ID: 1168652167

View in Genome Browser
Species Human (GRCh38)
Location 19:58098176-58098198
Sequence GCTGCGCAGCTACCCCAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 177}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168652159_1168652167 -4 Left 1168652159 19:58098157-58098179 CCCCGGGACCGACCCACCTGCTG 0: 1
1: 0
2: 0
3: 13
4: 153
Right 1168652167 19:58098176-58098198 GCTGCGCAGCTACCCCAGGCCGG 0: 1
1: 0
2: 0
3: 17
4: 177
1168652158_1168652167 7 Left 1168652158 19:58098146-58098168 CCGCGCTGCATCCCCGGGACCGA 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1168652167 19:58098176-58098198 GCTGCGCAGCTACCCCAGGCCGG 0: 1
1: 0
2: 0
3: 17
4: 177
1168652161_1168652167 -6 Left 1168652161 19:58098159-58098181 CCGGGACCGACCCACCTGCTGCG 0: 1
1: 0
2: 1
3: 13
4: 105
Right 1168652167 19:58098176-58098198 GCTGCGCAGCTACCCCAGGCCGG 0: 1
1: 0
2: 0
3: 17
4: 177
1168652157_1168652167 8 Left 1168652157 19:58098145-58098167 CCCGCGCTGCATCCCCGGGACCG 0: 1
1: 0
2: 0
3: 2
4: 110
Right 1168652167 19:58098176-58098198 GCTGCGCAGCTACCCCAGGCCGG 0: 1
1: 0
2: 0
3: 17
4: 177
1168652156_1168652167 9 Left 1168652156 19:58098144-58098166 CCCCGCGCTGCATCCCCGGGACC 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1168652167 19:58098176-58098198 GCTGCGCAGCTACCCCAGGCCGG 0: 1
1: 0
2: 0
3: 17
4: 177
1168652160_1168652167 -5 Left 1168652160 19:58098158-58098180 CCCGGGACCGACCCACCTGCTGC 0: 1
1: 0
2: 3
3: 18
4: 207
Right 1168652167 19:58098176-58098198 GCTGCGCAGCTACCCCAGGCCGG 0: 1
1: 0
2: 0
3: 17
4: 177
1168652155_1168652167 10 Left 1168652155 19:58098143-58098165 CCCCCGCGCTGCATCCCCGGGAC 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1168652167 19:58098176-58098198 GCTGCGCAGCTACCCCAGGCCGG 0: 1
1: 0
2: 0
3: 17
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168652167 Original CRISPR GCTGCGCAGCTACCCCAGGC CGG Intronic
900579527 1:3402224-3402246 GCTGCCCAGCTGCTACAGGCAGG + Intronic
901209319 1:7515502-7515524 GCTGTGCAGCCACCCCTGACTGG - Intronic
901777426 1:11569934-11569956 GCTGAGCTGCTGCCCCTGGCAGG + Intergenic
902229705 1:15020113-15020135 GCCTCACTGCTACCCCAGGCGGG + Intronic
902231560 1:15030812-15030834 GCTGCTCAGCCAAGCCAGGCAGG + Intronic
903434630 1:23337609-23337631 ACTGCGCCGCTACTCCAGCCTGG + Intronic
906143666 1:43547835-43547857 GCAGCGCAGCTTCCCCAGCCAGG + Intronic
906318418 1:44802567-44802589 GCTGAGCAGCTGGGCCAGGCGGG + Intronic
906714351 1:47955832-47955854 ACTGCTCAGCAACCCCAGGAGGG + Intronic
910485526 1:87709331-87709353 CCTGCTCAGCTATCCCATGCAGG + Intergenic
913527059 1:119703631-119703653 GCTGCTCAGGCACCCCAGCCAGG - Intronic
917135427 1:171784360-171784382 GCTGCGCCGCAAGGCCAGGCTGG + Exonic
920403547 1:205692489-205692511 GCTGCTCAGCTGCTCAAGGCAGG - Intergenic
922468400 1:225860683-225860705 GCTGGGCAGATACCCCAGTTGGG + Intronic
1063187635 10:3665364-3665386 GAGGCTGAGCTACCCCAGGCAGG + Intergenic
1063572296 10:7227367-7227389 GCTGGGCAGCAAGTCCAGGCAGG + Intronic
1066623129 10:37379398-37379420 GCTGCCAAGCTCCACCAGGCAGG - Intronic
1067022952 10:42818008-42818030 CCTGCTCAGCATCCCCAGGCAGG - Intronic
1067312473 10:45127016-45127038 GTTGCCCAGCTTGCCCAGGCTGG - Intergenic
1070079161 10:73168395-73168417 ACTGCTCAGCCACCCCAGCCGGG + Intronic
1074164086 10:110859452-110859474 GCAGCACAGCTACCCCAGCTGGG + Intergenic
1074575652 10:114666601-114666623 GCTGCTCAGCAACCTCAGGTGGG + Intronic
1074801553 10:117005411-117005433 GGTGCGGAGCGACCCCACGCAGG - Exonic
1075671461 10:124266339-124266361 GCGGTGCAGCTTCCCCAGCCAGG + Intergenic
1076782867 10:132734072-132734094 GCTGCGCAGGTACCTCTGGTCGG + Intronic
1076831167 10:132995033-132995055 CCTGCTGAGCTACCCCACGCTGG - Intergenic
1076834267 10:133013152-133013174 GGTGCCCAGCAACCCCAGGCAGG - Intergenic
1076848128 10:133080093-133080115 GCAGCGCAGCCGACCCAGGCAGG + Intronic
1076877821 10:133225321-133225343 GTTGCTCAGCCAACCCAGGCTGG - Exonic
1076898530 10:133325786-133325808 GGCGCGCACCTACCCCGGGCCGG + Exonic
1077349401 11:2085509-2085531 GCTGCTCAGCTTCCCCTGCCAGG - Intergenic
1077378145 11:2215263-2215285 GCTCCGCAGCCTCCCCAGCCAGG + Intergenic
1077411310 11:2405167-2405189 GCTCCCCATCTTCCCCAGGCTGG - Intronic
1077841757 11:5982899-5982921 GGTGCTCAGCAACCCCATGCAGG + Intergenic
1079280107 11:19079614-19079636 TCTCTGCAGCCACCCCAGGCAGG - Intergenic
1081630170 11:44684067-44684089 CTGGCCCAGCTACCCCAGGCTGG + Intergenic
1083708798 11:64534747-64534769 AATTCGCAGCCACCCCAGGCGGG + Intergenic
1083720296 11:64600520-64600542 GCTGCGGGGCACCCCCAGGCAGG + Intronic
1083885332 11:65570710-65570732 GCTGCGCGGTTACCGCATGCTGG + Exonic
1084775736 11:71373700-71373722 GCAGCTAAGCTCCCCCAGGCAGG + Intergenic
1086091752 11:83011763-83011785 GCTGCCCAGCTACCAGAGTCTGG - Intronic
1089094312 11:115906185-115906207 GCTGCCCAGCTCCCCCAAACTGG + Intergenic
1090884158 11:130861593-130861615 CCCGCCCAGCTTCCCCAGGCTGG + Intergenic
1095281071 12:40353100-40353122 GCTGGGCAGCCACCCCATCCGGG - Intronic
1097903958 12:64901349-64901371 GCTGCGTATTTACCCGAGGCAGG + Intergenic
1097990226 12:65825505-65825527 TCTGCGCCGCTCCCCCCGGCCGG - Intronic
1101089446 12:101270212-101270234 GATGGGCAGGTACCCCAAGCTGG - Intergenic
1101641054 12:106586036-106586058 GCTGCCCAGCTTCCCCCGACCGG - Intronic
1105798786 13:23884513-23884535 GCTGGGCTGCCAGCCCAGGCAGG - Intronic
1105927053 13:25018176-25018198 GCTGCGCAGGTGCCGCGGGCTGG + Intergenic
1106511592 13:30417959-30417981 GCTGTGCACCTGACCCAGGCTGG + Intergenic
1106792338 13:33168393-33168415 ACTCCACAGCTTCCCCAGGCAGG - Intronic
1107116667 13:36754603-36754625 GCAGCGCAGCTGCCTCATGCTGG - Intergenic
1107225716 13:38045328-38045350 GCTACGCTGCTAGCCCAAGCTGG - Intergenic
1113537183 13:111076953-111076975 TCTGCTGAGCTTCCCCAGGCAGG - Intergenic
1113771386 13:112911397-112911419 GCTGGGCCGCTCTCCCAGGCAGG - Intronic
1117487451 14:56212649-56212671 GCAGTGCAGCTGCCACAGGCAGG - Intronic
1117754673 14:58961182-58961204 GCTGTGCAGCTACCACAGGTGGG + Intergenic
1118883784 14:69850283-69850305 ACAGGGCAGCAACCCCAGGCCGG + Intergenic
1119644665 14:76339703-76339725 GCTGCTCTTCTACCCCAGCCTGG - Intronic
1121204089 14:92146991-92147013 GATGGGCAGCTAAACCAGGCAGG - Intronic
1122789192 14:104177220-104177242 GCTGCGCCGCTCCTACAGGCGGG - Exonic
1123219787 14:106844726-106844748 GCTTCGCCGCTATCCCAGGTCGG + Intergenic
1123424103 15:20155157-20155179 CCTGCTCAGCACCCCCAGGCAGG - Intergenic
1123533323 15:21161686-21161708 CCTGCTCAGCACCCCCAGGCAGG - Intergenic
1128156673 15:65395858-65395880 GCTGCCCAGCGCCCCCACGCGGG - Exonic
1128648971 15:69396740-69396762 CCTGAGCTGCTGCCCCAGGCTGG + Intronic
1132728970 16:1351453-1351475 GCAGCGCACCAGCCCCAGGCGGG + Exonic
1132949820 16:2554962-2554984 GCTGAGCAGCTACTCCATGCTGG - Intronic
1132964528 16:2645205-2645227 GCTGAGCAGCTACTCCATGCTGG + Intergenic
1134057880 16:11181615-11181637 GCTGAGGCGCTCCCCCAGGCAGG + Exonic
1136860764 16:33700727-33700749 CCTGCTCAGCACCCCCAGGCTGG + Intergenic
1137557961 16:49484591-49484613 GCCGCGCACCAACCCCAGGCTGG + Intergenic
1138405212 16:56787470-56787492 GCTGAGCAGCTTTGCCAGGCTGG - Intronic
1140890848 16:79283882-79283904 GCTCCCCAGCTACCCCGTGCAGG - Intergenic
1141639772 16:85334366-85334388 CCAGCGCAGCTCCCCCATGCAGG - Intergenic
1141729619 16:85812928-85812950 GCTACTCAGCTACCTGAGGCAGG - Intergenic
1142249203 16:88983382-88983404 GCTCATCAGCCACCCCAGGCGGG + Intergenic
1203122261 16_KI270728v1_random:1548910-1548932 CCTGCTCAGCACCCCCAGGCAGG + Intergenic
1142742209 17:1937754-1937776 GCTGCGGAGCTGCCCCTGGGTGG - Exonic
1143541640 17:7572924-7572946 GCCTCTCAGCTACCCCCGGCGGG - Intronic
1143543076 17:7581030-7581052 GCTGCTCAGCTGCCCCACACAGG + Exonic
1143886690 17:10070284-10070306 GCTGGGCAGCTGACCCAGGCTGG - Intronic
1144006599 17:11106038-11106060 GCTGAGCAGCAACCTGAGGCTGG - Intergenic
1144578473 17:16444518-16444540 GCTGAGCTGCCACCCCAGGGTGG - Intronic
1145863749 17:28227424-28227446 GCGGCTCAGCTACCCCAGGAAGG - Intergenic
1146595798 17:34167415-34167437 GCAGAGCAGCTACCAGAGGCTGG + Intronic
1147374624 17:40016307-40016329 CCTGAGCAGCTGCCCCAGCCAGG + Exonic
1149478934 17:56986056-56986078 GCTGTGCAGCAGCCCCAGGGTGG - Intronic
1151569625 17:74919779-74919801 GCTGCAGAGCTCCCCCAGCCTGG - Exonic
1151595296 17:75074715-75074737 GCTGCTCAGCATCCCCAGGGCGG - Intergenic
1151707147 17:75775164-75775186 GCTGCTCAGCTCCCCCTGCCTGG - Intergenic
1151978338 17:77494884-77494906 GCTGGGCAGCTCCCGCAGGGTGG - Intronic
1152426648 17:80221664-80221686 GCTGGGCAGCCACGCCAGGATGG - Exonic
1153024550 18:660659-660681 GCTGAGTAGGTACCTCAGGCCGG + Intronic
1154342393 18:13514785-13514807 GCTGGGCAGCAACACCAGCCTGG - Intronic
1154980319 18:21498325-21498347 GCTGCCCTGCTCCCCCAGCCAGG + Intronic
1159781745 18:72668093-72668115 GCTGCACAGCTCTCCGAGGCTGG - Intergenic
1161264784 19:3359316-3359338 GCTCCGCAGCGAGCCCAGCCGGG + Intergenic
1161321612 19:3644096-3644118 GGCCCGCAGCTACCCCACGCTGG - Exonic
1161904842 19:7149039-7149061 GTGACGCAGCTACCCCAGGCGGG - Intronic
1163300218 19:16440806-16440828 GCTGGGCAGAGCCCCCAGGCTGG - Intronic
1163784279 19:19266646-19266668 GATGAGCAGCTACCCCAGGTGGG + Intronic
1168652167 19:58098176-58098198 GCTGCGCAGCTACCCCAGGCCGG + Intronic
925182007 2:1823501-1823523 TCTGAGCAGCTCCCCCAGGACGG + Intronic
925914358 2:8594186-8594208 CCTGCTCAGCCACCACAGGCTGG - Intergenic
929998514 2:46845473-46845495 GCTGCGGAAGTACCCCGGGCAGG - Intronic
932702766 2:74002593-74002615 GCTGGGCAGGTCCACCAGGCGGG + Intronic
933710526 2:85322365-85322387 GCAGCGCAGCCTGCCCAGGCTGG + Exonic
934459144 2:94201882-94201904 CCTGCTCAGCAACCCCAGGCAGG + Intergenic
934938606 2:98483412-98483434 GCTGCAGGGCTGCCCCAGGCGGG + Intronic
937925099 2:127162123-127162145 GCTGCTCTGCAGCCCCAGGCTGG + Intergenic
940329137 2:152455549-152455571 ACTGAGCACCTACCACAGGCTGG + Intronic
941054868 2:160776486-160776508 GTTGCTCAGCAACCCCATGCAGG - Intergenic
944043490 2:195382332-195382354 GCTGTGCAGCTCCCCCAAGCAGG + Intergenic
946029713 2:216694523-216694545 GCTGCGCTGCCTCCCCCGGCAGG - Exonic
948479401 2:238240532-238240554 GCTTGGCAGCCACCCCAGCCGGG - Intronic
948944527 2:241212744-241212766 GCTGCACAGCTGGCCCTGGCTGG - Intronic
949023134 2:241752573-241752595 GCTGGGCAGCTGCCTCAGCCCGG - Intronic
1172176357 20:32974587-32974609 GCTGAGCTCCAACCCCAGGCTGG + Intergenic
1172655263 20:36532991-36533013 GCTGTGCTGCTGCTCCAGGCGGG + Intergenic
1173291577 20:41719582-41719604 CCTGCTCAGCCACGCCAGGCTGG + Intergenic
1173332927 20:42090326-42090348 TCTTCACAGCTACCCCAAGCTGG - Intronic
1173553517 20:43949497-43949519 GGTGCCCAGCTCCCCCAGGTGGG - Intronic
1174008754 20:47431788-47431810 GGTGCCCAGCTTGCCCAGGCTGG + Intergenic
1176140666 20:63543374-63543396 GGTGAGCAGCTCCTCCAGGCCGG + Exonic
1176188552 20:63795368-63795390 GCTGCGCAGTTACACCGTGCAGG + Intronic
1176201414 20:63862458-63862480 GCTGTGCTGCTACCCGGGGCCGG + Exonic
1179028254 21:37698309-37698331 GCTGCCCTGCTTCTCCAGGCGGG + Intronic
1179587031 21:42379997-42380019 GCTGCCCAGATACCCCGGCCAGG - Intronic
1179663509 21:42893394-42893416 GCCGCGCAGCCAGCCCAGGCTGG - Intronic
1180014617 21:45074297-45074319 GCGGCGCCGCGACGCCAGGCCGG + Intronic
1180180557 21:46117033-46117055 GCTGTGGAGCTGCCCCAAGCCGG - Intronic
1181584448 22:23845361-23845383 GCTGCGGAGCTGGCACAGGCAGG + Intergenic
1181756523 22:25028521-25028543 GCTTGGCAGCCACCTCAGGCCGG - Exonic
1183079131 22:35445106-35445128 GCTGGGGAGCAACCCCAGGCTGG - Intergenic
1183255228 22:36757662-36757684 GCTGCCCAGCTCCCCGAGGCAGG + Intergenic
1183490824 22:38114811-38114833 GCCTCGCAGCCTCCCCAGGCAGG + Intronic
1183923085 22:41184825-41184847 GCTGAGTAGCTTCCCGAGGCAGG - Intergenic
1184661922 22:45969374-45969396 GCTGCGCTTCTGTCCCAGGCAGG - Intronic
951217842 3:20040890-20040912 GCGGTGCAGCGGCCCCAGGCGGG - Intronic
952108577 3:30096510-30096532 GTGGGGCAGCTTCCCCAGGCAGG + Intergenic
953037427 3:39225302-39225324 GCTGCGCAGTTGGCCCAGGTTGG + Intergenic
954028839 3:47803551-47803573 GATGCGCCGTTTCCCCAGGCAGG + Intronic
954035008 3:47846701-47846723 GCTGCAGAGCAACCCCAGCCTGG + Exonic
957054732 3:75435014-75435036 GCTGCGCTCCTTCCCCTGGCAGG - Intergenic
961300117 3:125916698-125916720 GCTGCGCTCCTTCCCCTGGCAGG + Intergenic
966263193 3:178004525-178004547 GCTGAAGAGCTTCCCCAGGCAGG - Intergenic
966982980 3:185154391-185154413 GCTGAGAACCGACCCCAGGCTGG + Intergenic
967874288 3:194256209-194256231 GCTGCGGACCTCCCCCAGGACGG - Intergenic
968655296 4:1775964-1775986 GCTGCTCGGCTGCCCCGGGCAGG + Intergenic
969691135 4:8704876-8704898 GCAGCGCCCCTGCCCCAGGCAGG - Intergenic
982130439 4:152224334-152224356 CCCGCACAGCTACCCCTGGCAGG - Intergenic
985551005 5:533614-533636 GCCACGCAGCCTCCCCAGGCAGG - Intergenic
987235368 5:15936759-15936781 GATGCTCAGGTACCGCAGGCGGG - Exonic
988547706 5:32173987-32174009 GGTGCGCCGCTGCACCAGGCCGG + Exonic
997428411 5:133820192-133820214 GCAGCACAGCTTCCCCGGGCCGG + Intergenic
999258408 5:150222683-150222705 GCAACGCAGCGACCCCAGCCTGG + Exonic
999480815 5:151946762-151946784 GGTGAGCAGCCACCCCAGGCTGG + Intergenic
1002197639 5:177509874-177509896 GGTGCGCAGCTGCCCGGGGCGGG - Intronic
1002605710 5:180381610-180381632 GCTGAGCAGCTGGACCAGGCTGG + Intergenic
1003307914 6:4946002-4946024 GCTGCCCAGCGCCCACAGGCGGG + Intronic
1005842532 6:29752999-29753021 GCTGCTCCGCCACCCCAGGAAGG + Intergenic
1006829066 6:36958042-36958064 GCTGTGGAGCTATCCCAGCCAGG + Intronic
1012592939 6:101005300-101005322 ACTGCTCAGCTGCCCCAGGTAGG - Intergenic
1018017860 6:159727761-159727783 GATGCGCAGCCGCCCCCGGCGGG + Intronic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1021034797 7:15784867-15784889 GCTCCATAGCTACCCCAGGTGGG - Intergenic
1023429512 7:40074789-40074811 GTTCCACTGCTACCCCAGGCTGG - Intronic
1023579861 7:41670276-41670298 CCTTTGCAGCAACCCCAGGCAGG - Intergenic
1023844867 7:44114863-44114885 GCTGCGCAGGTTCACAAGGCAGG + Exonic
1026360593 7:69598599-69598621 GCTGCGCTTCTCCCTCAGGCGGG + Intergenic
1028937656 7:96484258-96484280 TCTGAGCAGCGACCACAGGCAGG - Intronic
1029123764 7:98284148-98284170 TCTGGGCAGCTGCACCAGGCAGG + Intronic
1029147831 7:98459118-98459140 GGTGAACAGCTACCCCTGGCAGG + Intergenic
1035195707 7:157218640-157218662 GCTGTGAAGCAACCCCAGCCTGG - Intronic
1035311311 7:157970729-157970751 GCTGCACAGCTACCCCTGCTGGG - Intronic
1035637582 8:1158061-1158083 GCTGCACAGCTGCCCCTTGCAGG + Intergenic
1036453884 8:8892169-8892191 GCCGCGCTGCTGCCCCTGGCTGG - Exonic
1037821879 8:22139016-22139038 GCTGCGGAGCTTCTCCATGCAGG - Exonic
1042477630 8:69266863-69266885 GGTGGGCAGCTAATCCAGGCTGG - Intergenic
1047100153 8:121667520-121667542 GCTGCGCAGGAGCCCCCGGCGGG + Intergenic
1048162162 8:132031566-132031588 ACTGCCCAGCTACCCCAAGAGGG - Intronic
1049847072 8:144807985-144808007 GCTGCGCAGAGGCCCCAGGCGGG + Exonic
1053689640 9:40577669-40577691 CCTGCTCAGCACCCCCAGGCAGG + Intergenic
1054274389 9:63053388-63053410 CCTGCTCAGCACCCCCAGGCAGG - Intergenic
1054300887 9:63378608-63378630 CCTGCTCAGCACCCCCAGGCAGG + Intergenic
1054400435 9:64711541-64711563 CCTGCTCAGCACCCCCAGGCAGG + Intergenic
1054434025 9:65195797-65195819 CCTGCTCAGCACCCCCAGGCAGG + Intergenic
1054496362 9:65825871-65825893 CCTGCTCAGCACCCCCAGGCAGG - Intergenic
1056256112 9:84801042-84801064 GCTGCTGAGCTACTGCAGGCAGG + Intronic
1059397826 9:114049582-114049604 GCTGCCCACCTACGTCAGGCTGG + Exonic
1062376568 9:136264407-136264429 GCTGCCCAGGGATCCCAGGCGGG - Intergenic
1196920129 X:120576874-120576896 GCTGGGCACCTAACCCAGGATGG - Intergenic
1200176884 X:154123256-154123278 ACTGGGCAGCTACCCCAGCTGGG + Intergenic