGTGCAGCTGTGCTGGATCCGG + Exonic
1174379328 20:50146633-50146655 GAGGGCAGCTGTCCTGGTTCTGG - Intronic
1174531889 20:51220798-51220820 TGGGGCAGCGGGGCTGGTGGTGG - Intergenic
1174773935 20:53326114-53326136 AGAGGCAGCAGGGGTGGTGCAGG - Intronic
1174868799 20:54164404-54164426 CGGGGGTGCTGGGCTGGTTCTGG + Intronic
1175445687 20:59018048-59018070 AGGTGCAGGTGGGCAGGTACAGG - Intergenic
1175854845 20:62115113-62115135 CGGGGCAGAGGGGCTGGTCCTGG - Intergenic
1176039572 20:63058087-63058109 AGGGGCTGCTGAGCTGCTGCAGG - Intergenic
1176056575 20:63152131-63152153 AAGGCCAGCTGGGTTGGCTCAGG + Intergenic
1176150836 20:63589995-63590017 AGAGGCCGCAGGGCTGGCTCGGG - Exonic
1176256134 20:64154196-64154218 TGGGGCAGCTGGGATGGCACAGG - Intronic
1178828471 21:36035125-36035147 AGGGGCTGCTGGTCCTGTTCAGG - Exonic
1179438928 21:41379928-41379950 GGGGACAGCAGGGCAGGTTCTGG + Intronic
1179481202 21:41679642-41679664 AGGGGTAGCTGGAGTGTTTCAGG + Intergenic
1179647004 21:42782176-42782198 AGGAGCAGCTGCACTGGGTCAGG + Intergenic
1179796833 21:43789794-43789816 GGGGCCGGCTGGGCTGGTGCGGG + Intronic
1180613785 22:17114446-17114468 AGGGGGAGGTGGGCTGGGCCAGG - Exonic
1181309478 22:21936810-21936832 GGGAGCAGCTTAGCTGGTTCTGG - Intronic
1181568029 22:23751422-23751444 CGGGGCATCTGCGCTGGTGCTGG + Intergenic
1181733487 22:24864409-24864431 ATGGGCATCTGGGTTGCTTCCGG - Intronic
1182259635 22:29064156-29064178 AGGGGCAGTAGGGCTGGGTGTGG - Intergenic
1182452535 22:30429819-30429841 AGGGGCTGCAGGGCTGGGTAGGG + Intergenic
1183259423 22:36784922-36784944 AGGGGCATTTGAGCTGGGTCTGG - Intergenic
1184193158 22:42908548-42908570 TGGGGCAGCTTGGCTACTTCTGG - Intronic
1184210979 22:43035439-43035461 AGGGGCTGCAGGGCTGCTGCGGG + Intergenic
1184283594 22:43453316-43453338 AGGGGCAGGGGGGGTGGTGCGGG - Intronic
1184418062 22:44363601-44363623 AGGGCCAGCCCGGCTGGATCAGG + Intergenic
1184788226 22:46682179-46682201 AGGGGCAGCTGGGGTGGGGCTGG + Intergenic
1184803675 22:46777687-46777709 AGGGGAAGCTGGGCAGGGCCAGG + Intronic
1184821874 22:46915542-46915564 AGCTGCAGCTGGCCTGGTTCTGG + Intronic
1184821902 22:46915711-46915733 AGTGGGAGCTGGGCTCTTTCTGG + Intronic
1185085241 22:48737402-48737424 AGGGACAGCAGGGCAGGCTCAGG - Intronic
1185131956 22:49044332-49044354 AGGGGCAGCAAGGCTGCTGCTGG + Intergenic
1185165812 22:49261529-49261551 AGGGGGAGCAGGGCAGGTGCGGG + Intergenic
951729199 3:25791854-25791876 AGGTGCAGCTGTGCTGGTGCTGG + Exonic
953203398 3:40798312-40798334 AGAGGCAGCTGTGTTGGTCCTGG + Intergenic
953492921 3:43365171-43365193 AAGGGCAGATGGGCGGCTTCTGG + Intronic
953885069 3:46710395-46710417 GGGGGCTGCAGGGCTGGGTCAGG + Exonic
954000986 3:47556891-47556913 AGGGGCAGCTTCACTGGTCCAGG - Intergenic
954300729 3:49699530-49699552 AGAGGTTGCTGGGCTGCTTCCGG + Exonic
954305934 3:49725395-49725417 AGGGACAGCTTGCCTGTTTCTGG - Exonic
954325533 3:49861387-49861409 GTTGGCAGCTGGGCTGGTGCTGG - Intronic
954384911 3:50238893-50238915 CGGGGCAGCAGGCGTGGTTCTGG - Intronic
954391015 3:50267932-50267954 GGGGTCAGCTGGGCAGGTGCTGG - Intronic
954481292 3:50803815-50803837 AGGGGCAGCTGGCCGGGTTGGGG + Intronic
954634562 3:52064548-52064570 AGGAGGGGCTGGGCTGGGTCAGG + Intergenic
955239202 3:57164862-57164884 AGGGGCGGCGGGGCTGGGCCGGG - Intronic
959045047 3:101464737-101464759 TGGGGCAGGTGGGATGGTTTTGG - Intronic
960967790 3:123116966-123116988 AGGAGCAGCTGGGATGGGGCGGG + Intronic
961021979 3:123515519-123515541 AGGGGCTGCAGTGCTGGTGCTGG + Intronic
961536869 3:127575904-127575926 TGGGGCAGCTGGGGTGGCTGGGG - Intronic
961642601 3:128374025-128374047 GGAGGCAGCGGGGCTGGTCCAGG - Intronic
961789086 3:129363433-129363455 CGGGGCAGCTGGCCTGGTGGGGG + Intergenic
962475086 3:135748301-135748323 AGGGGCTGCTGGGCTGAATCTGG - Intergenic
963173298 3:142272767-142272789 ATGGCCAGCTGGGCTATTTCCGG - Intergenic
963706785 3:148698073-148698095 AGGGCCGGCTGCGCTGGTGCGGG - Exonic
963747153 3:149135848-149135870 AGGGGTAGATGGGCTGGGGCTGG - Intronic
967763479 3:193251449-193251471 ATTGGAAGCTGGGCTGATTCTGG + Intronic
968064721 3:195752320-195752342 AGGGGGCGCTTGGCGGGTTCAGG - Intronic
968066231 3:195761320-195761342 AGAGGCAGGTGGGCTGGTGGTGG + Intronic
968704622 4:2072174-2072196 AGGGGCAGCCAGGCTGTTGCTGG + Exonic
968731519 4:2271451-2271473 AGGAGCAGGTGGGCTGGGCCGGG + Intronic
969459689 4:7322375-7322397 AAGTGCAGCTGGGCTGGGCCAGG - Intronic
969464655 4:7349186-7349208 AGGGGCAGCATGGCTGGTGCTGG + Intronic
969471647 4:7392650-7392672 CAGGGCTGCTGGGCTGGTCCTGG + Intronic
969703679 4:8780999-8781021 AGGGGCTGCTGGGCTGGGTTTGG + Intergenic
975758443 4:77594592-77594614 ACAGGCAGCTGGGCAGGTCCAGG + Intronic
977145918 4:93439831-93439853 AGGGGCAGTTGGGAAGGATCAGG + Intronic
981441470 4:144787878-144787900 AGGGGAAGCTGGTATGGATCTGG - Intergenic
982946730 4:161633633-161633655 AGGGGAAGCTAGGCTGGGTGCGG - Intronic
983665767 4:170180628-170180650 AGGGGCAGGTGGGGTGGCACAGG - Intergenic
983908022 4:173205413-173205435 AGGGTCTGCTGGGCTGGGCCTGG + Intronic
984644909 4:182209256-182209278 AGGGACAGCTGGGCTGGATGCGG - Intronic
984765094 4:183394259-183394281 AGGGGCAGCTGTGCTGGGACTGG + Intergenic
985597562 5:802681-802703 AGGAGAAGCTGGGCTGGGTGCGG + Intronic
985606342 5:860132-860154 AGGAACAGCTGGGCTGGGGCGGG + Intronic
985689132 5:1297433-1297455 AGGGGCAGCTGGGAGGCTGCAGG - Intergenic
986182001 5:5401769-5401791 AGGGGTAGCAGGGCAGGGTCAGG - Intergenic
986712433 5:10497837-10497859 AAGGGCAGCTGGGCCCCTTCTGG + Intergenic
987062831 5:14258731-14258753 AGAGGCAACTGGGCTGGTACTGG - Intronic
988706285 5:33728685-33728707 AGGGGTAGCTGGCCTTCTTCAGG - Intronic
990557705 5:56952052-56952074 AGGAGCAGCCGGGCTGGAGCGGG - Intronic
992450766 5:76873692-76873714 AGGGGCAGATGGGATGGTTGAGG + Intronic
993147464 5:84113464-84113486 AGGAGCAGCTGGGCTAGCTGGGG + Intronic
995046587 5:107656008-107656030 ACGGGCAGCTGGGCTGTCCCTGG - Intronic
995587184 5:113660162-113660184 GTGGGCAGCTGGGCTGGGGCAGG + Intergenic
995625898 5:114076259-114076281 AGGGGCAGGTGTGCTGCTGCTGG + Intergenic
996567687 5:124897407-124897429 AGGGGCATATGGCCTGGTTCGGG - Intergenic
997280184 5:132637882-132637904 TGGGGCATCTGGGTTGCTTCTGG + Intronic
997439484 5:133899147-133899169 AGGGGCAGCTGAGATGTTCCTGG + Intergenic
997476010 5:134142956-134142978 AGGGGCAGGTGGGGTGCATCAGG - Intronic
997518788 5:134508930-134508952 AGGAGCAGCCTGGCTGGGTCAGG - Intergenic
998133101 5:139660912-139660934 AGGGGCAGCTTGCCTGGGCCTGG + Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998337117 5:141383127-141383149 AGCTGCCGCTGCGCTGGTTCAGG - Exonic
998352578 5:141511210-141511232 AGGAGAAGCTGGGCTGGTTGGGG - Exonic
999178810 5:149654288-149654310 AGGGGCAGGAGTGCTGGTGCAGG + Intergenic
999181990 5:149676271-149676293 AAGGGCACCTGGGCTGGGCCTGG + Intergenic
999956968 5:156713097-156713119 AGGGGTAGCCGGGCAGGTACAGG + Intronic
1000048444 5:157541154-157541176 TGGGGCAGCTGGGCTGGGCCGGG - Intronic
1000052705 5:157575935-157575957 CGGGGGAGCGGGGCTGGCTCAGG + Intergenic
1001155856 5:169271996-169272018 AGGGGAAACTGGGCAGGTGCAGG + Intronic
1001276232 5:170353723-170353745 AGAGGCAGCTGTGCTGTTCCCGG + Intronic
1001284648 5:170413757-170413779 AGGGGAGGCTGGGCTGGTGGAGG - Intronic
1001517294 5:172364930-172364952 AGGGGCTTCTGTGCTGCTTCTGG - Intronic
1001546512 5:172573871-172573893 AGAAGCATCTGAGCTGGTTCTGG - Intergenic
1002494459 5:179602321-179602343 AGAGGGAGCAGGGCTGGTTTGGG + Intronic
1002764005 6:224378-224400 AGGGTCTGCTGGGCAGGGTCAGG - Intergenic
1003859276 6:10307460-10307482 AGTGGCAGCTGGGTGCGTTCTGG - Intergenic
1004300729 6:14454856-14454878 AGGGGATGCTGGGTTGATTCTGG - Intergenic
1006133296 6:31881336-31881358 AGGGGCAGTTGGCCTGGGTGGGG + Intronic
1006543458 6:34759299-34759321 AGAGGCAGCTGGGCTGGATATGG + Intronic
1006614050 6:35312679-35312701 AGAGGCAGCTGGGCTGCAGCTGG - Exonic
1007661979 6:43492377-43492399 AGGGGCAGCAGGGCTGGTCTGGG + Intronic
1008387767 6:50913370-50913392 ATGGGCAGCTGGCCTGGGTGGGG + Intergenic
1011597433 6:89029587-89029609 AGGGGCAGGAGGGCTGGAGCAGG - Intergenic
1011929368 6:92691142-92691164 AGTGGCAGCAAGGCTGGTGCAGG - Intergenic
1012152390 6:95770514-95770536 TGGGGCATAAGGGCTGGTTCTGG - Intergenic
1013900946 6:115155828-115155850 ATGGGGCTCTGGGCTGGTTCTGG + Intergenic
1015148931 6:130018536-130018558 AGGGGAAACTGCGCTGGTGCCGG - Exonic
1018151129 6:160940472-160940494 AGGGGCAGCAGGTCTGTTACTGG + Intergenic
1018647373 6:165961004-165961026 AAGGGGACCTGGGCTGGGTCAGG + Intronic
1019409045 7:898667-898689 AGGGGCAGGTTGGCTGGGTGTGG + Exonic
1019559179 7:1647530-1647552 AGGGGCGGAGGGGCTGGTGCGGG + Intergenic
1021590370 7:22254728-22254750 AGGGGGAGATGGGATGGTTTTGG + Intronic
1022539503 7:31122702-31122724 AGGGGCAGCTTGGCTGGGGGAGG - Intergenic
1022647481 7:32244862-32244884 GTGGGCAGCTGGGCAGGCTCTGG - Intronic
1024127677 7:46317265-46317287 GGGGGCAGCTGGTCTGGAGCAGG - Intergenic
1025572957 7:62599758-62599780 TGGGGCGGCTGGGCTGGTGGGGG + Intergenic
1025803562 7:64809417-64809439 CGGGGCAGCTGGGCCGGGTTGGG + Intronic
1026988718 7:74571002-74571024 AGCGGAAGCTGGCCTGGGTCCGG - Intronic
1027265400 7:76492409-76492431 AGGGGCACCTGGGCTCACTCTGG - Intronic
1027270348 7:76515349-76515371 AGAGGCAGGGGGGCTGGTGCTGG - Exonic
1027316771 7:76990526-76990548 AGGGGCACCTGGGCTCACTCTGG - Intergenic
1029489475 7:100862533-100862555 AGGGGCAGAGGGGCTGGTGTCGG - Intronic
1034589553 7:152128222-152128244 AGGCGCCCCTGGGCAGGTTCTGG - Intergenic
1034879641 7:154753399-154753421 AGGGGCACCTGCACTGGGTCTGG + Intronic
1035049365 7:155989794-155989816 ATGGCCAGGTGGGCTGGTCCAGG + Intergenic
1035391849 7:158509368-158509390 AGGGCCAGCGGGGCTGTCTCAGG + Intronic
1035635449 8:1140446-1140468 AAGGGCACCAGGGCTGGTTCTGG - Intergenic
1036567302 8:9948378-9948400 AGGGGAAGCTGGGATGATTAGGG + Intergenic
1037835890 8:22214516-22214538 AGGGGCAGCTGCACTGGGTGGGG - Intergenic
1037945853 8:22988899-22988921 AGTGGCAGCTTGGCTGATTTGGG + Intronic
1039548656 8:38428132-38428154 AGGAGCAGCTGGTCAGGCTCAGG + Intronic
1039906590 8:41790964-41790986 TGGGGGAGCTGGGCTGGGCCAGG - Intronic
1039907955 8:41799827-41799849 AAAGGGAGCTGGGCTGGTTTCGG + Intronic
1040542695 8:48374133-48374155 AGTGGTGGCTGGGCTGGCTCTGG + Intergenic
1040934318 8:52767024-52767046 AGGGGAAGCAGGCCTGGTTGTGG - Intergenic
1041145876 8:54875322-54875344 AGGGCCTGCTGGGCTGGATTAGG + Intergenic
1045499591 8:102734888-102734910 AGGGGCAGGGGGGCTGGTCTAGG + Intergenic
1047308765 8:123675112-123675134 GGGAGCATCTGGGCTGGTTCTGG - Intergenic
1049322893 8:142006445-142006467 GGTGGCAGCTGGGCTGGGCCGGG + Intergenic
1049353218 8:142175224-142175246 AGGGGGAGCTGGGGTGGCTACGG + Intergenic
1049392010 8:142376550-142376572 AGTGCCAGCAGGGGTGGTTCTGG - Intronic
1049551808 8:143263503-143263525 AGGGAGAGCTGGGAGGGTTCTGG - Intronic
1053180253 9:35962303-35962325 AGTGGCAGCTGGGAGGTTTCTGG + Intergenic
1053489126 9:38486841-38486863 GGGGGCAGCTGGGCTGGTCCAGG + Intergenic
1053489278 9:38487469-38487491 AGGGGCAGCGGGGCTCGGGCAGG - Intergenic
1057486207 9:95486568-95486590 AGGGTCACCTGGGGTGCTTCCGG - Intronic
1057587863 9:96345790-96345812 AGGGGCAGCTGGGCAGAGGCTGG + Intronic
1057669476 9:97076155-97076177 GGGGGCAGCTGGTCTGGTCCAGG + Intergenic
1057669623 9:97076783-97076805 AGGGGCAGCGGGGCTCGGGCAGG - Intergenic
1057757905 9:97852344-97852366 AGGGGCTGCTTGGCTGCCTCTGG + Intergenic
1061178216 9:129009764-129009786 AGAAGCAGCTGGGCAGGTGCGGG - Exonic
1061920618 9:133780402-133780424 GGGGGCAGGAGGGCTGGTGCAGG + Intronic
1062010289 9:134263479-134263501 GAGGGCAGCTGGGGTGGTACAGG - Intergenic
1062231934 9:135486705-135486727 TGGAGCAGCTGGGCGGGCTCCGG + Exonic
1062340834 9:136093427-136093449 AGTGGGAGCTGGGCTGCTACAGG - Intronic
1062421553 9:136484816-136484838 GGGGGCAGCGGGGCTGGGGCTGG - Exonic
1062479632 9:136745332-136745354 AGGGGCCGCTGAGCTGATGCTGG + Intronic
1062488724 9:136793808-136793830 CGTGGCAGCTGAGCTGGGTCGGG - Intronic
1186531410 X:10299491-10299513 AGAGGCTGCTTAGCTGGTTCTGG + Intergenic
1189278163 X:39802511-39802533 CGGGGCAGCTGGGCTGAGTTCGG + Intergenic
1189292999 X:39899223-39899245 AGTGGCAGGTGAGCTGGGTCTGG - Intergenic
1190233684 X:48600653-48600675 AAGGGCTGGTGGGCTGGGTCAGG + Intronic
1190303047 X:49067481-49067503 AGGGGCAGCTGAGCTAGGCCGGG - Exonic
1192544812 X:72004654-72004676 GGGGGCTGCGGGGGTGGTTCTGG - Intergenic
1200183471 X:154166342-154166364 AGGGCCAGGAGGGCTGATTCTGG - Intergenic
1200189125 X:154203470-154203492 AGGGCCAGGAGGGCTGATTCTGG - Intergenic
1200194880 X:154241279-154241301 AGGGCCAGGAGGGCTGATTCTGG - Intergenic
1200200530 X:154278400-154278422 AGGGCCAGGAGGGCTGATTCTGG - Intronic