ID: 1168658888

View in Genome Browser
Species Human (GRCh38)
Location 19:58150690-58150712
Sequence TTTCCTGCGGAGGGAAGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 121}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168658888_1168658899 18 Left 1168658888 19:58150690-58150712 CCAAGACTTCCCTCCGCAGGAAA 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1168658899 19:58150731-58150753 CAGGGATGCGTCGGCACTTACGG 0: 1
1: 0
2: 0
3: 4
4: 30
1168658888_1168658901 25 Left 1168658888 19:58150690-58150712 CCAAGACTTCCCTCCGCAGGAAA 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1168658901 19:58150738-58150760 GCGTCGGCACTTACGGTTGGCGG 0: 1
1: 0
2: 0
3: 1
4: 12
1168658888_1168658900 22 Left 1168658888 19:58150690-58150712 CCAAGACTTCCCTCCGCAGGAAA 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1168658900 19:58150735-58150757 GATGCGTCGGCACTTACGGTTGG 0: 1
1: 0
2: 0
3: 0
4: 13
1168658888_1168658897 0 Left 1168658888 19:58150690-58150712 CCAAGACTTCCCTCCGCAGGAAA 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1168658897 19:58150713-58150735 CGGAGGCAGCGCAGGGCTCAGGG 0: 1
1: 0
2: 0
3: 23
4: 278
1168658888_1168658895 -7 Left 1168658888 19:58150690-58150712 CCAAGACTTCCCTCCGCAGGAAA 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1168658895 19:58150706-58150728 CAGGAAACGGAGGCAGCGCAGGG 0: 1
1: 0
2: 3
3: 25
4: 322
1168658888_1168658902 29 Left 1168658888 19:58150690-58150712 CCAAGACTTCCCTCCGCAGGAAA 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1168658902 19:58150742-58150764 CGGCACTTACGGTTGGCGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 12
1168658888_1168658898 9 Left 1168658888 19:58150690-58150712 CCAAGACTTCCCTCCGCAGGAAA 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1168658898 19:58150722-58150744 CGCAGGGCTCAGGGATGCGTCGG 0: 1
1: 0
2: 3
3: 9
4: 145
1168658888_1168658896 -1 Left 1168658888 19:58150690-58150712 CCAAGACTTCCCTCCGCAGGAAA 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1168658896 19:58150712-58150734 ACGGAGGCAGCGCAGGGCTCAGG 0: 1
1: 0
2: 3
3: 23
4: 348
1168658888_1168658894 -8 Left 1168658888 19:58150690-58150712 CCAAGACTTCCCTCCGCAGGAAA 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1168658894 19:58150705-58150727 GCAGGAAACGGAGGCAGCGCAGG 0: 1
1: 0
2: 9
3: 25
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168658888 Original CRISPR TTTCCTGCGGAGGGAAGTCT TGG (reversed) Intronic
900195567 1:1374023-1374045 GTTCCTGCGGAGGAAGGTCCAGG - Exonic
904301483 1:29557395-29557417 TTCCCTGAGGAGGGAGCTCTGGG + Intergenic
906233396 1:44185449-44185471 TTACTTGTGGAAGGAAGTCTTGG - Intergenic
906707214 1:47903573-47903595 TTTCCTGCGGGGTGGAGTCAAGG + Intronic
907455343 1:54571989-54572011 TTTCCTGGGGCAGGAAGTCCTGG + Intronic
910288865 1:85581109-85581131 TTTCCTGCCGTGGGCAATCTGGG - Intronic
915563979 1:156703803-156703825 GTTCCTGCAGAGGCAAGGCTGGG + Intronic
916832564 1:168508035-168508057 TTACCTGGGGAGGGAATTCAGGG - Intergenic
920439605 1:205970745-205970767 TTTCCTGTAGAAGGACGTCTAGG + Intergenic
923966202 1:239141836-239141858 TTTCATGCTTAGGGACGTCTTGG + Intergenic
924800967 1:247329536-247329558 TTTCCTTCGGAGCCAAGACTCGG + Exonic
1064455932 10:15487518-15487540 TTTCATGGGGAGGGAAGAATGGG + Intergenic
1065204953 10:23348290-23348312 CTTACTGCTGAGGGAAGTTTGGG + Intergenic
1065279764 10:24123393-24123415 TTTTCTACTGAGGGAAGTGTGGG + Intronic
1070959739 10:80490275-80490297 TGTCCTGGAGATGGAAGTCTTGG + Intronic
1073284584 10:102380000-102380022 TTTCCCGAGGAGGGAAGCCAGGG + Intronic
1074746745 10:116542046-116542068 TTTTCTGCTCAGGGAAGTTTGGG + Intergenic
1076042023 10:127258538-127258560 TTTCCTGTTGAAGGACGTCTGGG + Intronic
1078307143 11:10200939-10200961 TTTCCTGAGGATAAAAGTCTTGG + Intronic
1078323700 11:10360464-10360486 TTTCCTGGGCAGAGAACTCTAGG - Intronic
1080542873 11:33285620-33285642 TTTCCTCCTGAGGCAATTCTTGG + Intronic
1081931832 11:46876827-46876849 TTTCCTGGAGAGGGAAAGCTTGG + Exonic
1086186548 11:84024151-84024173 TTTCCTGCAAAGAGAAGTCTAGG + Intronic
1086426745 11:86692060-86692082 TTTTCTGCAGAGGGAAGCCTGGG + Intergenic
1091177544 11:133575363-133575385 TTGGCTGCTGAGGGAGGTCTTGG + Intergenic
1091603958 12:1934956-1934978 TGTCCTGCGGAGGGGAGGCGGGG - Intergenic
1092133401 12:6128416-6128438 TTCCTTCTGGAGGGAAGTCTGGG + Intergenic
1094298806 12:28938075-28938097 TTTAATGCGGAGGGAAGGCAGGG - Intergenic
1096426369 12:51507229-51507251 TTTCCTTCGGAGGAAAATCCAGG + Intronic
1097293693 12:57941588-57941610 TTCCCTGCGGAGGGAGGGCCTGG + Exonic
1099507950 12:83501430-83501452 TTTCATTAGGAGGGAAATCTGGG - Intergenic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1106145464 13:27045966-27045988 TTTCCTACGGATGAAAGTTTAGG - Intergenic
1106778608 13:33032893-33032915 TTTCTTGCTGAGGGAAATCAAGG - Intronic
1108071625 13:46634842-46634864 TTTCCTGGGGCGGGAAGGGTTGG + Intronic
1109137249 13:58668699-58668721 TTTCCTGCACAGGTAAGTTTAGG - Intergenic
1113367445 13:109689719-109689741 TTTCTTGAGGAGGGATTTCTAGG - Intergenic
1114719735 14:24868508-24868530 TTTCCTGCTGAGGGACATTTGGG - Intronic
1115697045 14:35910311-35910333 TTTCTTGAGAATGGAAGTCTAGG + Intronic
1115757493 14:36543993-36544015 TTTCCTGGGGAGGGGTGCCTTGG + Intergenic
1115768774 14:36648643-36648665 TTTCCCACGGAGGGAAGGGTTGG - Intergenic
1117671699 14:58114193-58114215 TTTCCTTCTGTGGGAAGTCAGGG + Intronic
1122998649 14:105279799-105279821 TTTCCTGTTGATGGACGTCTAGG - Intronic
1128992418 15:72272270-72272292 TTTCCTGGGGAGGCAGGTGTTGG - Intronic
1132180892 15:99752243-99752265 TTTCTTGTGGAAGGAAGTCCCGG + Intergenic
1133893801 16:9906376-9906398 TTTCCAGTGGAGGGAGGTGTAGG - Intronic
1137569014 16:49552551-49552573 ATTACTGCAGAGGGAAATCTCGG + Intronic
1141984812 16:87572827-87572849 CTTCCTGGGGAGGGGAGTGTGGG - Intergenic
1142121697 16:88389737-88389759 TTCCCTGAGTAGGGAAGTCAAGG + Intergenic
1161121760 19:2530940-2530962 TTTCCTGAGGAGAGAAGGCTTGG + Intronic
1162132669 19:8536696-8536718 ATTCATGCTGAGGGAAGTTTGGG + Intronic
1163469671 19:17488989-17489011 TTTCCTGCAGAGGGTGGCCTTGG - Exonic
1165582202 19:36876323-36876345 TTTCCTGGGGTGGGAAATCTGGG - Intronic
1167913915 19:52725217-52725239 GTGACTGCGGAGGGAAGACTTGG + Intronic
1168658888 19:58150690-58150712 TTTCCTGCGGAGGGAAGTCTTGG - Intronic
925352952 2:3215053-3215075 GTTCCTGGGGCGGGAAGTCCAGG - Intronic
925694888 2:6566280-6566302 TTTGCTCTGGAGGCAAGTCTAGG - Intergenic
927065785 2:19469522-19469544 TTTCTTGCTTAGGGAATTCTAGG + Intergenic
928606511 2:32948324-32948346 TTTCCTGGGGTGGGGTGTCTTGG + Intronic
929976867 2:46643624-46643646 TTTCCTGTTGCGGGAAGTCAGGG - Intergenic
932306260 2:70705918-70705940 TTTGGTGAGGAGGGAAGACTGGG + Intronic
933689762 2:85170880-85170902 TTTCCTGCCTAGGGACATCTTGG + Intronic
934479774 2:94625398-94625420 ATTCCTGAGGTAGGAAGTCTGGG + Intergenic
934544750 2:95205704-95205726 TCTCCTGCGGAAGGAAGAGTGGG + Intergenic
937558863 2:123195137-123195159 TTTCCTGTGAAAGGAAGACTTGG + Intergenic
937668283 2:124512072-124512094 TTTCCTGCAGAGAGAAATCCAGG + Intronic
941490020 2:166132034-166132056 TTTCCTGCGGTGGGAAGAGAGGG - Intergenic
947546775 2:231015904-231015926 TCTCCTGCCCAGGGAAATCTTGG - Intronic
949056298 2:241929645-241929667 TTTCCTGAGTTGGGAGGTCTGGG + Intergenic
1173357322 20:42306249-42306271 TTACCTAAGGAGAGAAGTCTGGG + Intronic
1176197635 20:63844687-63844709 TTTCCTGAGGAAGGAAGGGTGGG + Intergenic
1176816685 21:13609970-13609992 TTTCCTTCGGAGGGGGGGCTTGG + Intronic
1178943789 21:36929305-36929327 TTTCCTGGGGATGGAGGGCTGGG - Intronic
1179172810 21:38985809-38985831 TGTCCTGCGGCGGGAAGGCCTGG + Intergenic
1179548121 21:42125689-42125711 TTCCCTGGTGAGGGAGGTCTGGG + Intronic
949566372 3:5248818-5248840 TCTTCTTCGGAGGAAAGTCTTGG - Intergenic
952000702 3:28782484-28782506 TTTCCGGCAGAGGGGAGACTGGG + Intergenic
954432711 3:50479760-50479782 TTCCAAGCAGAGGGAAGTCTGGG - Intronic
954689481 3:52388148-52388170 TGTCCTGAGGTGGGAAGCCTGGG - Exonic
961717268 3:128866381-128866403 TTTGCTGGGGATGGAAGTCACGG - Intergenic
961750498 3:129091343-129091365 TTCCCTGCGGAGGAAAGCCGGGG + Exonic
963204776 3:142621794-142621816 TTTCCTGTGAAGTGAAGTCCTGG + Intronic
964487580 3:157201735-157201757 TTTCATGCTGTGGGAATTCTCGG - Intergenic
966038691 3:175452895-175452917 TTTCCTGGGGAGTGCAGGCTGGG + Intronic
973319764 4:48798212-48798234 TATCCTGCATAGTGAAGTCTGGG + Intergenic
973949618 4:55998472-55998494 TTTCCTGCAGATTGAAGACTTGG - Intronic
977780072 4:100970643-100970665 TTTCCTGCGGAAGGAGGTAAGGG - Intergenic
982637828 4:157919324-157919346 TTTACTACAGAGGGAAGACTTGG + Intergenic
985354468 4:189102953-189102975 GTTCCTTCGAAGGGAAGTCCAGG + Intergenic
985697311 5:1347885-1347907 TTTCCTGGGGAGGAAGGTGTTGG + Intergenic
986336936 5:6762395-6762417 TCCCCTGCGGGTGGAAGTCTTGG + Intergenic
986717661 5:10535494-10535516 TTTCCTGAGAAGGGACGTCAAGG - Intergenic
989842607 5:46098619-46098641 TTTCCTGAGGAGTGAAATATAGG + Intergenic
992894685 5:81235774-81235796 TTTAATGCGGAGGGCAGTGTAGG + Intronic
997469434 5:134108673-134108695 TGTCCTGGGGAGGGAATACTTGG + Intergenic
999781095 5:154851003-154851025 TTTCCTGTGGAGGGCAGGCAAGG + Intronic
1000344446 5:160302968-160302990 TCTTCTGCGGAGGGAAATTTGGG + Intronic
1001410593 5:171508874-171508896 TTGCCTCTGGAGGGAACTCTGGG - Intergenic
1002074150 5:176698177-176698199 CTGCCTCCGGAGGCAAGTCTGGG + Intergenic
1002629091 5:180557139-180557161 TTACCTGCTGAAGGAAATCTGGG + Intronic
1003088530 6:3081487-3081509 TTTCCAGAGGAGGAGAGTCTTGG - Intronic
1003125641 6:3353765-3353787 CTTCCTGAGGAGGGAGCTCTTGG - Intronic
1006889817 6:37416984-37417006 TTTCCTGGGTATGGAATTCTTGG + Intergenic
1009250772 6:61295128-61295150 TTTCCTGTGAAAGGAAGTTTGGG - Intergenic
1012475334 6:99610285-99610307 CTTCCTGTGGAAAGAAGTCTAGG + Intronic
1022795251 7:33726948-33726970 TTTCCTGCTGAGGGAAATGGTGG + Intronic
1027607473 7:80318220-80318242 TTTCTTGCAGAGACAAGTCTAGG - Intergenic
1029624901 7:101714552-101714574 TTTCCTGGGCTGGGATGTCTAGG - Intergenic
1034691075 7:153014213-153014235 TTTCCTGCTGATGGACGTTTGGG + Intergenic
1036788932 8:11704978-11705000 TGGCCGGCGGAGGGAAGTCACGG - Intronic
1038266178 8:26041349-26041371 TTTTCTGCCAAGGGAAGCCTTGG - Intronic
1041847010 8:62340707-62340729 ATTCCTGCTGAGGGCAGGCTAGG + Intronic
1044582696 8:93837978-93838000 CTTCCCGAGGAGGGAAGTCCAGG - Intergenic
1045102462 8:98859233-98859255 TTTCCTGAGGAAGCAATTCTGGG + Intronic
1048457049 8:134587697-134587719 TTGCCTGTGAAGGGAAGTGTGGG - Intronic
1053678060 9:40458197-40458219 ATTCCTGAGGCAGGAAGTCTGGG - Intergenic
1053927981 9:43086227-43086249 ATTCCTGAGGTAGGAAGTCTGGG - Intergenic
1054285672 9:63166743-63166765 ATTCCTGAGGCAGGAAGTCTGGG + Intergenic
1054291132 9:63293734-63293756 ATTCCTGAGGCAGGAAGTCTGGG - Intergenic
1054389151 9:64598269-64598291 ATTCCTGAGGCAGGAAGTCTGGG - Intergenic
1054506565 9:65918101-65918123 ATTCCTGAGGCAGGAAGTCTGGG + Intergenic
1056404709 9:86262563-86262585 TTTCCTGCTGAGTGAAACCTAGG + Intergenic
1056782989 9:89565107-89565129 TTTCCTGCCATGGGAAGTCTGGG - Intergenic
1059022220 9:110589264-110589286 TTTCCTGTTGAGGGAAGTCAGGG + Intergenic
1059212323 9:112525135-112525157 TCTCCTGTGGAGGGAATTCTGGG - Intronic
1062015879 9:134291207-134291229 TCTCCTGCATAGAGAAGTCTGGG - Intergenic
1189848291 X:45156293-45156315 TGTACCGCGGAGGGAAGTCCTGG + Intronic
1190057983 X:47193146-47193168 TTTGCTGGGCAGGGCAGTCTTGG + Intronic
1199720456 X:150539701-150539723 TTTCCTTCCCAGAGAAGTCTGGG - Intergenic