ID: 1168660308

View in Genome Browser
Species Human (GRCh38)
Location 19:58160498-58160520
Sequence CAAAAACGGGCCAGGCGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168660303_1168660308 12 Left 1168660303 19:58160463-58160485 CCAGCCTGGGCAACAGAGTGAGA 0: 21776
1: 73212
2: 167026
3: 221294
4: 302558
Right 1168660308 19:58160498-58160520 CAAAAACGGGCCAGGCGCCGTGG No data
1168660302_1168660308 22 Left 1168660302 19:58160453-58160475 CCATTGCACTCCAGCCTGGGCAA 0: 36772
1: 108043
2: 179343
3: 213379
4: 164443
Right 1168660308 19:58160498-58160520 CAAAAACGGGCCAGGCGCCGTGG No data
1168660304_1168660308 8 Left 1168660304 19:58160467-58160489 CCTGGGCAACAGAGTGAGACTGT 0: 988
1: 10645
2: 41908
3: 101046
4: 181313
Right 1168660308 19:58160498-58160520 CAAAAACGGGCCAGGCGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168660308 Original CRISPR CAAAAACGGGCCAGGCGCCG TGG Intergenic
No off target data available for this crispr