ID: 1168663013

View in Genome Browser
Species Human (GRCh38)
Location 19:58182696-58182718
Sequence GTCCACCCTCACTTTCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168663007_1168663013 4 Left 1168663007 19:58182669-58182691 CCTGACCTTGAGTGGACACTTGG No data
Right 1168663013 19:58182696-58182718 GTCCACCCTCACTTTCAGGCAGG No data
1168662997_1168663013 30 Left 1168662997 19:58182643-58182665 CCGGTCCTCCGAGTTTCCCTCCC No data
Right 1168663013 19:58182696-58182718 GTCCACCCTCACTTTCAGGCAGG No data
1168663005_1168663013 8 Left 1168663005 19:58182665-58182687 CCTCCCTGACCTTGAGTGGACAC No data
Right 1168663013 19:58182696-58182718 GTCCACCCTCACTTTCAGGCAGG No data
1168663003_1168663013 10 Left 1168663003 19:58182663-58182685 CCCCTCCCTGACCTTGAGTGGAC No data
Right 1168663013 19:58182696-58182718 GTCCACCCTCACTTTCAGGCAGG No data
1168663006_1168663013 5 Left 1168663006 19:58182668-58182690 CCCTGACCTTGAGTGGACACTTG No data
Right 1168663013 19:58182696-58182718 GTCCACCCTCACTTTCAGGCAGG No data
1168663009_1168663013 -1 Left 1168663009 19:58182674-58182696 CCTTGAGTGGACACTTGGCCCTG No data
Right 1168663013 19:58182696-58182718 GTCCACCCTCACTTTCAGGCAGG No data
1168662999_1168663013 22 Left 1168662999 19:58182651-58182673 CCGAGTTTCCCTCCCCTCCCTGA No data
Right 1168663013 19:58182696-58182718 GTCCACCCTCACTTTCAGGCAGG No data
1168663001_1168663013 13 Left 1168663001 19:58182660-58182682 CCTCCCCTCCCTGACCTTGAGTG No data
Right 1168663013 19:58182696-58182718 GTCCACCCTCACTTTCAGGCAGG No data
1168663004_1168663013 9 Left 1168663004 19:58182664-58182686 CCCTCCCTGACCTTGAGTGGACA No data
Right 1168663013 19:58182696-58182718 GTCCACCCTCACTTTCAGGCAGG No data
1168663000_1168663013 14 Left 1168663000 19:58182659-58182681 CCCTCCCCTCCCTGACCTTGAGT No data
Right 1168663013 19:58182696-58182718 GTCCACCCTCACTTTCAGGCAGG No data
1168662998_1168663013 25 Left 1168662998 19:58182648-58182670 CCTCCGAGTTTCCCTCCCCTCCC No data
Right 1168663013 19:58182696-58182718 GTCCACCCTCACTTTCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168663013 Original CRISPR GTCCACCCTCACTTTCAGGC AGG Intergenic
No off target data available for this crispr