ID: 1168649650

View in Genome Browser
Species Human (GRCh38)
Location 19:58085242-58085264
Sequence GTCGGGCACCACTGAGGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 144}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168649650_1168649659 -7 Left 1168649650 19:58085242-58085264 CCTCCTCCTCAGTGGTGCCCGAC 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1168649659 19:58085258-58085280 GCCCGACGGGGGATCGGCAAGGG 0: 1
1: 0
2: 0
3: 0
4: 30
1168649650_1168649662 3 Left 1168649650 19:58085242-58085264 CCTCCTCCTCAGTGGTGCCCGAC 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1168649662 19:58085268-58085290 GGATCGGCAAGGGCGTCCCCAGG 0: 1
1: 0
2: 1
3: 4
4: 68
1168649650_1168649666 18 Left 1168649650 19:58085242-58085264 CCTCCTCCTCAGTGGTGCCCGAC 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1168649666 19:58085283-58085305 TCCCCAGGGGGCGCCTCCGTAGG 0: 1
1: 0
2: 1
3: 12
4: 92
1168649650_1168649664 5 Left 1168649650 19:58085242-58085264 CCTCCTCCTCAGTGGTGCCCGAC 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1168649664 19:58085270-58085292 ATCGGCAAGGGCGTCCCCAGGGG 0: 1
1: 0
2: 0
3: 1
4: 54
1168649650_1168649658 -8 Left 1168649650 19:58085242-58085264 CCTCCTCCTCAGTGGTGCCCGAC 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1168649658 19:58085257-58085279 TGCCCGACGGGGGATCGGCAAGG 0: 1
1: 0
2: 1
3: 0
4: 31
1168649650_1168649670 27 Left 1168649650 19:58085242-58085264 CCTCCTCCTCAGTGGTGCCCGAC 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1168649670 19:58085292-58085314 GGCGCCTCCGTAGGCAGCTCAGG 0: 1
1: 0
2: 1
3: 6
4: 107
1168649650_1168649665 6 Left 1168649650 19:58085242-58085264 CCTCCTCCTCAGTGGTGCCCGAC 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1168649665 19:58085271-58085293 TCGGCAAGGGCGTCCCCAGGGGG 0: 1
1: 0
2: 0
3: 9
4: 73
1168649650_1168649663 4 Left 1168649650 19:58085242-58085264 CCTCCTCCTCAGTGGTGCCCGAC 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1168649663 19:58085269-58085291 GATCGGCAAGGGCGTCCCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168649650 Original CRISPR GTCGGGCACCACTGAGGAGG AGG (reversed) Exonic
900320208 1:2079835-2079857 GTGGGGCACCACAGAGCTGGTGG + Intronic
902661930 1:17910331-17910353 GTAAGGCAACACTGAGAAGGGGG - Intergenic
903372407 1:22845097-22845119 CTCGCTCACCACTCAGGAGGTGG - Intronic
903450564 1:23451226-23451248 GTCTGGCACCACTGAGCAGATGG + Intronic
907701447 1:56792109-56792131 GCCGGGCTCCTCTCAGGAGGTGG + Exonic
910763686 1:90759652-90759674 CTGGGGCTCCACTGAGAAGGAGG + Intergenic
912543587 1:110434965-110434987 GGCTGGCACCACTGGGGAGAGGG + Intergenic
915038591 1:152948843-152948865 GTCTGGCACTGCTGAGGGGGTGG - Intergenic
919916156 1:202140704-202140726 GTTAGGAACCACTGAGGAAGAGG + Intronic
920573603 1:207038011-207038033 GTGGAGTACCAGTGAGGAGGAGG - Intronic
920963491 1:210683821-210683843 GTCTGGCACCCCGGAGGTGGAGG + Exonic
921131576 1:212224412-212224434 GAGGGGCTTCACTGAGGAGGTGG + Intergenic
922799837 1:228360152-228360174 GGAGGGCACCATGGAGGAGGCGG + Intronic
922997187 1:229973424-229973446 GTGAGGGAGCACTGAGGAGGTGG - Intergenic
1067840765 10:49677251-49677273 GTCCGGCACCACCAAGGATGGGG + Intergenic
1068880142 10:62039668-62039690 ATCAGGCATCACTGAGAAGGCGG - Intronic
1071489189 10:86124358-86124380 TTGGAGCATCACTGAGGAGGAGG - Intronic
1071981427 10:91007960-91007982 GTCAATGACCACTGAGGAGGAGG + Intergenic
1072283779 10:93894105-93894127 CCCGGGCGCCACTGAGGAGCCGG + Exonic
1074618529 10:115093626-115093648 GACGGGCGCCGGTGAGGAGGAGG + Exonic
1076869606 10:133186920-133186942 GCCGGGCAGGGCTGAGGAGGCGG - Intronic
1077715822 11:4579503-4579525 GTCCAGCACCACTCAGGAAGAGG + Intergenic
1084673899 11:70623309-70623331 GTCGGCAACCTCGGAGGAGGTGG - Intronic
1085687747 11:78639186-78639208 ATCAGGCACCACGGAGCAGGGGG - Intergenic
1086426420 11:86688350-86688372 TTCGGGGCCCTCTGAGGAGGAGG - Intergenic
1092122740 12:6056210-6056232 GTCGGGCAACAGTGATGATGTGG - Intronic
1093291047 12:17322469-17322491 GTTGGCCTCCAGTGAGGAGGTGG + Intergenic
1100618407 12:96249374-96249396 GACGCGCGCCACTGCGGAGGGGG + Intronic
1102176111 12:110876189-110876211 CTCAGGCCCCACTGAGTAGGTGG - Intronic
1102956382 12:117061705-117061727 GTCAGGCACCAGTGGTGAGGGGG - Intronic
1113788476 13:113015243-113015265 GTCTGGCACACCTGTGGAGGTGG + Intronic
1119182365 14:72613753-72613775 GTCAGGAAACTCTGAGGAGGAGG - Intergenic
1122435040 14:101689411-101689433 GGCGGGCACCCCGGAGCAGGAGG - Intergenic
1122998961 14:105281612-105281634 CTCGTGCACCACAGTGGAGGGGG + Intronic
1129277139 15:74453432-74453454 GACAGGCACCACTGAGAGGGAGG + Intronic
1132285394 15:100658706-100658728 GTCTGTCAGCACTCAGGAGGGGG + Intergenic
1132915567 16:2341592-2341614 GTCGGGGTCACCTGAGGAGGTGG + Intergenic
1133008861 16:2899115-2899137 GCCGGGCGCCACAGAGCAGGGGG - Exonic
1133021672 16:2969609-2969631 CTGCGGCCCCACTGAGGAGGAGG + Exonic
1133024171 16:2980493-2980515 GACGGGCTGCACTGGGGAGGGGG - Exonic
1133626276 16:7573360-7573382 GTTGGAGACCACTGAGAAGGGGG + Intronic
1135470032 16:22721974-22721996 ATCGGGCACCAGGGAGGAGGAGG + Intergenic
1136077361 16:27826344-27826366 GTGGGGCAGCAATGAGGAGCTGG - Intronic
1137836597 16:51598155-51598177 GTTGGGGACCACTGAGGTAGAGG - Intergenic
1137958297 16:52854969-52854991 TTAGGGCACCATTGAGGAAGGGG + Intergenic
1138522512 16:57578851-57578873 GTGTGGCAGCACCGAGGAGGAGG - Intronic
1139552903 16:67685595-67685617 GTGGGGGAAGACTGAGGAGGAGG - Exonic
1139793635 16:69463281-69463303 GTCCGGCACCACTTGGGAAGGGG - Exonic
1141892136 16:86933417-86933439 GTCACCCAGCACTGAGGAGGGGG + Intergenic
1144817682 17:18047552-18047574 GTCAGGCTCCTTTGAGGAGGGGG + Intronic
1149867105 17:60157133-60157155 CCAGGGCACCACAGAGGAGGTGG + Intronic
1150076655 17:62198029-62198051 ATCACGCACCACTGAGGATGAGG - Intergenic
1152822115 17:82442698-82442720 GGCAGCCACTACTGAGGAGGAGG + Exonic
1154980677 18:21500092-21500114 GTGGGGCAGCAGGGAGGAGGAGG - Exonic
1156242985 18:35271682-35271704 ACCGGGCACCACGGAGCAGGGGG + Intronic
1156651989 18:39235666-39235688 ACCGGGCACCACGGAGCAGGGGG - Intergenic
1157453865 18:47809142-47809164 CTCGGGCATCTCTGGGGAGGTGG + Exonic
1162461606 19:10817108-10817130 GGCAGCCACCCCTGAGGAGGAGG + Intronic
1163084251 19:14968155-14968177 GACGGGCACTTCTAAGGAGGAGG - Intronic
1163116555 19:15192222-15192244 ATCGGGCCCCACTGAGCAGCGGG + Exonic
1165121672 19:33562992-33563014 GAAAGGCACCAGTGAGGAGGCGG + Intergenic
1165166835 19:33863092-33863114 GTCTGGCACCACGGTGGAGAAGG - Intergenic
1165496116 19:36152582-36152604 TTCGTCCACCACGGAGGAGGCGG + Exonic
1165741520 19:38207715-38207737 GTCAGGAACCTCAGAGGAGGGGG + Exonic
1166010202 19:39935818-39935840 TTCCAGCACCACTGAGGAGCAGG - Intergenic
1166106383 19:40600121-40600143 GCCGGGGACTACTGAGAAGGAGG + Exonic
1168314796 19:55480073-55480095 GTCGGGCAGGAGTGAGGATGTGG + Intronic
1168408201 19:56121413-56121435 GCCGGGCACCACAGAGCTGGGGG - Intergenic
1168464197 19:56589106-56589128 AGAGGGCATCACTGAGGAGGGGG + Intergenic
1168649650 19:58085242-58085264 GTCGGGCACCACTGAGGAGGAGG - Exonic
926147662 2:10406485-10406507 CTCGGGAACCACTGAGGTGTGGG + Intronic
928825179 2:35412262-35412284 GTCGGGGAACAGAGAGGAGGAGG - Intergenic
929934229 2:46282626-46282648 GAGGGGCTGCACTGAGGAGGGGG + Intergenic
934978797 2:98823486-98823508 GACGTGCACCCCAGAGGAGGAGG - Exonic
935319221 2:101869711-101869733 GTCGGGGACGACGGATGAGGAGG + Exonic
936095623 2:109528557-109528579 CTCTGGCAACTCTGAGGAGGTGG + Intergenic
938344761 2:130559149-130559171 TTCAGGCACCACTTTGGAGGTGG - Intergenic
938345072 2:130561571-130561593 TTCAGGCACCACTTTGGAGGTGG + Intergenic
943298196 2:186164332-186164354 CTCGGACACCACTGTGGTGGTGG - Intergenic
946152713 2:217787295-217787317 ACCGGGCACCACGGAGCAGGGGG + Intergenic
947534392 2:230931782-230931804 GTGGGGCACCACTCAGGGTGTGG - Intronic
947753415 2:232544474-232544496 GTCGATCACAACTGGGGAGGAGG + Exonic
948657327 2:239484713-239484735 GCCGGGCACCACTGCCGATGAGG + Intergenic
948924510 2:241086354-241086376 GTGGGGCAGTACTGAAGAGGAGG - Intronic
949064849 2:241983785-241983807 CTGGGGCATCAGTGAGGAGGAGG + Intergenic
1171109961 20:22471777-22471799 GTGTGGCATCTCTGAGGAGGCGG - Intergenic
1171459676 20:25291535-25291557 GCCAGGCACCACTAAAGAGGGGG - Intronic
1172022453 20:31924197-31924219 GGCAGGCACCAGTGAGGGGGCGG - Intronic
1181529909 22:23511542-23511564 TTCAGGCACCACAGATGAGGTGG - Intergenic
1182005274 22:26954583-26954605 GGAGGGCATCACTCAGGAGGAGG + Intergenic
1183143014 22:35961903-35961925 GTTGGGGACCAGAGAGGAGGAGG - Intronic
1183468378 22:37991896-37991918 AACAGGCACCACGGAGGAGGTGG - Intronic
1183722807 22:39572228-39572250 GCTGGGGACCACTGAGGAGGAGG + Intronic
1184231593 22:43161157-43161179 GTCGGGCACCAAAGAAGATGGGG - Exonic
1185243084 22:49756790-49756812 GGCAGGCAACTCTGAGGAGGGGG - Intergenic
1185312000 22:50161391-50161413 TTCTGGCACCACTGGGTAGGAGG - Exonic
950004023 3:9679894-9679916 GTTGAGCAACACTGAAGAGGTGG - Intronic
952764976 3:36945617-36945639 GTCGATCATCACTGGGGAGGTGG - Intergenic
953251462 3:41248720-41248742 GTCAGGCACCCCATAGGAGGCGG + Intronic
954000680 3:47554445-47554467 GCCGGCCACCACTGAGGGAGGGG - Intergenic
954035318 3:47848123-47848145 GTGGGGAAGCACTGAGGAAGTGG + Intronic
954230537 3:49213567-49213589 ACCGGGCACCACGGAGCAGGGGG + Intronic
954705740 3:52479618-52479640 GTAGGGCTCTGCTGAGGAGGAGG - Intronic
961025329 3:123550665-123550687 GTCGGGGAACAATGATGAGGTGG + Intronic
961654040 3:128431975-128431997 GGAGGGCCTCACTGAGGAGGCGG + Intergenic
963643887 3:147889815-147889837 GTCAGGCAGCACTGGGGAAGGGG - Intergenic
964400214 3:156290744-156290766 ATCCAGCACCACTCAGGAGGGGG - Intronic
968496428 4:919832-919854 GTCAGGCACCACTTAGGTGCTGG - Intronic
971372305 4:26028901-26028923 GCCGGGCGCCACCCAGGAGGGGG + Intergenic
975746868 4:77483501-77483523 GTCTGTCACCACTCAGGATGTGG - Intergenic
978285633 4:107073526-107073548 GACGGGCACCATGGAGCAGGGGG - Intronic
982205537 4:152995009-152995031 CTCGGGCAGCATTGAGGAGGGGG + Intergenic
985748774 5:1662473-1662495 GCCGGGCACCACTCAGCACGTGG + Intergenic
991253761 5:64592729-64592751 TTTGGGCATCACAGAGGAGGAGG - Intronic
997342395 5:133154784-133154806 GTCATGCACCACTTAGGATGGGG + Intergenic
1000020158 5:157311447-157311469 GGCTGGCACCAAAGAGGAGGAGG + Intronic
1000320277 5:160129179-160129201 CACAGGCACCACTGTGGAGGGGG + Intergenic
1001709409 5:173766044-173766066 TTCCGGGACTACTGAGGAGGGGG + Intergenic
1002930392 6:1630439-1630461 GCTGGGCCCCACTCAGGAGGTGG - Intronic
1003860489 6:10318225-10318247 ATAGGGCACCAGTGAGGGGGTGG - Intergenic
1011254258 6:85404800-85404822 ATCGGGCATCACTGTGGGGGCGG + Intergenic
1012791703 6:103706925-103706947 GTCAGGCATCACTGTGGAGGTGG + Intergenic
1013308452 6:108871693-108871715 CTGGGGAAGCACTGAGGAGGGGG - Intronic
1014088327 6:117373319-117373341 ATCGGGCGCCACGGAGCAGGGGG + Intronic
1016388710 6:143553870-143553892 GGCAGGCCCCACTGAGAAGGTGG + Intronic
1016833193 6:148453065-148453087 GTTGGGAACAGCTGAGGAGGAGG - Intronic
1018669267 6:166166547-166166569 GTCTGGGACCAGCGAGGAGGGGG - Intronic
1026315136 7:69221288-69221310 GTTGGGGACCCCTGAGGAGGTGG + Intergenic
1028711120 7:93909601-93909623 GTGTGGGACCACTGAGGAAGAGG + Intronic
1032765412 7:134986901-134986923 GTCTTCCACCACTGCGGAGGAGG - Intronic
1037865791 8:22441268-22441290 CTCGGACACCGCTGAGGAGCCGG + Exonic
1041108072 8:54459931-54459953 GTCGGACACCACCGAGGAAATGG - Exonic
1041232972 8:55772160-55772182 GTAGGGCAGCAGTAAGGAGGTGG + Intronic
1047381133 8:124364350-124364372 GTCTGAGAGCACTGAGGAGGAGG + Intronic
1047608684 8:126499539-126499561 GGCAGGGACCACTTAGGAGGTGG - Intergenic
1048138033 8:131765219-131765241 TTTGGGAACCACTGAGCAGGGGG + Intergenic
1049680762 8:143916989-143917011 GTCAGACCCCACTGAGGAGACGG - Exonic
1051358296 9:16259919-16259941 GTCTGGCAGCACCTAGGAGGTGG - Intronic
1055482101 9:76718818-76718840 GACAGACACAACTGAGGAGGCGG - Intronic
1058885714 9:109320291-109320313 GGCGGGCAGCGCCGAGGAGGAGG + Exonic
1060269066 9:122128421-122128443 GTTGGGCACAGCAGAGGAGGAGG - Intergenic
1060473845 9:123970624-123970646 ATGGGGCTCCACTGAGGAGCAGG + Intergenic
1061250461 9:129423332-129423354 TTCAGGCACCACAGATGAGGTGG + Intergenic
1061258800 9:129467836-129467858 CTGGGGCTGCACTGAGGAGGTGG - Intergenic
1061492918 9:130956197-130956219 GGCCGCCCCCACTGAGGAGGGGG + Intergenic
1061919550 9:133775211-133775233 GCGGGGCACCACTGTGGATGGGG + Intronic
1061989898 9:134153203-134153225 CACGGCCACCTCTGAGGAGGGGG + Intronic
1062351585 9:136142276-136142298 GTCAGGCATCACTGAGAAGGAGG + Intergenic
1185908243 X:3958001-3958023 GGCGGGCGCCACCTAGGAGGCGG - Intergenic
1186816815 X:13246296-13246318 GCAGGGGACCACTTAGGAGGAGG + Intergenic
1192088974 X:68132789-68132811 GGCGAGCCCCACTGAGGAGCCGG + Intronic
1194815838 X:98440156-98440178 GTTGGCCTCCAGTGAGGAGGTGG - Intergenic
1197760601 X:130025234-130025256 GTGGGACACCAATGAGGAGGAGG + Exonic