ID: 1168653336

View in Genome Browser
Species Human (GRCh38)
Location 19:58108201-58108223
Sequence CACACATAACTTATTAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 268}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168653336_1168653339 15 Left 1168653336 19:58108201-58108223 CCATGTTTAATAAGTTATGTGTG 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1168653339 19:58108239-58108261 TCTACACCCAGTACATACATAGG 0: 1
1: 0
2: 0
3: 9
4: 106
1168653336_1168653340 16 Left 1168653336 19:58108201-58108223 CCATGTTTAATAAGTTATGTGTG 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1168653340 19:58108240-58108262 CTACACCCAGTACATACATAGGG 0: 1
1: 0
2: 2
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168653336 Original CRISPR CACACATAACTTATTAAACA TGG (reversed) Intronic
904174884 1:28620100-28620122 CACATATAACTTTTGAAATAAGG + Intronic
906736477 1:48134094-48134116 TGAACATAATTTATTAAACAGGG + Intergenic
906891132 1:49716185-49716207 CCAACATCACTTATTAAATAGGG + Intronic
908142582 1:61202409-61202431 CACAAATAAATCCTTAAACAAGG - Intronic
908328795 1:63050168-63050190 CACACATAAATTTTCAAATATGG - Intergenic
908620491 1:65974497-65974519 CAGACATTACCTATTAATCAAGG + Intronic
909725477 1:78829608-78829630 CACAGAAACCCTATTAAACAGGG - Intergenic
910104429 1:83616204-83616226 GACATATAAATTATTGAACAAGG - Intergenic
910757353 1:90707220-90707242 CACTAAGAACTTATTAAATAGGG + Intergenic
910953898 1:92680620-92680642 CACAAATTACTTATTACAAAAGG + Intronic
911353078 1:96779703-96779725 CACACTTCACTTATTACAGAAGG + Intronic
911407160 1:97456605-97456627 CAGACATAGTTCATTAAACAAGG - Intronic
911518759 1:98902717-98902739 CACACATAATTAGTTACACATGG - Intronic
911713892 1:101108723-101108745 CACACATGACTTATTCACAAAGG - Intergenic
912973136 1:114302877-114302899 CTCACCTAAGTTATTAACCAAGG - Intergenic
916907257 1:169300195-169300217 CACACATAAATCATTAGACTAGG + Intronic
918493463 1:185108152-185108174 CTCTCATTACTTATTCAACATGG + Intergenic
920811117 1:209286607-209286629 GACACATAAAATATTAAATATGG + Intergenic
920961642 1:210669072-210669094 CACACATTACCTTTTAAAGAAGG + Intronic
921494207 1:215817482-215817504 CATACATGACTTGGTAAACAAGG + Intronic
923069811 1:230552242-230552264 CACACATAACTGATAAAGCTGGG + Intergenic
1063608993 10:7547341-7547363 CCCACATAATTAATTACACATGG - Intergenic
1064005218 10:11693883-11693905 CAGACAGAACTTGTTTAACAAGG - Intergenic
1064301811 10:14129671-14129693 CACACAGAACTAATTACCCAAGG - Intronic
1064869220 10:19919322-19919344 CACAAAAACCTTATTAAAAAAGG + Intronic
1065257477 10:23885930-23885952 CACAAATAACCCACTAAACATGG - Intronic
1065658703 10:27982366-27982388 TACATATAACTTATTTAGCATGG - Intronic
1066601482 10:37112613-37112635 TACACATAACTAAGTAAAAAAGG + Intergenic
1068028310 10:51676615-51676637 CACAGATAACTTGTTATACAGGG - Intronic
1068712781 10:60152539-60152561 CACACAGGACTTACTAATCATGG + Intronic
1070185491 10:74058300-74058322 CAAACATATCTGATCAAACAAGG - Intronic
1070508060 10:77133769-77133791 CACACATATATTAGTAAACTAGG + Intronic
1070824575 10:79383783-79383805 CACACATATTTTTTTAAAAAAGG + Exonic
1072329384 10:94331718-94331740 AACACATAAATTATTAACAATGG - Exonic
1073622171 10:105061108-105061130 TACAAATAATTTTTTAAACAAGG + Intronic
1074930658 10:118122580-118122602 CACACCTAACTTATTTACAAAGG + Intergenic
1075271441 10:121055133-121055155 CAAACATAACTTTATTAACAAGG - Intergenic
1076049700 10:127322493-127322515 CACACATAATTTTCTAAACCAGG + Intronic
1078165990 11:8885837-8885859 CATACAAAACTTATTAATTATGG - Intronic
1079637002 11:22755216-22755238 CACACATAAGCTATAAAACATGG + Intronic
1079864470 11:25717737-25717759 AACAAACAACTTATTAAAAATGG - Intergenic
1080342708 11:31285511-31285533 CACACATAAATTAGTAACTATGG - Intronic
1081053297 11:38373941-38373963 TACACCTAACTTACTGAACATGG - Intergenic
1082626181 11:55489069-55489091 CACATATACCTTATTAGAAAGGG - Intergenic
1082707279 11:56508013-56508035 CCAACATCATTTATTAAACAGGG + Intergenic
1086015628 11:82163410-82163432 CACACATAAGTTTGTAAAGATGG - Intergenic
1086029108 11:82332244-82332266 TATACATAACTTTTTAAAAATGG - Intergenic
1086347360 11:85910621-85910643 CAGACATAACTAAGAAAACATGG - Intronic
1086965896 11:93027920-93027942 CATACATTACTTATTAGTCAGGG - Intergenic
1087700064 11:101426544-101426566 CACAGCTAACACATTAAACAGGG - Intergenic
1088000940 11:104879629-104879651 CAACCATAATTTATTAGACATGG + Intergenic
1090136024 11:124200171-124200193 CATACCTAACTTATTCCACATGG - Intergenic
1092703688 12:11261222-11261244 CATACACCATTTATTAAACAGGG - Intergenic
1092747040 12:11682808-11682830 CCAACACAACTTATTAAATAGGG + Intronic
1093178282 12:15937854-15937876 AACACATAACTTAATGAAAAAGG - Intronic
1093475525 12:19550124-19550146 CACAGATAATTAATTAAAAATGG + Intronic
1095232026 12:39750819-39750841 CCCACATCATTTATTAAATAGGG - Intronic
1095831869 12:46596520-46596542 CCAACATTACTTATTAAATAGGG + Intergenic
1097006093 12:55918942-55918964 CTCCCATAAGATATTAAACAGGG + Intronic
1098272016 12:68778351-68778373 TACAGATAACCTATTAGACAAGG - Exonic
1098662594 12:73115552-73115574 TACACATTAGTTATTAAACTGGG - Intergenic
1099902616 12:88730435-88730457 CACATATAAATTATTAAAATTGG - Intergenic
1101034719 12:100694127-100694149 CACAGATTACTTATTACAAAGGG - Intergenic
1101978038 12:109379319-109379341 CACATAGAACTTTTTAAAAATGG - Intronic
1102597253 12:114002298-114002320 GACACATAAAATATTATACACGG - Intergenic
1105228373 13:18461075-18461097 CACACCTAACATACTAAATAAGG + Intergenic
1106447243 13:29847763-29847785 CACAGATCACTCATCAAACAAGG + Intronic
1107593094 13:41929451-41929473 CACACATAATTTGTAACACAGGG - Intronic
1108216398 13:48189228-48189250 CACAGAGAAGTTATTAGACAGGG + Intergenic
1109288990 13:60450047-60450069 TACATATAAATTATTTAACATGG - Intronic
1109902361 13:68791201-68791223 CCAACAGAATTTATTAAACAGGG + Intergenic
1111064706 13:83074593-83074615 CACAGTTATCATATTAAACAAGG + Intergenic
1111147169 13:84197822-84197844 CAAACATAATTCATTAAAAATGG - Intergenic
1111213400 13:85110182-85110204 CACATATACATAATTAAACAAGG + Intergenic
1111505109 13:89179058-89179080 AACACATAAATTATGAAAAAAGG - Intergenic
1112410336 13:99157486-99157508 CAAAGATAACTGATAAAACATGG - Intergenic
1112970284 13:105253270-105253292 CACTCATATCATAGTAAACATGG - Intergenic
1112989701 13:105497195-105497217 CACATATCACTTATTTCACAAGG + Intergenic
1113187989 13:107711669-107711691 CACACAGACCTTATGGAACACGG - Intronic
1114335846 14:21689070-21689092 CCAACATCATTTATTAAACAGGG + Intergenic
1114971830 14:28040791-28040813 CCAACACCACTTATTAAACAGGG + Intergenic
1115048246 14:29024660-29024682 CCAACATAATTTATTAAACAGGG + Intergenic
1115294930 14:31814770-31814792 CCAACATCACTTATTAAATAGGG + Intronic
1115796026 14:36936487-36936509 CACACATTAGTTACCAAACATGG - Intronic
1116353583 14:43898439-43898461 CAAAGGTAACTTATTAAATAGGG + Intergenic
1116450429 14:45058798-45058820 AACAAATAATTTATAAAACAGGG - Intronic
1117284586 14:54274819-54274841 CACAAATCTCTTATTAAAGAAGG + Intergenic
1117378183 14:55134851-55134873 CACACATCTCTTTTTGAACATGG - Intronic
1120447165 14:84613676-84613698 CATCAATTACTTATTAAACATGG - Intergenic
1122453475 14:101831218-101831240 CACAGATAACATATTAAGAAGGG - Intronic
1202939411 14_KI270725v1_random:131957-131979 GACATATAACATATTAAATATGG - Intergenic
1123809740 15:23911783-23911805 CACACATAACCTATTCCAAATGG - Intergenic
1125126001 15:36221613-36221635 CAAACACCACTTATTAAATAGGG + Intergenic
1126496311 15:49294449-49294471 CACACACAAATTATTTAATAAGG - Intronic
1126504076 15:49382655-49382677 AACAGCTAACTTAATAAACAAGG + Intronic
1126861069 15:52883760-52883782 CAGGCATCACTAATTAAACATGG - Intergenic
1136902631 16:34055768-34055790 GACATATAACATATTAAATATGG + Intergenic
1137294042 16:47073212-47073234 CAGACATAACTTCTTTAGCAGGG + Intergenic
1138943182 16:61814970-61814992 CACACATTTTTTATTAAACCTGG - Intronic
1139085534 16:63580766-63580788 CAGACACAACTTAATAATCAGGG - Intergenic
1139453422 16:67050922-67050944 GACACATTCCTTATAAAACATGG + Intronic
1140568929 16:76078974-76078996 CCAACACCACTTATTAAACAAGG - Intergenic
1140840725 16:78836521-78836543 CATAGATGACTTACTAAACATGG - Intronic
1143675475 17:8429410-8429432 CACAAGAGACTTATTAAACATGG - Intronic
1143936888 17:10495429-10495451 CTCAGATAATTTATGAAACAAGG - Intronic
1144497068 17:15754381-15754403 CACACATATTTTATTAATCATGG - Intergenic
1144904564 17:18630544-18630566 CACACATATTTTATTAATCATGG + Intergenic
1146777886 17:35638317-35638339 CACATCTAATTTATTATACAGGG + Intronic
1148630723 17:49106310-49106332 TACAGATAACATACTAAACATGG - Intergenic
1149351778 17:55796274-55796296 CTCTCATAAATTTTTAAACATGG + Intronic
1149957209 17:61065032-61065054 CACACATAACTACTTGAAAATGG - Intronic
1153068977 18:1082907-1082929 CACACAACACTTTTAAAACATGG - Intergenic
1154058012 18:11030390-11030412 TACAGATAACTAATGAAACATGG - Intronic
1154525078 18:15279225-15279247 CACACCTAACATACTAAATAAGG - Intergenic
1155859752 18:30882045-30882067 CTGACATGACTTATTATACAAGG + Intergenic
1156071402 18:33215212-33215234 AAAACATAAATTATTAAACATGG + Intronic
1159341104 18:67134856-67134878 CACACAGAACATATTTAACCTGG - Intergenic
1162660707 19:12166799-12166821 CAAACATGAGTCATTAAACATGG + Intronic
1164142099 19:22479865-22479887 CACAGTTAACATACTAAACATGG - Intronic
1167149504 19:47700870-47700892 TATACATAACTTTTTAAAAATGG - Intronic
1168606798 19:57766603-57766625 CCCAGATATCTAATTAAACATGG + Intergenic
1168653336 19:58108201-58108223 CACACATAACTTATTAAACATGG - Intronic
1168674834 19:58270033-58270055 CACCCATAACTTAAAAAAAAAGG + Intronic
927124563 2:20002187-20002209 CACACAGAGCTAATGAAACAAGG + Intronic
928880840 2:36094695-36094717 CCCACACCATTTATTAAACAGGG - Intergenic
929022849 2:37570918-37570940 CACACAACACTCACTAAACATGG + Intergenic
930158979 2:48133805-48133827 CTCACATAAGTGATTAAAGATGG + Intergenic
932378378 2:71259014-71259036 CACACAGAAATTACTAAACCAGG + Intergenic
933325339 2:80828984-80829006 CAGACATAACTCTTTAAGCAAGG - Intergenic
935299829 2:101684567-101684589 TTCACATAACTTAATGAACATGG + Intergenic
935428545 2:102947276-102947298 CTCACATAATTTATTGAACTTGG + Intergenic
936579619 2:113686608-113686630 TACACTTAATTTATTAAAAATGG - Intergenic
936734399 2:115423435-115423457 CACACATATCATATAAAACATGG - Intronic
938524276 2:132111352-132111374 CACACCTAACATACTAAATAAGG - Intergenic
940078377 2:149770249-149770271 CATACATAACTTCTTAATAAGGG - Intergenic
940389140 2:153110935-153110957 CACACATAAGTGATTTAACCAGG - Intergenic
948249739 2:236516770-236516792 GACTTATGACTTATTAAACAGGG - Intergenic
1169846691 20:10000957-10000979 AACACATATCCTATAAAACATGG + Intronic
1169959892 20:11147939-11147961 CCAACATCACTTATTAAATAGGG + Intergenic
1170383954 20:15795641-15795663 CACACATATCTTAATAAATCGGG - Intronic
1171110673 20:22478938-22478960 CCAGCACAACTTATTAAACAGGG - Intergenic
1174505889 20:51017352-51017374 CACACATTACATATTTTACAAGG + Intronic
1174951280 20:55043543-55043565 AAAAAATAAATTATTAAACATGG + Intergenic
1175651847 20:60731735-60731757 CAAACATAACGTATTCAACCAGG - Intergenic
1176583783 21:8555254-8555276 GACATATAACATATTAAATATGG + Intergenic
1176772354 21:13089257-13089279 CACACCTAACATACTAAATAAGG + Intergenic
1177019307 21:15833555-15833577 CAAACACAACTTAATAAAAATGG - Intronic
1177382784 21:20367124-20367146 CATACATCACATATCAAACAAGG + Intergenic
1178183207 21:30188276-30188298 CACACCTAAAATATTAAATAAGG - Intergenic
1178784992 21:35645421-35645443 CCAACATCACTTATTAAATAGGG + Intronic
1179306612 21:40159273-40159295 GATACATAAGTTAGTAAACAGGG - Intronic
1180266593 22:10532166-10532188 GACATATAACATATTAAATATGG + Intergenic
1180334720 22:11566998-11567020 CCAACATGATTTATTAAACAAGG + Intergenic
1180519380 22:16182950-16182972 CACACCTAACATACTAAATAAGG + Intergenic
1183410097 22:37649942-37649964 CAGACATCACTAATTAATCAAGG - Intronic
950728281 3:14933877-14933899 CTAACATAACTTATTAAAGGAGG + Exonic
951501033 3:23387632-23387654 CACACACAAATAATTAAAGATGG - Intronic
951631856 3:24730572-24730594 CACACATAGCTCATTCAAAAAGG - Intergenic
952541019 3:34367934-34367956 CACAAATAACTTCTGAAACATGG - Intergenic
952608189 3:35174509-35174531 TACACATCACTTATTGAAAAGGG + Intergenic
952768677 3:36977340-36977362 GATACATTAGTTATTAAACAAGG + Intergenic
953118640 3:40017213-40017235 CAAACATTACTAATCAAACAAGG + Intronic
957532821 3:81462155-81462177 GACACAGAACTGGTTAAACATGG - Intergenic
960422711 3:117467003-117467025 CCCACATAACCAATTAGACAAGG + Intergenic
963184742 3:142401725-142401747 AACACATAACTTCTTGACCAAGG + Intronic
963344701 3:144081031-144081053 CTCCCATTACTTATTAAATAGGG + Intergenic
964281942 3:155077321-155077343 CATACATAAGTTATTAAGAATGG - Intronic
964516828 3:157519718-157519740 CACACACAACTTAGCATACAAGG - Intronic
965194970 3:165582374-165582396 CACATTTAATTTATTAAAAATGG - Intergenic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
966749896 3:183312253-183312275 CAAACTTAAATAATTAAACAAGG - Intronic
967395231 3:189001032-189001054 TACACATAACATATTAAATGAGG - Intronic
967552534 3:190814391-190814413 CACACTAAATTTATTAAAAATGG + Intergenic
967660460 3:192102479-192102501 CACCCCTACCATATTAAACAAGG + Intergenic
971051882 4:22871087-22871109 CAGACATACCATTTTAAACATGG - Intergenic
971559818 4:28063760-28063782 CTCTCATCACTTATTAAAGAGGG + Intergenic
972952634 4:44347195-44347217 CTATCATAGCTTATTAAACATGG + Intronic
974396557 4:61343462-61343484 CACACATCACTTTTGATACAGGG - Intronic
974485770 4:62503947-62503969 CACAAATAATTTTTTATACATGG + Intergenic
974631968 4:64503600-64503622 CACACATCATTTATTAGATAGGG - Intergenic
974685818 4:65227202-65227224 CACACATAAATTAAGAATCAAGG + Intergenic
975022946 4:69513317-69513339 CCCACATCATTTATTAAATAGGG + Intronic
976744164 4:88387056-88387078 CACACATAAAACATTTAACATGG - Intronic
977744258 4:100526563-100526585 AACTCATAACTAATTAAACCTGG + Intronic
978035508 4:103987820-103987842 GACAAATAACTGATTAAAAATGG + Intergenic
979265671 4:118699341-118699363 CACAGATAACACTTTAAACAGGG - Intronic
979307425 4:119163183-119163205 CACAAATAACTGTTTAGACATGG + Intronic
980053510 4:128060287-128060309 CACAGATAATTTATTTAACAAGG + Intergenic
980075050 4:128286707-128286729 CCCACATACCTTGTTAATCATGG + Intronic
980660266 4:135848801-135848823 CAAACACAATTTATTAAATAGGG - Intergenic
980868225 4:138579147-138579169 CACAGCTAACATATTGAACAGGG + Intergenic
981772434 4:148325647-148325669 CATACATAATTTATTCACCAGGG + Intronic
982638746 4:157929731-157929753 CACTCATACCTTATAGAACAGGG + Intergenic
983038129 4:162892453-162892475 CACACATATCTAACTTAACAAGG + Intergenic
983303905 4:165961727-165961749 CACACACCACTTATTTAATAAGG - Intronic
983630457 4:169844232-169844254 CACACACATCTTAATAAACGAGG - Intergenic
984005203 4:174297831-174297853 CACACATAACTTGCTCAGCAAGG - Intronic
984525713 4:180857103-180857125 CAAACATCATTTATTAAATAGGG + Intergenic
986136581 5:4985492-4985514 CACACACCACGTATTAATCAGGG - Intergenic
987481057 5:18458599-18458621 CACACAAATCTTATAAAATATGG + Intergenic
987965998 5:24873774-24873796 AACATGTAACTTATAAAACAAGG + Intergenic
987973226 5:24977940-24977962 CCCCCACAATTTATTAAACAGGG + Intergenic
988021972 5:25632387-25632409 CCCACAAAATTTATTAAATAGGG - Intergenic
988823643 5:34913030-34913052 TAGACATAACTTATAAAATATGG + Intronic
990047687 5:51454709-51454731 CACAAATAAATTATTTTACAAGG - Intergenic
991150564 5:63362949-63362971 CACACAGAACTTATTTAGAACGG + Intergenic
992291855 5:75287580-75287602 CCAACACCACTTATTAAACAGGG + Intergenic
993886016 5:93416110-93416132 CCCACACAGCTTATGAAACAGGG + Intergenic
996313483 5:122134555-122134577 CAAACATAAATGAATAAACATGG + Intronic
997095426 5:130905163-130905185 CACAAATAACATATTCAACAAGG + Intergenic
997244632 5:132336967-132336989 AACACATAATTTATTTAACCAGG + Intronic
998663567 5:144268447-144268469 CACAAATAACTTTATATACAGGG + Intronic
999533000 5:152483156-152483178 CCCACATCATTTATTAAATAGGG - Intergenic
999700103 5:154220118-154220140 CGTACATAATTTTTTAAACATGG + Intronic
999851122 5:155540654-155540676 CACACACACGTTATTAAAGACGG + Intergenic
1003792701 6:9565002-9565024 CACACTTAACCAATAAAACAGGG - Intergenic
1004309321 6:14530431-14530453 CACTCAAAACTTATCTAACAGGG - Intergenic
1005881310 6:30063003-30063025 CACACATGACTTAGAGAACATGG + Intronic
1007451873 6:41946266-41946288 CACAACTAACTTTTTAAAAAAGG - Intronic
1008102560 6:47407684-47407706 CACACACAACTTAATCAAGAGGG + Intergenic
1008165140 6:48128170-48128192 AACAAATAACTTAGTAAAAAAGG + Intergenic
1008194586 6:48502827-48502849 CAAACATCATTTATTAAACAGGG - Intergenic
1009535710 6:64880890-64880912 CACACATAATATATAAAATAAGG - Intronic
1009540134 6:64944305-64944327 CACTCATAAATTATTTATCAAGG - Intronic
1012839982 6:104317920-104317942 CAGACATCCCTAATTAAACAAGG + Intergenic
1012949264 6:105500797-105500819 CAGGCATTACTTATTAAACTGGG - Intergenic
1013058777 6:106611576-106611598 CACACATGACTTTTAAATCACGG + Intronic
1013305065 6:108840112-108840134 CACACAACACGTATCAAACAAGG - Intergenic
1013400725 6:109793917-109793939 CACACAGTACTTATTCATCATGG + Intronic
1014782352 6:125578850-125578872 CACACAGATCTTCTTCAACAAGG - Intergenic
1015202543 6:130599515-130599537 CATATATACCTTATAAAACAAGG + Intergenic
1018204225 6:161422101-161422123 CACATAAAACTTATTAGCCAAGG + Intronic
1019683546 7:2366920-2366942 CACACCTAACTTTTTACAAAAGG - Intronic
1021022345 7:15617933-15617955 GACAAATAACATATTGAACAAGG + Intronic
1021357507 7:19670091-19670113 CAAACAATACTTATTAAATAAGG + Intergenic
1021547854 7:21835644-21835666 CACAGCTAACATATTAAACAGGG + Intronic
1022114010 7:27247238-27247260 CACACATCACTTGCTAATCAGGG - Intergenic
1023084825 7:36559966-36559988 CCCACATCATTTATTGAACAGGG + Intronic
1024047878 7:45597374-45597396 AAAACATAACTTATCAAACGGGG - Intronic
1025994812 7:66521323-66521345 CACACAGAATTTAATAGACAGGG + Intergenic
1026495253 7:70896245-70896267 TCCACATAAATTATGAAACATGG - Intergenic
1026986434 7:74557970-74557992 CACACAGAATTTAATAGACAAGG + Intronic
1027742537 7:82028984-82029006 CACACAGAACTTTTAAAACTTGG - Intronic
1028045382 7:86110846-86110868 CAAACAGAACTTAGAAAACAAGG + Intergenic
1028459613 7:91076407-91076429 CCAGCATCACTTATTAAACAGGG - Intronic
1028997290 7:97115449-97115471 AACACAGAACTTTTTAAAAATGG - Intergenic
1029894511 7:103968265-103968287 CACAAATGACTTGTCAAACATGG + Intronic
1031717211 7:125124185-125124207 CAAACATCATTTATTAAATAGGG + Intergenic
1031795348 7:126167702-126167724 CTCACAGAACATATAAAACACGG + Intergenic
1034606263 7:152318677-152318699 CACAAATGACATATAAAACAAGG + Intronic
1037830234 8:22183874-22183896 CACACATAAAGAATTTAACATGG - Intronic
1043035999 8:75200315-75200337 CACACACAAATTAACAAACACGG - Intergenic
1043646785 8:82531300-82531322 CAAACATCATTTATTAAATAGGG + Intergenic
1045855091 8:106755968-106755990 TACATATTACTTATTACACAAGG - Intergenic
1047101943 8:121686380-121686402 CACATATAAGTGATAAAACATGG - Intergenic
1050993672 9:12185635-12185657 AACACAGACCTTATTACACAAGG + Intergenic
1051134949 9:13909754-13909776 CACACATATCTTTTCAAAAAGGG + Intergenic
1052196991 9:25729644-25729666 CACACAAAACATAGAAAACAAGG + Intergenic
1052640660 9:31162851-31162873 CTCACAGATCTTATTCAACAGGG - Intergenic
1053272209 9:36758165-36758187 CACACACAGCTTTTTAAAGAAGG + Intergenic
1054968057 9:71052469-71052491 CACACATAGCTAATTGAATATGG - Intronic
1058298426 9:103339171-103339193 CACAAATAATTTGTTAAAGAGGG + Intergenic
1058455386 9:105133505-105133527 CAAACTTAACTAATCAAACATGG - Intergenic
1059217916 9:112583764-112583786 CACACACACTTAATTAAACATGG + Intronic
1061078968 9:128358745-128358767 TACATTTAAATTATTAAACAAGG - Intronic
1203580451 Un_KI270745v1:39899-39921 CACACATAGCTGGTCAAACACGG + Intergenic
1203613743 Un_KI270749v1:33108-33130 GACATATAACATATTAAATATGG + Intergenic
1186329459 X:8516791-8516813 CACACAAAAGTTTTTAAAAAGGG - Intergenic
1187475369 X:19606139-19606161 TGCACATAAATTCTTAAACATGG - Intronic
1190065077 X:47233936-47233958 CACAGAAAACCAATTAAACATGG - Intronic
1190318719 X:49166871-49166893 CACACATAAATTATTGTGCATGG + Intronic
1190693199 X:52929509-52929531 CCAACATAATTTATTAAACAGGG - Intronic
1191942331 X:66494454-66494476 CCAACACCACTTATTAAACAGGG - Intergenic
1193192026 X:78582112-78582134 AACATATAACTTATAAAAAATGG + Intergenic
1193898368 X:87143215-87143237 TACACATTACATATTAAAAAGGG - Intergenic
1193929693 X:87537712-87537734 CACAGATAACTAAATAAATATGG - Intronic
1194837033 X:98694380-98694402 CAAACACAATTTATTAAATAGGG + Intergenic
1197386259 X:125806671-125806693 AACACAGAACATATGAAACAGGG - Intergenic
1197479875 X:126969355-126969377 CAATCATAATTTATTAAATAGGG - Intergenic
1199280922 X:145998308-145998330 TTCACATAACTTATGAAATAAGG - Intergenic
1199282494 X:146018714-146018736 CTCATATAACTTTTTAAATAAGG - Intergenic
1200881898 Y:8223060-8223082 CCCACATCATTTATTAAATAGGG - Intergenic