ID: 1168663003

View in Genome Browser
Species Human (GRCh38)
Location 19:58182663-58182685
Sequence GTCCACTCAAGGTCAGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168663003_1168663013 10 Left 1168663003 19:58182663-58182685 CCCCTCCCTGACCTTGAGTGGAC No data
Right 1168663013 19:58182696-58182718 GTCCACCCTCACTTTCAGGCAGG No data
1168663003_1168663011 6 Left 1168663003 19:58182663-58182685 CCCCTCCCTGACCTTGAGTGGAC No data
Right 1168663011 19:58182692-58182714 CCCTGTCCACCCTCACTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168663003 Original CRISPR GTCCACTCAAGGTCAGGGAG GGG (reversed) Intergenic
No off target data available for this crispr