ID: 1168665076

View in Genome Browser
Species Human (GRCh38)
Location 19:58198888-58198910
Sequence GCACCCATCCCTGTCTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168665076_1168665078 4 Left 1168665076 19:58198888-58198910 CCATTAAAGACAGGGATGGGTGC No data
Right 1168665078 19:58198915-58198937 GCTCACCCATCTCAGCACCTTGG No data
1168665076_1168665085 18 Left 1168665076 19:58198888-58198910 CCATTAAAGACAGGGATGGGTGC No data
Right 1168665085 19:58198929-58198951 GCACCTTGGGAGGGTGAAGTGGG No data
1168665076_1168665082 9 Left 1168665076 19:58198888-58198910 CCATTAAAGACAGGGATGGGTGC No data
Right 1168665082 19:58198920-58198942 CCCATCTCAGCACCTTGGGAGGG No data
1168665076_1168665084 17 Left 1168665076 19:58198888-58198910 CCATTAAAGACAGGGATGGGTGC No data
Right 1168665084 19:58198928-58198950 AGCACCTTGGGAGGGTGAAGTGG No data
1168665076_1168665080 8 Left 1168665076 19:58198888-58198910 CCATTAAAGACAGGGATGGGTGC No data
Right 1168665080 19:58198919-58198941 ACCCATCTCAGCACCTTGGGAGG No data
1168665076_1168665079 5 Left 1168665076 19:58198888-58198910 CCATTAAAGACAGGGATGGGTGC No data
Right 1168665079 19:58198916-58198938 CTCACCCATCTCAGCACCTTGGG No data
1168665076_1168665087 29 Left 1168665076 19:58198888-58198910 CCATTAAAGACAGGGATGGGTGC No data
Right 1168665087 19:58198940-58198962 GGGTGAAGTGGGAGAATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168665076 Original CRISPR GCACCCATCCCTGTCTTTAA TGG (reversed) Intronic