ID: 1168666785

View in Genome Browser
Species Human (GRCh38)
Location 19:58210362-58210384
Sequence GATACAGATGTGCCTGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168666785_1168666790 24 Left 1168666785 19:58210362-58210384 CCACAGGCAGGCACATCTGTATC 0: 1
1: 0
2: 1
3: 20
4: 185
Right 1168666790 19:58210409-58210431 ACCTTCAGAAATGCATACTTAGG 0: 1
1: 0
2: 5
3: 23
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168666785 Original CRISPR GATACAGATGTGCCTGCCTG TGG (reversed) Intronic
900924966 1:5699240-5699262 GAGGCAGCTCTGCCTGCCTGGGG - Intergenic
901738138 1:11325245-11325267 GAATCAGATGTCCCGGCCTGAGG + Intergenic
902929504 1:19720829-19720851 GATAAAAATGTTTCTGCCTGTGG - Intronic
904381211 1:30112277-30112299 CAGACAGATGTTCCTGCCTGGGG + Intergenic
905465772 1:38152063-38152085 GATGCAGAGCTGCCTGGCTGAGG - Intergenic
907152865 1:52305709-52305731 GCTACAGCTGTGCCTGCAAGGGG - Intronic
908211669 1:61906555-61906577 GACATAGATGTGTGTGCCTGTGG - Intronic
910425641 1:87117766-87117788 GATACAGGTGTGCCTTGCTTTGG + Intronic
911412963 1:97533907-97533929 GATACAAATGAGCATGCTTGGGG - Intronic
911972044 1:104451489-104451511 GACACAGTTGTGCATGGCTGGGG - Intergenic
913420613 1:118663891-118663913 GACACAGTTGTGCATGCCTGTGG + Intergenic
917586798 1:176435074-176435096 GATTCAGATATGCTAGCCTGCGG - Intergenic
920950757 1:210569893-210569915 GAAACATCTGTGCTTGCCTGGGG - Intronic
922653006 1:227357295-227357317 GAGACAGATTTGCCTGCTGGAGG + Intergenic
922803435 1:228374185-228374207 GGTACAGATGGGCCAGGCTGGGG + Intronic
923927386 1:238648115-238648137 CATACAGATGGAGCTGCCTGAGG + Intergenic
924292593 1:242553081-242553103 GATACAGATGTGGATCCTTGTGG + Intergenic
924837558 1:247667710-247667732 CATAGAGATGAGCCTGTCTGTGG - Intergenic
1063143173 10:3274037-3274059 GATACAGGTGTCCCTTCCAGGGG - Intergenic
1063569137 10:7198436-7198458 GATACAGATGCGCAGACCTGTGG - Intronic
1064729483 10:18315552-18315574 GATGCAGTGGTGCCTGCCTGTGG + Intronic
1065167388 10:22994143-22994165 GATCCAGAAGTGCCTCCTTGAGG + Intronic
1066678509 10:37913731-37913753 AGTACAGATGGGCCTGCCTCTGG + Intergenic
1067102588 10:43343688-43343710 TAGACAGCGGTGCCTGCCTGTGG - Intergenic
1069650386 10:70042873-70042895 GATGCAGGTGACCCTGCCTGTGG + Intergenic
1074865032 10:117539949-117539971 CAGCCAGATGTCCCTGCCTGGGG + Intergenic
1076248012 10:128962416-128962438 GACCCAGATGGGCCTGGCTGTGG - Intergenic
1078684696 11:13517932-13517954 GATACAGATGTGTCTGTCTTTGG + Intergenic
1078847318 11:15130004-15130026 CAGGCAGATGTGGCTGCCTGTGG + Intronic
1080664124 11:34320653-34320675 GACACCCATATGCCTGCCTGTGG - Intronic
1083780396 11:64914547-64914569 GATAAGGCTGTGCCAGCCTGTGG - Intronic
1087502166 11:98971504-98971526 GAAACGAATGTGCCTGCCTCTGG + Intergenic
1087605831 11:100376836-100376858 GATACCTATGTGGCTGACTGAGG + Intergenic
1088003034 11:104905565-104905587 GATACAGATGGGTATGCCTTGGG + Intergenic
1088006505 11:104947200-104947222 GATACAGATGGGTATGCCTTGGG + Intronic
1088457422 11:110047610-110047632 GATATAGTGGTGCATGCCTGTGG + Intergenic
1088879123 11:113959675-113959697 GATACACATGTGGCTGGGTGTGG + Intergenic
1089745565 11:120614461-120614483 GAGACAGAGGTGCCTGCATCTGG + Intronic
1090717428 11:129442619-129442641 GAAACAGATGCCCATGCCTGAGG - Intronic
1091995858 12:4993398-4993420 AAAAGAGATGTACCTGCCTGAGG - Intergenic
1093389045 12:18595663-18595685 GATACAGCTGGCCCTGCCTAAGG - Intronic
1095731237 12:45509156-45509178 CATACAGATGGGGCTGCTTGAGG - Intergenic
1096967178 12:55637678-55637700 GTAACAGAGGAGCCTGCCTGCGG - Exonic
1097055036 12:56244037-56244059 GCTGCAGATGTGAGTGCCTGGGG - Exonic
1099255781 12:80309692-80309714 GATACTGGTGTTCCTTCCTGAGG + Intronic
1101062640 12:100987990-100988012 GATGCAGATGAGCCTGCAGGGGG - Intronic
1101445099 12:104731913-104731935 GAGACAGATGAGCCTGCCCCAGG + Intronic
1102418455 12:112784930-112784952 GATACAGCTGTGGCTGGGTGTGG + Intronic
1104892326 12:132146178-132146200 GATCCAGGAGTGGCTGCCTGGGG - Intronic
1105007186 12:132728921-132728943 GCTAGGGATGTGCCTGCCAGTGG - Intronic
1108522951 13:51261304-51261326 GATACTAATGTGCCTGCCATGGG + Intronic
1108694878 13:52894178-52894200 GATGCTGAAGTGTCTGCCTGGGG + Intergenic
1109077750 13:57859371-57859393 GATAATGATGAGCCTTCCTGGGG - Intergenic
1112372772 13:98809447-98809469 CATACAGATGGGCCAGCCTCTGG + Exonic
1114049870 14:18913939-18913961 GATACGGCTCTGCTTGCCTGGGG - Intergenic
1114112687 14:19487991-19488013 GATACGGCTCTGCTTGCCTGGGG + Intergenic
1114417786 14:22555923-22555945 GATAGATGTGTGCCTGCCTGGGG - Intergenic
1116247064 14:42429036-42429058 GTTACATTTGTGCATGCCTGGGG + Intergenic
1118342783 14:64909609-64909631 AATACAGGTGAGCCTGGCTGAGG - Intergenic
1119718226 14:76873715-76873737 AATACAGCTGTGGCTCCCTGAGG + Intergenic
1122520802 14:102342144-102342166 GATGCAGAGGGGCGTGCCTGCGG + Exonic
1122614810 14:103010009-103010031 GGTACAGTGGTGCATGCCTGTGG + Intronic
1123185640 14:106514063-106514085 AATTCAGATGAGCCTGGCTGTGG - Intergenic
1125366445 15:38921390-38921412 GACAGAGGTGTGCCTGTCTGAGG + Intergenic
1128972704 15:72121591-72121613 GACATAGTGGTGCCTGCCTGTGG + Intronic
1131107238 15:89743588-89743610 GTGACACATCTGCCTGCCTGAGG - Exonic
1131609944 15:93950115-93950137 CATACACGTGTGACTGCCTGCGG + Intergenic
1132282377 15:100631371-100631393 CACACAGATCTGCCTGCCTTGGG + Intronic
1133050277 16:3113487-3113509 GGTACAGATGGGGCTGGCTGAGG + Exonic
1133219528 16:4313911-4313933 GCTGCAGTTCTGCCTGCCTGAGG + Intergenic
1136685404 16:31991247-31991269 GATACAGACGTGCCTGCGTGGGG + Intergenic
1136786018 16:32934777-32934799 GATACACACGTGCCTGCGTGGGG + Intergenic
1136883757 16:33919026-33919048 GATACACACGTGCCTGCGTGGGG - Intergenic
1138418199 16:56883551-56883573 ATTACAGTTGTGCCTGGCTGAGG + Intronic
1141475421 16:84269929-84269951 GTCACAGATGTGCGTGCCTGTGG - Intergenic
1141478983 16:84293739-84293761 GAAACAGAGGGGGCTGCCTGAGG - Intergenic
1141504121 16:84463420-84463442 GTTCCAGAAGGGCCTGCCTGTGG - Intronic
1141724061 16:85774666-85774688 GCTGCAGAAGTGACTGCCTGAGG - Intronic
1203088251 16_KI270728v1_random:1196435-1196457 GATACACACGTGCCTGCGTGGGG + Intergenic
1146792317 17:35758960-35758982 GGTTTAGATGTGCCTGCCAGGGG + Intronic
1147146349 17:38486922-38486944 GATACACACGTGCCTGCGTGGGG + Intronic
1147266290 17:39236828-39236850 GATTCTGAGGGGCCTGCCTGGGG - Intergenic
1147376711 17:40026959-40026981 GATGCAGACCTGCATGCCTGAGG - Exonic
1150336422 17:64333849-64333871 GAGTCAGAGGGGCCTGCCTGGGG + Intronic
1150472767 17:65451173-65451195 GGGATAGATGTGCCTGCCTCTGG + Intergenic
1151234802 17:72712091-72712113 GAAACAAATGTGCTTGCATGGGG - Intronic
1151342760 17:73482341-73482363 GATACAGATGTGTCTGAAAGCGG + Intronic
1151944081 17:77309927-77309949 AGCACAGATGTGCCTGCCCGGGG - Intronic
1152828315 17:82481272-82481294 GACACAGATCTGCCTGGCTCTGG - Intronic
1156163803 18:34393646-34393668 GATACAGATTTGCTTTCCTGGGG - Intergenic
1156354064 18:36326221-36326243 GATTCAAATATGCCTGCCAGTGG + Intronic
1159353031 18:67299636-67299658 TATACAGATGGGTCTACCTGGGG + Intergenic
1162552528 19:11365531-11365553 CATACAGATGTGCCATCATGGGG + Exonic
1163699075 19:18778089-18778111 GCCACCGATGGGCCTGCCTGCGG - Exonic
1165306647 19:35006844-35006866 GCGACAGAGGTGCCTGCCTTAGG + Intronic
1165313444 19:35041541-35041563 GACCCAGGTGTGCCTGTCTGCGG - Intronic
1166699607 19:44874589-44874611 GATGCAGACCTGCCTGGCTGAGG + Intronic
1167502647 19:49856440-49856462 CTGACAGATGTGCCTGGCTGTGG - Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
1168666785 19:58210362-58210384 GATACAGATGTGCCTGCCTGTGG - Intronic
927034515 2:19159687-19159709 GCTACAGCTGTTGCTGCCTGGGG + Intergenic
928446551 2:31338428-31338450 GATAAAAATGTGCCTTTCTGGGG - Intronic
929758728 2:44788811-44788833 GAATCAGATGTGCCTGCATCTGG - Intergenic
930053493 2:47234899-47234921 GATACAGATGTCTCTGCCCAGGG + Intergenic
936168256 2:110143043-110143065 AAAATAGGTGTGCCTGCCTGAGG + Intronic
936471524 2:112802831-112802853 GATACAGTGGTGCATGCCTGTGG - Intergenic
937631768 2:124109598-124109620 GAGACCGATTTCCCTGCCTGGGG + Intronic
938252122 2:129823304-129823326 GACACTGCTGTGCCTGCCTGTGG - Intergenic
940238016 2:151531454-151531476 GATGCAGTGGTGCATGCCTGTGG - Intronic
940614992 2:156038645-156038667 GATTCAGCTGTTCCGGCCTGTGG + Intergenic
944062503 2:195583979-195584001 GATATGGATCTGGCTGCCTGGGG - Intronic
945311656 2:208320926-208320948 GATGCGGGTGTGCCTCCCTGGGG - Intronic
945957542 2:216100137-216100159 GACGCTGATCTGCCTGCCTGTGG + Exonic
946360169 2:219214621-219214643 GCTGCAGAGGTGCCTCCCTGTGG - Intronic
946941627 2:224775355-224775377 CTTCCAGATGTGCCTGGCTGTGG + Intronic
947375076 2:229487851-229487873 CATGCACATGTGCCTGCCTTGGG - Intronic
947824968 2:233099492-233099514 GAGAGAGATGGGCCTGGCTGAGG - Intronic
948168140 2:235878878-235878900 GTGACAGAGGTGCCTGCCAGAGG + Intronic
948825155 2:240570459-240570481 CATACAAAGGTGCATGCCTGAGG - Intronic
949041418 2:241851639-241851661 CCCACATATGTGCCTGCCTGCGG - Intronic
1168888742 20:1279899-1279921 GGCACAGCTGTGCCTTCCTGTGG + Intronic
1170603639 20:17860058-17860080 GATACAGATGGTCCAGCCTGGGG - Intergenic
1171342240 20:24439520-24439542 GATACATATGTGTGTGCATGTGG + Intergenic
1172030294 20:31977171-31977193 GATACAGTTGTGGCTGACTTAGG + Intronic
1172808358 20:37629508-37629530 GGGACAGGTGTGCCTGCCAGTGG + Intergenic
1173106044 20:40134917-40134939 TATACCTATGTGCCTGCCTGTGG - Intergenic
1173530765 20:43767603-43767625 TATGCAGGTGTGCCTGCATGAGG + Intergenic
1175095372 20:56537213-56537235 GATACAGATGTGCTAACCAGGGG + Intergenic
1175493882 20:59399197-59399219 GATACAGATTTTCCTGCCCTCGG - Intergenic
1180468352 22:15636315-15636337 GATACGGCTCTGCTTGCCTGGGG - Intergenic
1181582563 22:23836357-23836379 CCTACAGATGTTCCTGCCAGTGG - Intronic
1182170377 22:28222683-28222705 GATACTGTTGTGCATGTCTGAGG - Intronic
1182458579 22:30468672-30468694 GATCCAGAAGTACATGCCTGGGG - Exonic
1182520287 22:30881133-30881155 GATGCAGAGGGGCCGGCCTGGGG - Intronic
1182882233 22:33743506-33743528 GAGGCAGAAGTGGCTGCCTGGGG - Intronic
1183373861 22:37450849-37450871 GATACAGATCTCCTTTCCTGGGG + Intergenic
949876963 3:8632754-8632776 GAGACAGAAGTGCCTGTCAGAGG + Intronic
951352327 3:21620972-21620994 CACACACATGTGCATGCCTGTGG - Intronic
952698611 3:36300150-36300172 TATACATATGTACCTGCATGTGG + Intergenic
952976098 3:38697843-38697865 GATCCAGATGGACCTGCCTTTGG - Exonic
953064616 3:39457582-39457604 GATAAAAAGGTGCCTGCCGGTGG + Intergenic
953452968 3:43019409-43019431 GGTTCAGCTCTGCCTGCCTGGGG + Intronic
953867776 3:46599175-46599197 GATAGAGATGGCCCTTCCTGGGG + Intronic
953899776 3:46833573-46833595 GCCGCAGATGTGCCTGCCTTTGG + Exonic
954141089 3:48605942-48605964 GATTCATAAGTCCCTGCCTGGGG - Intronic
955341851 3:58130947-58130969 GTTACAGCTGCCCCTGCCTGGGG - Intronic
959133432 3:102387173-102387195 GATGAGGATGTGACTGCCTGTGG + Intronic
960149207 3:114232994-114233016 GAGACAGCTCTGCCTGCATGTGG + Intergenic
960300007 3:115991427-115991449 CATATACATGTGCATGCCTGTGG + Intronic
961470782 3:127110224-127110246 GATAGAGCTGTGCTTCCCTGAGG + Intergenic
961503217 3:127352020-127352042 CAGACACATGTGCCTGCCTGAGG + Intergenic
962314228 3:134349036-134349058 GACCCATGTGTGCCTGCCTGAGG + Intergenic
964336564 3:155660940-155660962 AATACCTATCTGCCTGCCTGAGG + Intronic
964739712 3:159952607-159952629 GACACACAAGTTCCTGCCTGTGG + Intergenic
966471869 3:180298734-180298756 GGTGCAGATGTGCTTCCCTGGGG - Intergenic
969651320 4:8469834-8469856 AACGCAGAGGTGCCTGCCTGAGG - Intronic
973243965 4:47990187-47990209 GATAAAGGTCTGACTGCCTGTGG + Intronic
973948176 4:55982134-55982156 GAGACACAGGTGGCTGCCTGTGG - Intronic
976777555 4:88722615-88722637 GATGCACATGCGCCTGCCTGGGG - Intergenic
979185133 4:117779690-117779712 GATACGGTTGTGCTTGCCTGTGG + Intergenic
980715522 4:136623729-136623751 GAAACAGATTTGTCTGCCTGTGG - Intergenic
982138048 4:152291390-152291412 GATTCAGAGGTTCCTGTCTGTGG - Intergenic
983640045 4:169936802-169936824 GAAACACAAGTGCCTGTCTGTGG - Intergenic
984049624 4:174847918-174847940 GAAACAGATGTTCCTGCATTAGG + Intronic
985619621 5:947360-947382 GAGACAGACGTGGCTTCCTGTGG + Intergenic
985730602 5:1545613-1545635 GGTACAGATGTGCATGCAGGTGG - Intergenic
994041526 5:95264763-95264785 CTCACAGCTGTGCCTGCCTGTGG - Intronic
996701717 5:126456890-126456912 GATATAGAAGTACCTGGCTGAGG + Intronic
997487870 5:134246930-134246952 AGAGCAGATGTGCCTGCCTGAGG + Intergenic
997565899 5:134886232-134886254 TATACAAATGTGCATACCTGAGG + Intronic
1000630538 5:163585941-163585963 GGTACGGTAGTGCCTGCCTGTGG - Intergenic
1000863792 5:166488267-166488289 GCTGCAGATGTGTGTGCCTGAGG + Intergenic
1003140303 6:3465856-3465878 GAACCAGATGTGCTTGCTTGTGG + Intergenic
1005546161 6:26874544-26874566 TATACAGATGTCCCTACCAGGGG - Intergenic
1006552028 6:34832258-34832280 GATACAGTGGTGCATGCCTTTGG - Intronic
1006902197 6:37510474-37510496 GAGACAGATGTGCCTGGGGGAGG + Intergenic
1018705577 6:166461317-166461339 CAGACACATGTGCTTGCCTGAGG + Intronic
1019312134 7:368023-368045 GAGAGGGATGGGCCTGCCTGAGG + Intergenic
1019929911 7:4216418-4216440 GAGACAACTGTGCCTGCGTGGGG + Intronic
1020068706 7:5211144-5211166 GATGCACATGTTCCTGGCTGAGG - Intronic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1023247872 7:38225851-38225873 GACACGGATGTGTCTGCATGTGG + Intronic
1023835538 7:44065286-44065308 GGACCAGATGTGGCTGCCTGTGG - Exonic
1025027220 7:55526518-55526540 AAGTCAGCTGTGCCTGCCTGTGG - Intronic
1032549289 7:132769659-132769681 GATTCTGATATGCCTGGCTGAGG + Intergenic
1034536067 7:151726648-151726670 GATGCAGCCGTGCCTGCGTGCGG - Intronic
1034920851 7:155080432-155080454 GAGACTGATGTGCTTGGCTGTGG + Intronic
1036951475 8:13143907-13143929 CATTCACATGTGCCTGCCCGGGG - Intronic
1037015679 8:13903253-13903275 GACACAGATGTGTCTGTCTTGGG - Intergenic
1044929303 8:97236499-97236521 GATGCAGATGAGCCTCCTTGGGG + Intergenic
1045229848 8:100293558-100293580 GATAAAGATGTGCCTAGATGTGG + Intronic
1048219391 8:132527485-132527507 GGGACAGAGGTGCCTGCCTGGGG - Intergenic
1048458936 8:134603689-134603711 GTTGAGGATGTGCCTGCCTGGGG + Intronic
1049038280 8:140093781-140093803 GAGACAAAGGTGCCTGCTTGAGG + Intronic
1051779203 9:20670409-20670431 GATACAGTTCTGCATGGCTGGGG + Intronic
1056639032 9:88354517-88354539 GATTCAGAGGTGCCTGACTCAGG + Intergenic
1060433191 9:123568678-123568700 GATACAGATTTCCCTGCTTAGGG + Intronic
1060789455 9:126476223-126476245 GTTACCGCTGAGCCTGCCTGAGG + Intronic
1061968919 9:134033067-134033089 AGGACAGATGTGCCTGCTTGTGG - Exonic
1185650398 X:1643465-1643487 GAGACAGATGGGACTGTCTGAGG - Intergenic
1190892134 X:54579521-54579543 GGTACGGTTGTGCATGCCTGTGG - Intergenic
1191930311 X:66365077-66365099 GATTCAGCTGTTCCAGCCTGCGG - Intergenic
1192568805 X:72185260-72185282 CACTCAGATGAGCCTGCCTGAGG - Intronic
1192784892 X:74325949-74325971 GATACAGAAAGGCCTGCCTCAGG - Intergenic
1197298283 X:124746794-124746816 GATATAGATGTGTCTGCTAGTGG + Intronic
1197699858 X:129591184-129591206 GCTCTAGATGGGCCTGCCTGAGG - Exonic
1199670729 X:150146209-150146231 TATACATTTGTGCCTCCCTGTGG + Intergenic