ID: 1168649975

View in Genome Browser
Species Human (GRCh38)
Location 19:58086620-58086642
Sequence CCACCCTCCTTGCCAGATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168649975_1168649981 -4 Left 1168649975 19:58086620-58086642 CCTGTATCTGGCAAGGAGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1168649981 19:58086639-58086661 GTGGCAATGTGGGCGCCTTGGGG 0: 1
1: 0
2: 0
3: 12
4: 151
1168649975_1168649979 -6 Left 1168649975 19:58086620-58086642 CCTGTATCTGGCAAGGAGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1168649979 19:58086637-58086659 GGGTGGCAATGTGGGCGCCTTGG 0: 1
1: 0
2: 0
3: 14
4: 155
1168649975_1168649983 4 Left 1168649975 19:58086620-58086642 CCTGTATCTGGCAAGGAGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1168649983 19:58086647-58086669 GTGGGCGCCTTGGGGCCAGGAGG 0: 1
1: 0
2: 1
3: 42
4: 341
1168649975_1168649986 22 Left 1168649975 19:58086620-58086642 CCTGTATCTGGCAAGGAGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1168649986 19:58086665-58086687 GGAGGCCTTTCCAAATTCCGAGG 0: 1
1: 0
2: 0
3: 4
4: 74
1168649975_1168649980 -5 Left 1168649975 19:58086620-58086642 CCTGTATCTGGCAAGGAGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1168649980 19:58086638-58086660 GGTGGCAATGTGGGCGCCTTGGG 0: 1
1: 0
2: 0
3: 10
4: 103
1168649975_1168649982 1 Left 1168649975 19:58086620-58086642 CCTGTATCTGGCAAGGAGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1168649982 19:58086644-58086666 AATGTGGGCGCCTTGGGGCCAGG 0: 1
1: 0
2: 1
3: 12
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168649975 Original CRISPR CCACCCTCCTTGCCAGATAC AGG (reversed) Intronic
900163888 1:1237079-1237101 GCACCCTCCCTGCTAGATGCTGG + Intergenic
900998670 1:6136486-6136508 CCACCTCCCTAGCCAGATCCAGG + Intronic
901167428 1:7230290-7230312 CCACCCTCCTCCCCAGACCCCGG - Intronic
902689909 1:18104671-18104693 CCACCCTCCCTGCCAGGAAAGGG - Intergenic
903680609 1:25094028-25094050 CCACCCTCTTTGCTCCATACTGG - Intergenic
903839467 1:26227987-26228009 CCACACTCCTTACCAGATGTTGG - Intergenic
906843331 1:49163328-49163350 CCACCATTCTTGCCTGATTCTGG + Intronic
907396661 1:54195469-54195491 CCTCCCACCTTGCCAGATCTCGG + Exonic
907792252 1:57678401-57678423 CCATCATCCTTGCCAGGTAGGGG + Intronic
910432713 1:87174818-87174840 CCACCCTCCATGCCTGAAAGAGG - Intergenic
913321357 1:117590905-117590927 CCAACCTCCCTTCCAAATACTGG - Intergenic
917705898 1:177634257-177634279 GGACCCTCCTTGCCAGGTGCGGG - Intergenic
917742315 1:177972656-177972678 CCATCCTCCTTTCCAAATGCCGG + Intronic
919705067 1:200668688-200668710 CCTCCTTCCTTCCCAGATCCAGG + Intronic
921074029 1:211685550-211685572 TCACCATCCTTGCCAGATCCCGG + Intergenic
923623364 1:235595210-235595232 CCACCCTCCACGGCAGACACGGG - Intronic
1072683281 10:97521795-97521817 CCAGCCTCCATGCCAGAGCCTGG - Intronic
1074480993 10:113820625-113820647 CCACCCACTCTCCCAGATACCGG - Intergenic
1074584397 10:114753065-114753087 CCAACCTCATTGCCTGTTACAGG - Intergenic
1075422351 10:122310918-122310940 CGACCCTCCTTTCCGGATTCTGG - Intronic
1075683998 10:124351464-124351486 ACAACCTCCCTGCCAGATACGGG + Intergenic
1076143512 10:128098031-128098053 TCACCCACCTTGCCAGGTGCAGG - Exonic
1076750793 10:132541824-132541846 CCAGCCACCTGGCCAGAGACAGG - Intronic
1077021522 11:419198-419220 CCACTTTCCCTGCCAGAGACTGG + Intronic
1077105106 11:838783-838805 CAACCATCCCTGCCACATACAGG + Exonic
1077226878 11:1442474-1442496 CCACCCTCCTCCCCAGCCACAGG + Exonic
1079694999 11:23470873-23470895 CCAGCCTCCTTTCCATATAAGGG + Intergenic
1081231557 11:40591144-40591166 CGACCCTCCGAGCCAGGTACCGG + Intronic
1084509825 11:69596618-69596640 ACACTCTCCTTGCCAGACACAGG + Intergenic
1084979660 11:72822362-72822384 CCCCCCTCCCTTCCAGACACCGG - Intronic
1085728457 11:78975711-78975733 CCAGCCTCCTACTCAGATACTGG + Intronic
1085803012 11:79608789-79608811 CCAAGCTCCGTGGCAGATACTGG - Intergenic
1086509875 11:87544590-87544612 CCACTATCCTTCCCAGATTCAGG + Intergenic
1086847824 11:91773808-91773830 CCTCCCTTTTTCCCAGATACAGG + Intergenic
1088195247 11:107266761-107266783 CCAACCTCCTGGCCTGATCCCGG - Intergenic
1093882259 12:24418331-24418353 CCATCCTCCTTGCCAGTGATTGG + Intergenic
1096414666 12:51402818-51402840 CCACTCTCCTTGCCAGTGATGGG + Intronic
1096497155 12:52045272-52045294 CCACCCTCCCTGCCAGCCCCAGG + Intronic
1096775436 12:53960923-53960945 CCACCCTCCCTGCTATATCCAGG + Intergenic
1098573147 12:72011824-72011846 CCAGCCTCCTTGCCACAGTCAGG - Intronic
1102027283 12:109720683-109720705 CCAGGCTCCCTGCCAGATGCTGG + Intronic
1105278623 13:18950337-18950359 GCACACTCCTTCCCAGAGACAGG + Intergenic
1106897169 13:34316281-34316303 CCAGCCTCCTTGCAAGTTTCTGG - Intergenic
1113084315 13:106551969-106551991 CCGCCCTCCTTGTCATATATGGG + Intronic
1118571806 14:67201598-67201620 CCACACCCCTTGCCAGTGACTGG - Intronic
1119662240 14:76460285-76460307 CCATCCTCCTTGTGAGATACAGG + Intronic
1119852390 14:77875273-77875295 CCACCGTCCATGCCAGAACCTGG - Intronic
1121562546 14:94885891-94885913 GCTCCCTCCTTGCCAGAAATGGG + Intergenic
1126515905 15:49537899-49537921 CCACCCACCTTGCCTGGTCCCGG - Intronic
1126671638 15:51120819-51120841 CCACCCTCCTCTCCTGATGCAGG - Intergenic
1131343702 15:91626960-91626982 CAACACTTCCTGCCAGATACAGG - Intergenic
1131937353 15:97521518-97521540 AAGCCCTCCTGGCCAGATACAGG - Intergenic
1133257007 16:4523188-4523210 ACATCCTCCGTGCCAGATACAGG + Intronic
1141480274 16:84301721-84301743 CCCCCCTCCATGCCAGGTTCTGG - Intronic
1141615174 16:85206235-85206257 CCCGCCTCCTTGCCAAACACAGG - Intergenic
1142262776 16:89050522-89050544 CCACCCTCCATGCCATTTTCAGG + Intergenic
1142711818 17:1727614-1727636 CCACACGCCTTGCCTGGTACAGG - Exonic
1142992038 17:3737917-3737939 CCAACCTCCCAGCCAGCTACTGG - Intronic
1147383975 17:40071153-40071175 CAGCCCTCCTTGCCAGCCACAGG - Intronic
1148863408 17:50616259-50616281 CCCCCATCCCTGCCAGATTCTGG + Exonic
1150617321 17:66782498-66782520 CCTCCCTCCTTCCCAGCTGCTGG - Intronic
1153138293 18:1942522-1942544 CTTCCTTCCTTCCCAGATACGGG - Intergenic
1155158575 18:23177890-23177912 CCACCCTCCTTGCCCGGCTCAGG + Intronic
1155644493 18:28061277-28061299 ACACCCTCCTTTCCACAAACAGG + Intronic
1156393880 18:36680175-36680197 CCACCATCCCTGGCAGCTACAGG - Intronic
1156975050 18:43211071-43211093 CCTCCCTCCATACCAGATCCTGG - Intergenic
1157404581 18:47412265-47412287 CCACCCTCTTTTCCAGAGGCAGG + Intergenic
1158162102 18:54496735-54496757 CCACTCTCCTTGCCAGTGATAGG - Intergenic
1159938205 18:74385453-74385475 CCTCCCTCCTGGCCACATATTGG + Intergenic
1161557765 19:4954260-4954282 CCAGCCTCCTTGCCAGGTCTGGG - Intronic
1161845898 19:6711844-6711866 CAACCCTCCTTGTGAGATTCAGG + Intronic
1162030395 19:7914750-7914772 CCTCCCTCCTTGCCAAGGACAGG + Intergenic
1162836150 19:13319521-13319543 CCACCCCACTTGCCAGACACAGG + Intronic
1164825754 19:31283853-31283875 CTCCCCTCCTTGCCTGATCCAGG - Intronic
1168475580 19:56672491-56672513 CCACCTTCTTTGCCATAGACTGG - Intergenic
1168649975 19:58086620-58086642 CCACCCTCCTTGCCAGATACAGG - Intronic
925204955 2:1997696-1997718 CCTCCCTCCTTCCCAGACTCGGG + Intronic
931185428 2:59946297-59946319 CCAGCCTCCTCGCTACATACAGG - Intergenic
935268875 2:101416594-101416616 CCACCCTCCTTGCCAGGTCAGGG - Intronic
937240768 2:120460986-120461008 CCACCCACCTTTCCTGATAGAGG + Intergenic
937373511 2:121319303-121319325 CCTCCCTCCCTGCCAAACACAGG - Intergenic
938774787 2:134531844-134531866 CCTCTCTCCTTGCCAGAGGCTGG + Intronic
940868215 2:158837854-158837876 CCACACTCCTTGCCAGCCATGGG + Intronic
942098506 2:172556008-172556030 CCACCCTCCTAGCCGGAGCCCGG - Exonic
945337172 2:208606000-208606022 CCAACCTCCATGCCATGTACTGG - Intronic
945359075 2:208874258-208874280 CCACATTCTTTGCCTGATACTGG + Intergenic
946393897 2:219433902-219433924 CCAGCCTCCTTGCCCCACACTGG - Intergenic
946428523 2:219612769-219612791 CCAAACTCCTTGGCAGACACAGG - Intronic
947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG + Intergenic
947523974 2:230867390-230867412 CCTGGCTCCTTGCCAGAAACTGG - Intronic
948662634 2:239516494-239516516 CCACACTCCCTGCCAGAGTCGGG - Intergenic
1168875475 20:1169214-1169236 CCACCCTCCAGGACAGATTCAGG - Intronic
1170932438 20:20781270-20781292 CAACCCTCCTTGCAAGGTGCTGG - Intergenic
1174147196 20:48460162-48460184 CCACCCGCCCTGCCAGCTGCTGG - Intergenic
1174524170 20:51158059-51158081 CCACGCTCTCTGCAAGATACTGG - Intergenic
1175137446 20:56835090-56835112 CCACCCTCTGTGCCAGATGAAGG + Intergenic
1175942263 20:62542943-62542965 CCATCCTCCATGCCAGTGACAGG + Intergenic
1178469895 21:32883027-32883049 CCACCATCTTTGCCAGAGAGTGG + Intergenic
1181826651 22:25521960-25521982 CAAAGGTCCTTGCCAGATACTGG - Intergenic
1182501828 22:30753549-30753571 CCACCTTCCTGGCCAGATGGAGG - Intronic
1184792203 22:46707179-46707201 CCACCCTCGGGGCCAGACACAGG + Intronic
950337799 3:12212552-12212574 CCACCCTCCTATCAAGATAAAGG + Intergenic
954415719 3:50392375-50392397 CCTCCCTCCTTCCCAGCTGCTGG - Intronic
954700255 3:52447115-52447137 CCCCCCTGCTTGCCAGCTGCAGG + Intergenic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955483213 3:59410330-59410352 CCATCCTCCTTGCCAGTGATTGG + Intergenic
957947528 3:87083994-87084016 CTACCCTAGTTGCCAGACACTGG + Intergenic
958462141 3:94412531-94412553 CCATCCTCCTTTCCAGAAAATGG + Intergenic
960667122 3:120120261-120120283 CCAACCTCCTCGCCAAATAGAGG + Intergenic
960914690 3:122683273-122683295 CCACCCTCCATGCCAGGAAGTGG + Intronic
961311589 3:126005458-126005480 CCAAGCTCCATGCTAGATACTGG - Intergenic
961633408 3:128317916-128317938 CCACCCTCCTTGCCACACTGGGG + Intronic
964444673 3:156746262-156746284 CCCCACTGCTTGCCAGAAACAGG - Intergenic
968392689 4:205798-205820 ACACCCTCCTTGCCAGGGAGTGG - Intergenic
970437156 4:16046919-16046941 CCACCCTCATTCCCAAACACTGG + Intronic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
975318392 4:72981301-72981323 CCACTCTCCTTCCCAAAAACTGG - Intergenic
976967156 4:91057196-91057218 CCACCCTCCATTCCTGAGACAGG - Intronic
977396780 4:96480691-96480713 CCACCATACTTGCCAGCTTCTGG + Intergenic
981288453 4:143046705-143046727 CCATCCTCCTCTCCAGATGCTGG - Intergenic
988955301 5:36310413-36310435 CCATCCTCCTTGCCAGTCACTGG + Intergenic
992631156 5:78682293-78682315 GGACCCTCCGAGCCAGATACAGG - Intronic
992877298 5:81069668-81069690 CCCACCTCCTTGCCAGAAAATGG + Intronic
993552148 5:89286793-89286815 CAATCCTCCTTGGCAGATTCAGG + Intergenic
995449192 5:112281518-112281540 ACACTCTCCTAGCCAGATGCTGG + Intronic
998005719 5:138655621-138655643 CCACCCTCCTTGTCAGAGATAGG + Intronic
998757886 5:145400674-145400696 ACACCCTCCTTCCCACAGACTGG - Intergenic
998879874 5:146634953-146634975 CCAACCCTCTTGCCAGATATAGG - Intronic
1007664511 6:43506393-43506415 CCACCCTCCTTTCCAGAGGGAGG - Exonic
1009627543 6:66155220-66155242 CCACTACCCTTCCCAGATACTGG - Intergenic
1011310690 6:85976402-85976424 CCACACTCTTTGCCAGACTCTGG - Intergenic
1013961234 6:115902768-115902790 CCACCCTCCTTCCCACATTATGG - Intergenic
1015803730 6:137087891-137087913 TCACCCACCTTGCCAGTTAGTGG + Intergenic
1020118552 7:5490099-5490121 CAACCCTGCTTGCCAGACTCTGG - Intronic
1021997395 7:26193610-26193632 CCACCCTGGTTGCCATATCCAGG + Exonic
1022159027 7:27690358-27690380 CCATCCTCCTGGCCACACACTGG - Intergenic
1022763617 7:33384286-33384308 GCACCCACTGTGCCAGATACTGG - Intronic
1023040611 7:36169741-36169763 CCAGGCTCCTTCCCAGATGCGGG - Intronic
1024194622 7:47047028-47047050 CCTCCTTCCCTGCCAGATCCTGG - Intergenic
1026251125 7:68671710-68671732 CCACCCTCCAGTCCAGATAGGGG - Intergenic
1026782940 7:73282250-73282272 CCACCCCACGTGCTAGATACTGG + Intergenic
1026959302 7:74398514-74398536 CCACCCTCCTGCCCAGACATTGG + Intronic
1031969105 7:128051023-128051045 GCCCCCTCCTTCCCAGTTACTGG - Intronic
1034753813 7:153595512-153595534 CCACCACCCTTGCCAGAACCTGG - Intergenic
1035259683 7:157653490-157653512 CCACCCTCCCTGGCACACACAGG - Intronic
1038811763 8:30853678-30853700 CAATCCTCCCTGACAGATACTGG + Intronic
1039468686 8:37800688-37800710 GCTCCCTCCTTCCCAGATGCAGG - Intronic
1040445813 8:47492312-47492334 CCTGCCTGCTTGCCAGATACTGG - Intronic
1041321006 8:56612443-56612465 GGACCCTCCCTGCCAGAAACAGG - Intergenic
1041788130 8:61658700-61658722 CCCCCCTCCCTGCCAGTCACAGG + Intronic
1043478559 8:80629180-80629202 CCATGCTCCTTGCCAGCTTCTGG - Exonic
1043529423 8:81133434-81133456 CTACCCTCCTTTCCATATCCAGG + Intergenic
1045719469 8:105091240-105091262 CCCCCCACCTGCCCAGATACAGG - Intronic
1049243480 8:141550224-141550246 TCACCGTGCTTGGCAGATACAGG - Intergenic
1049289676 8:141795172-141795194 CCTCCCACCTTTCTAGATACAGG - Intergenic
1049610013 8:143550455-143550477 CCACCTTCCTTGCCAGGTGGGGG + Intergenic
1050060712 9:1706816-1706838 CTACCTTACTTGCCAGATCCAGG + Intergenic
1052340153 9:27357229-27357251 CCATCTTCTTTGCCAGGTACAGG + Intronic
1054857976 9:69921742-69921764 CCTCCCTTCTTTCCAGATCCAGG + Intergenic
1056196083 9:84230032-84230054 CCATTCTCCTTTCCAGACACTGG + Intergenic
1056883825 9:90420787-90420809 CCATACTCCTTGCCAGACTCTGG - Intergenic
1057307557 9:93921028-93921050 CACCCCTCCTTCCCAGGTACTGG + Intergenic
1057717304 9:97504663-97504685 CCATCCTCCATCGCAGATACTGG - Intronic
1058536274 9:105963507-105963529 CCACCCTCATTGCCAGATTCTGG + Intergenic
1058636730 9:107045101-107045123 CCATCCTCCTTGCCAGTTCCTGG - Intergenic
1059824873 9:118017455-118017477 CCATTCTCCAGGCCAGATACCGG - Intergenic
1059965661 9:119610979-119611001 CCAAGCTCCTTGCCAGAACCAGG - Intergenic
1061133661 9:128721643-128721665 GCACCCACCATGCCAGGTACAGG + Exonic
1061587518 9:131578512-131578534 CCTCCCTCCTTGCCCCATCCTGG - Exonic
1186884953 X:13903787-13903809 CCACCCTGGCTGCCAGACACAGG - Intronic
1190627045 X:52346374-52346396 CCAACCTCCTAGCCAGATCCTGG + Intergenic
1199418428 X:147614553-147614575 CCACCCACCTTGCCTACTACCGG + Intergenic
1199526060 X:148793237-148793259 CCACCCACCCTGCCAAAGACTGG - Intronic
1200210416 X:154344555-154344577 CCACCCTCCAGGCCAGGGACCGG - Intergenic
1200220436 X:154387537-154387559 CCACCCTCCAGGCCAGGGACCGG + Intergenic