ID: 1168651662

View in Genome Browser
Species Human (GRCh38)
Location 19:58096118-58096140
Sequence GAGCCTGGGGAGTCTTAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168651658_1168651662 13 Left 1168651658 19:58096082-58096104 CCGGGGCAGGTGCGGCAGCGTAC 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1168651662 19:58096118-58096140 GAGCCTGGGGAGTCTTAAGCAGG 0: 1
1: 0
2: 3
3: 16
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168651662 Original CRISPR GAGCCTGGGGAGTCTTAAGC AGG Intronic
901797159 1:11686510-11686532 GAGCTTTGGGAGGCTGAAGCAGG - Intronic
901832603 1:11902220-11902242 GAGACAGGGGAGTTTTTAGCAGG - Intergenic
902921246 1:19666997-19667019 AAGCCTGAAGAGTCTGAAGCAGG - Intronic
905869934 1:41397596-41397618 GAGCCTCTGGAGTTTTCAGCAGG + Intergenic
906327791 1:44858838-44858860 GAGACTTGGGAGGCTGAAGCAGG - Intronic
907825480 1:58012752-58012774 GAGGCTGGGGAGTCTAAATGAGG - Intronic
907950487 1:59178655-59178677 GAGCCTGGGGGGCCTTAATAGGG + Intergenic
908874394 1:68654152-68654174 GAAACTGGAGAGTCCTAAGCTGG + Intergenic
909003642 1:70249634-70249656 GAGCCTGCGGAGGTTGAAGCTGG - Intronic
909121907 1:71613543-71613565 GAGGCTTGGGAGGCTGAAGCAGG + Intronic
910759745 1:90722692-90722714 GAGAGTGGGGAGTCTTACACTGG + Intergenic
912654796 1:111476721-111476743 GCACCTGGGGAAACTTAAGCTGG + Intronic
914828639 1:151154524-151154546 GAGGGAGGGGAGTCTGAAGCTGG + Intergenic
916798121 1:168186720-168186742 GAGACTGGGGAGGCTGAGGCAGG + Intronic
919777150 1:201201735-201201757 GACCCTGATGTGTCTTAAGCTGG - Exonic
920160882 1:203996865-203996887 GAGCCGGGGGAGACAAAAGCTGG + Intergenic
921090629 1:211838751-211838773 GATACTGGGGAGGCTGAAGCAGG + Intergenic
923629444 1:235640243-235640265 GAGCCTGGGGATGCTTAGGCAGG + Intronic
1063915078 10:10873476-10873498 GAGCCTTCTGAGTCTCAAGCTGG + Intergenic
1064850743 10:19706451-19706473 GAGGCTGGGGAGACTGAGGCAGG - Intronic
1065183998 10:23155082-23155104 GGGCTTGGGGAGGCTGAAGCCGG + Intergenic
1065858201 10:29847794-29847816 GCACCTGGGGAGGCTGAAGCGGG - Intergenic
1067349739 10:45465179-45465201 GAGCCTGGGGAATCCGAGGCTGG - Intronic
1068350540 10:55839061-55839083 GAGCTTTGGGAGTCTAAGGCAGG - Intergenic
1068507022 10:57913928-57913950 GACCCTGGGGAATAATAAGCTGG + Intergenic
1071530974 10:86390077-86390099 GGGCCTGGGGCGTCTGAAGCTGG + Intergenic
1074585163 10:114761413-114761435 GAGCCTGGGCAGTAGCAAGCTGG - Intergenic
1074978214 10:118597781-118597803 GAACTTTGGGAGTCTGAAGCGGG - Intergenic
1075446685 10:122518229-122518251 GAGGCTGAGGAGTCTGGAGCAGG + Intergenic
1075964035 10:126594933-126594955 GGCCCTGGAGAGTCTTAAGGTGG + Intronic
1081620964 11:44618986-44619008 GAGGCTGGGGCGTCTGAGGCCGG + Intronic
1083704983 11:64508040-64508062 GACCCTGGGGTGACTTAGGCCGG - Intergenic
1085336067 11:75697017-75697039 GAGCTTTGGGAGGCTAAAGCAGG - Intergenic
1089399378 11:118155731-118155753 GTGACTGGGGACTCTTGAGCTGG - Intergenic
1089453685 11:118613466-118613488 GGCCCTGTGGAGCCTTAAGCAGG - Intronic
1091426889 12:398549-398571 GAGCCTTGGGAGGCTGAGGCAGG - Intronic
1092840865 12:12539941-12539963 GAGGCTGGGGAGGCTGAAGCAGG + Intronic
1095495008 12:42775223-42775245 GAGACTGGTGATTCTTAACCAGG + Intergenic
1096120091 12:49083053-49083075 GCACTTTGGGAGTCTTAAGCAGG + Intergenic
1096481369 12:51943474-51943496 GAGCCTGTGGATTCTGAAGAAGG + Intergenic
1099961307 12:89399892-89399914 GAGCTTTGGGAGGCTGAAGCAGG - Intergenic
1102054732 12:109888018-109888040 GTGCCTGGGGAGGCTGAGGCGGG - Intergenic
1103494206 12:121349016-121349038 GCGCCTTGGGAGGCTGAAGCAGG + Intronic
1103688749 12:122753204-122753226 GGGCCTGGGGAGTCTAAAAAGGG - Intronic
1104632223 12:130413317-130413339 GAGCCTTGTGAGTCTCAAGTAGG - Intronic
1105853790 13:24358530-24358552 GAGCCAGGGGAGCCAGAAGCTGG - Intergenic
1107443139 13:40446091-40446113 GCTACTGGGGAGGCTTAAGCAGG + Intergenic
1108003454 13:45925230-45925252 GAGCCTGTGGAGCCCTGAGCAGG - Intergenic
1109341118 13:61060391-61060413 GCGCCATGGGAGTCTGAAGCAGG - Intergenic
1111019479 13:82428454-82428476 GACCCTAGGGAGTCCAAAGCCGG + Intergenic
1111146088 13:84182386-84182408 GAGCTTTGGGAGTCTTAGGCAGG - Intergenic
1111674088 13:91366021-91366043 GAGCCTGGGGAGGTTGAACCTGG + Intergenic
1112282783 13:98077085-98077107 GAGCCCAGGGATTCTTAAGTGGG - Intergenic
1112500810 13:99941715-99941737 GTGCCTGGGGAGGCTGAGGCTGG - Intergenic
1114150346 14:20031758-20031780 GAGGCGGGGGAGACTTCAGCTGG - Intergenic
1115483221 14:33883180-33883202 GCACCTTGGGAGTCTTAGGCCGG - Intergenic
1116752026 14:48898848-48898870 CAGCCTTGTGAGTCTTACGCTGG - Intergenic
1117006358 14:51425095-51425117 GAGCCTGGGGAGACAAAAGGAGG - Intergenic
1118879160 14:69811431-69811453 GAGCCACGGGAGTCTCAAGGAGG - Intergenic
1123006340 14:105325586-105325608 GAGCCAGGTGTGTCTTGAGCTGG + Intronic
1123942318 15:25222558-25222580 GAGCCTGGGGACCCTCATGCAGG - Intergenic
1124356095 15:28995953-28995975 GAGCTTGGGGAGTTTGAAGCTGG + Intronic
1127528800 15:59821366-59821388 GAGCCTAAGGAATCTCAAGCAGG + Intergenic
1128311424 15:66633589-66633611 GAGCCTGGGGAGGCATAGGGCGG - Intronic
1128473837 15:67980080-67980102 CAGCCAGTGGAGTCTTAGGCAGG - Intergenic
1129956356 15:79640324-79640346 GAGCCTGTGGAATCTTAGGCTGG - Intergenic
1130282901 15:82532975-82532997 GAGCCTGGGGAGTCTTGGAACGG - Intergenic
1131234562 15:90684521-90684543 GAGCCTGGAGAGCAGTAAGCTGG + Intergenic
1131532014 15:93201833-93201855 GAACCTGGGGAGGCTAAGGCAGG - Intergenic
1133471108 16:6076608-6076630 GAGCCTTAGGACTCTTAACCTGG + Intronic
1134270149 16:12725948-12725970 GAGGCTGGGGAGGCTGAGGCAGG + Intronic
1135157132 16:20062019-20062041 GAGCTTTGGGAGACTGAAGCAGG + Intronic
1135614942 16:23903075-23903097 GAACTTGGGGAGGCTGAAGCAGG - Intronic
1135975405 16:27105888-27105910 GAGCTTTGGGAGGCTGAAGCAGG + Intergenic
1135994674 16:27238979-27239001 GTGCCTGGGGAGGCTGAGGCAGG - Intronic
1136073658 16:27804138-27804160 GAGCCCGGGGCATTTTAAGCAGG - Intronic
1137566823 16:49538501-49538523 GAGCCTGGGGAGGATTATCCAGG - Intronic
1138480974 16:57303343-57303365 CAGCCTGGAGTGTTTTAAGCAGG + Intergenic
1138940231 16:61781507-61781529 GATGCTAGGGAGTCTAAAGCAGG + Intronic
1141815897 16:86409078-86409100 GAGCCTGGGGAGTCTGCATCTGG - Intergenic
1142394699 16:89825482-89825504 GATACTGGGGAGGCTAAAGCAGG - Intronic
1142570318 17:869325-869347 GTGCCTGGTGAGTCAGAAGCTGG - Intronic
1142753831 17:2003822-2003844 GAGCTTTGGGAGTCTGAGGCGGG + Intronic
1144329060 17:14207808-14207830 TTGCCTTGGGAGTCTCAAGCTGG + Exonic
1146815583 17:35939432-35939454 GAGCCTGGGGAATCTGGAGAGGG + Exonic
1147190859 17:38737214-38737236 GAGCTTTGGGAGGCTGAAGCGGG + Intronic
1147414349 17:40277836-40277858 GATACTTGGGAGGCTTAAGCAGG - Intronic
1147866228 17:43554429-43554451 GGAGCTGGGGAGTCTGAAGCGGG - Intronic
1148770622 17:50064030-50064052 GGGCTTGGGGAGTCTGAACCCGG + Intronic
1149265126 17:54920197-54920219 AAGCCTAGGGAGTCATCAGCAGG + Intronic
1150254875 17:63736379-63736401 GAGCTTTGGGAGGCTGAAGCGGG + Intronic
1151562770 17:74879505-74879527 GAGCCTGGGGGTGCTTAACCTGG - Exonic
1151579054 17:74967854-74967876 GAGCTTTGGGAGGCTGAAGCAGG + Intronic
1153167376 18:2278074-2278096 GAGCTTGGAGAGTCTAAAACAGG - Intergenic
1156318362 18:35993676-35993698 GAGTCTGTGGTGTCTGAAGCAGG + Intronic
1157356426 18:46939220-46939242 GTGCCTTGGGAGTCTGAGGCAGG + Intronic
1159695997 18:71557005-71557027 GCTCCTGGGGAGGCTGAAGCAGG - Intergenic
1161507393 19:4651148-4651170 GAGGGTGGGGAGTGTTGAGCTGG + Intronic
1163066149 19:14797249-14797271 GAACTTGGGGAGGCTGAAGCAGG + Intronic
1163845404 19:19635628-19635650 GACCCTGGTGAGGCTGAAGCAGG - Exonic
1164188803 19:22896827-22896849 GAGGCTGGGGAGGCTGAGGCAGG - Intergenic
1168635212 19:57990879-57990901 GAGCCTGGGGGGTCTTGAGCAGG - Intronic
1168651662 19:58096118-58096140 GAGCCTGGGGAGTCTTAAGCAGG + Intronic
927253089 2:21016174-21016196 GCTCCTTGGGAGGCTTAAGCAGG + Intronic
929397257 2:41537209-41537231 GAGACTGGGGAGGCTGAGGCAGG - Intergenic
929503744 2:42511903-42511925 GCTGCTGGGGAGTCTGAAGCAGG + Intronic
933351991 2:81165145-81165167 GAGCTTTGGGAGACTGAAGCAGG + Intergenic
937553321 2:123122474-123122496 GACTCTGGGGACTCTTAAACGGG + Intergenic
939883815 2:147659454-147659476 GAGCATGGGGGGTGTTAACCAGG - Intergenic
944038275 2:195324217-195324239 GAGCCTGGGAAGTCCAAAGCTGG - Intergenic
944536076 2:200711195-200711217 GCGACTGGGGAGTCTGAGGCAGG + Intergenic
945493025 2:210477760-210477782 GCCCATGGTGAGTCTTAAGCTGG + Exonic
946212929 2:218162105-218162127 CTGCCTGGAGAGTCTTAAGCAGG + Intergenic
946344084 2:219094215-219094237 GTGCCTGGGGAAAATTAAGCAGG + Intronic
948729019 2:239951900-239951922 GAGCCTGGGCAGGCGTCAGCAGG - Intronic
949023547 2:241754395-241754417 GAGCTTTGGGAGGCTGAAGCAGG + Intronic
1169661402 20:7982342-7982364 GAGCCTGAGGAGGCTGAAGAAGG - Exonic
1170222050 20:13951485-13951507 CAGCCTGGGGAGGCTGAGGCAGG + Intronic
1173582155 20:44154949-44154971 GAGCCTGGGGACTGAGAAGCTGG - Intronic
1175086875 20:56467038-56467060 GCGACTGGGGAGGCTGAAGCAGG + Intergenic
1176336831 21:5606742-5606764 GACGCTGGGGATTCTAAAGCAGG - Intergenic
1176390926 21:6214206-6214228 GACGCTGGGGATTCTAAAGCAGG + Intergenic
1176470493 21:7101968-7101990 GACGCTGGGGATTCTAAAGCAGG - Intergenic
1176494054 21:7483746-7483768 GACGCTGGGGATTCTAAAGCAGG - Intergenic
1176506588 21:7654637-7654659 GACGCTGGGGATTCTAAAGCAGG + Intergenic
1177153407 21:17477690-17477712 GCTCCTGGGGAGGCTGAAGCAGG - Intergenic
1178885267 21:36479914-36479936 GAGCCTGGGCAGGCGTAGGCTGG - Exonic
1179442844 21:41407678-41407700 GAGCCAGGGGAGTCCTGGGCTGG + Intronic
1180161921 21:46001964-46001986 GAGCCAGGGCAGTCGTACGCGGG + Exonic
1180948137 22:19708044-19708066 GAACCTGGGGAGACCCAAGCGGG - Intergenic
1184221829 22:43105784-43105806 GAGCCTTGGGAGGCTGAGGCGGG + Intergenic
1184534635 22:45078030-45078052 GAGCCGGGGGAGACTGAGGCGGG + Intergenic
949935482 3:9112587-9112609 GAGCCTGGAGAGTCTTTAACAGG + Intronic
950555665 3:13694482-13694504 GAGGTTGGGGAGTGTGAAGCAGG + Intergenic
952387000 3:32849055-32849077 CAGTCAGGGGAGCCTTAAGCTGG + Intronic
953315047 3:41919353-41919375 GAGCTTTGGGAGGCCTAAGCAGG + Intronic
953763707 3:45716225-45716247 GTGCCTTGGGAGGCTGAAGCAGG + Intronic
953869387 3:46613380-46613402 GATACTGGGGAGGCTGAAGCAGG + Intronic
954697993 3:52437574-52437596 CAGCCTGGGGAGACTTGGGCAGG + Exonic
961512952 3:127414099-127414121 GGCCCTGGGGAGTAATAAGCGGG - Intergenic
964870968 3:161313447-161313469 GACCCTGAAGAATCTTAAGCTGG - Intergenic
967158364 3:186713709-186713731 GTGCCTGGGGAATCTCAGGCAGG + Intergenic
967432280 3:189399828-189399850 GAGACTGGAGAGACTCAAGCAGG + Intergenic
967993654 3:195150655-195150677 GAGCCTGGGGAGAATGAAACCGG + Intronic
968562827 4:1294048-1294070 GTGTCTGAGGAGTCTTAGGCCGG + Intronic
969651544 4:8471127-8471149 GACCCTGCGGAGGCTGAAGCGGG + Exonic
978582159 4:110242891-110242913 GCGACTGGGGAGTCTGAGGCAGG + Intergenic
979721168 4:123902118-123902140 CAGCCTGGGGAGGATGAAGCTGG - Intergenic
980640842 4:135576963-135576985 GATACTGGGGAGTCTGAGGCAGG + Intergenic
981017732 4:139991733-139991755 GAGCTTTGGGAGGCTGAAGCAGG + Intronic
982228738 4:153188929-153188951 GAGTATGGGGAGTGGTAAGCAGG - Intronic
983132695 4:164042197-164042219 CAGCCTGGAGAGACTCAAGCTGG - Intronic
983229457 4:165114436-165114458 GACCCTGGGGAGCCTGAGGCAGG - Intronic
984949053 4:184993322-184993344 GAGGCTGGGGAGAGTTAGGCAGG + Intergenic
985894082 5:2738927-2738949 CAGCCTGGGGAGTCAGAAGAGGG - Intergenic
988584860 5:32499503-32499525 GTGGATGGGGAGTCATAAGCTGG - Intergenic
991052310 5:62286409-62286431 GCCCCTGGAGAGTTTTAAGCAGG + Intergenic
994175198 5:96703015-96703037 GAGCCTGGGGAGTCCGCTGCAGG - Intronic
994339678 5:98611461-98611483 GCTCCTGGGGAGGCTGAAGCAGG + Intergenic
995991474 5:118245492-118245514 GAGCCTGGGGACTCTTAGGCTGG + Intergenic
996000234 5:118352796-118352818 GAGACTGGGGAGGCTGAGGCAGG - Intergenic
997160251 5:131601001-131601023 AATCCTCGGGAGTCTGAAGCAGG + Intronic
1001918363 5:175580968-175580990 GCGCCTGGGGAGTCTGAGGCAGG - Intergenic
1002132873 5:177092169-177092191 GAGCCAGGGAAGGTTTAAGCAGG + Intronic
1006334633 6:33414180-33414202 GAGCCAGGGGAGTCCTGAGGTGG - Intronic
1007001997 6:38322290-38322312 GAGCATGTGGATTTTTAAGCAGG - Intronic
1007499083 6:42281653-42281675 GAGTCTGGGCACTCTTAAGCAGG - Intronic
1008943864 6:57075961-57075983 GAGCCTGGGGAGGTCAAAGCTGG - Intergenic
1012928331 6:105290488-105290510 CAGCCTGGGGAGAATTCAGCTGG - Intronic
1016445819 6:144131120-144131142 GAGCCTCGGGAGGCTTTTGCAGG - Intergenic
1019742088 7:2680082-2680104 GAAGCTGGGGAGTCTATAGCCGG + Intronic
1019887146 7:3915268-3915290 GAGCCAGGGGAGTCTTTGGTAGG + Intronic
1023098181 7:36684810-36684832 GATCCTTGGGAGGCTGAAGCAGG + Intronic
1024594414 7:50919966-50919988 GACCCTGGGGAGTCTTCCCCAGG + Intergenic
1024635938 7:51290605-51290627 GAGCCCAGGAAGGCTTAAGCAGG - Intronic
1024762706 7:52619371-52619393 GATCCTGGGGAGCCTGAAGCCGG + Intergenic
1024771292 7:52726274-52726296 GATCCTGGGGAGGCTGCAGCGGG + Intergenic
1026586236 7:71658391-71658413 GGGTCTGGGAAGTCTTAGGCAGG - Intronic
1026924182 7:74178185-74178207 GAGCCTTGGGAGGCTGAGGCAGG - Intronic
1027328257 7:77064957-77064979 GCACCTGGGGAGGCTGAAGCGGG - Intergenic
1029749313 7:102534056-102534078 GCACCTGGGGAGGCTGAAGCGGG + Intergenic
1029767256 7:102633160-102633182 GCACCTGGGGAGGCTGAAGCGGG + Intronic
1031434367 7:121713972-121713994 ATGCCTTGGGAGTCTTAGGCAGG - Intergenic
1032874971 7:136028410-136028432 GTCCCTGGAGAGTTTTAAGCAGG - Intergenic
1034497598 7:151431851-151431873 GAGCCTGGGGAGTCCTGAACCGG + Intronic
1034886539 7:154803042-154803064 GAGGCTGGGGAGTTTGAAGCAGG - Intronic
1036699697 8:11004128-11004150 GAGCCCTGGGAGTCTTGGGCTGG + Intronic
1037093741 8:14956149-14956171 GATACTCGGGAGTCTGAAGCAGG - Intronic
1038743437 8:30235466-30235488 GCGACTCGGGAGTCTAAAGCAGG + Intergenic
1039295715 8:36150626-36150648 GAGCCTTGGGAGGCCAAAGCAGG - Intergenic
1040668360 8:49657926-49657948 GACCCTTGGGAGTCTTAGGTGGG + Intergenic
1041392725 8:57361035-57361057 GAGTCAGGTGTGTCTTAAGCAGG - Intergenic
1041445742 8:57949215-57949237 GCGACTCGGGAGTCTTAGGCAGG + Intergenic
1042571231 8:70167340-70167362 GAGCATGGGGAGGCTTGTGCAGG - Intronic
1042783329 8:72517618-72517640 GAGCCTGGGGAATATTCAGCTGG + Intergenic
1043768335 8:84164985-84165007 GAGACTTGGGAGGCTGAAGCAGG - Intergenic
1044725946 8:95194401-95194423 GAACCTGGAGAGCCTGAAGCAGG + Intergenic
1047357915 8:124140809-124140831 GAGCTTTGGGAGGCTTAGGCAGG + Intergenic
1047917325 8:129595916-129595938 GAGGCTGTGGAGTATCAAGCTGG - Intergenic
1047957275 8:129985396-129985418 GAGCCTGGGGAATTTCAAGGGGG - Intronic
1049472987 8:142784522-142784544 GGGCCTGGGGTGTCCCAAGCCGG + Intergenic
1049976933 9:868929-868951 GAGCCTGGGGAGGTTGAGGCTGG + Intronic
1050755760 9:9001266-9001288 GAGCCTGGGGAAGGTTTAGCAGG + Intronic
1053142528 9:35690490-35690512 GAGCTTGGGGAAACTGAAGCAGG + Exonic
1054731877 9:68709309-68709331 GAGCCTGGGGAGGTTGAGGCTGG - Intronic
1054771276 9:69086474-69086496 GAGCCTTGGGAGTTTGCAGCAGG + Intronic
1059738618 9:117127790-117127812 GATACTGGGGAGGCTGAAGCAGG - Intronic
1203424821 Un_GL000195v1:28160-28182 GACGCTGGGGATTCTAAAGCAGG + Intergenic
1185534507 X:850109-850131 GCGCTTGGGGAGGCTGAAGCAGG + Intergenic
1185689179 X:2139261-2139283 GAGCTTGTGGAGTCTCAGGCTGG - Intergenic
1185794680 X:2954899-2954921 CAACCTGGCCAGTCTTAAGCCGG - Intronic
1185854514 X:3521497-3521519 GAGCCTTTGGAGTCTTTTGCAGG + Intergenic
1186876415 X:13822475-13822497 GCGACTGGGGAGGCTGAAGCAGG - Intronic
1187996374 X:24931393-24931415 CAGCATGGGGATTCTTATGCGGG - Intronic
1191012832 X:55778539-55778561 TAGCCTGGGGCCTCTTTAGCAGG + Intergenic
1195242754 X:102968759-102968781 GAGCCTGGGGACTCTTAAGAGGG + Intergenic
1195301415 X:103533825-103533847 GAGCCTTGGCAGTCCTTAGCAGG + Intergenic
1196086955 X:111693877-111693899 CAGCCTAGGGATTCTTAACCCGG - Intronic
1196655692 X:118214961-118214983 GTGCCTGGGGAGGCTGAGGCAGG - Intergenic
1200749447 Y:6931285-6931307 CAGCCTGGGGAGGCTGAGGCAGG + Intronic
1200808997 Y:7463026-7463048 GAGCCTTTGGAGTCTTTTGCAGG - Intergenic
1201772929 Y:17635186-17635208 GCCCCTGGGGAGTCTGAGGCAGG - Intergenic
1201828626 Y:18270800-18270822 GCCCCTGGGGAGTCTGAGGCAGG + Intergenic