ID: 1168670128

View in Genome Browser
Species Human (GRCh38)
Location 19:58234665-58234687
Sequence CTAAACATACACATGCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 312}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168670128 Original CRISPR CTAAACATACACATGCAGAA AGG Intronic
900005161 1:40480-40502 TCAAACATATACATGCAGGAAGG - Intergenic
902074485 1:13772557-13772579 CAAAAGATACACATTCACAATGG - Intronic
905498015 1:38410711-38410733 CTACACAAACACTTCCAGAAAGG + Intergenic
908504883 1:64787307-64787329 CTAAACAGTGACATACAGAAAGG - Intronic
908649514 1:66316549-66316571 CTGAACACACACATACAGACAGG - Intronic
909364412 1:74802618-74802640 CTAAACCTACATAATCAGAAAGG - Intergenic
910576419 1:88769954-88769976 ATAAACATACACATGAAAAGGGG + Intronic
911464085 1:98229564-98229586 ATAAACATACACATACATATAGG + Intergenic
912219915 1:107661754-107661776 CAACACATATACACGCAGAATGG - Intronic
912352182 1:109024828-109024850 ATAAACATACACATGTGGACTGG + Intronic
916269449 1:162924417-162924439 ATAAACACACACATGCAAAAGGG - Intergenic
916378891 1:164187216-164187238 CTGAGCATACACATGAGGAAAGG - Intergenic
917585606 1:176424310-176424332 AGAAACAGCCACATGCAGAAAGG - Intergenic
918431707 1:184467589-184467611 CCAAACATAAACAGGCAGACTGG - Intronic
918939234 1:190969923-190969945 ATACACATAGACATACAGAAGGG - Intergenic
919015995 1:192037362-192037384 CCAAACTTACTCATGCACAATGG - Intergenic
919121016 1:193340175-193340197 CTAATCATCCATAAGCAGAAAGG + Intergenic
919232649 1:194794438-194794460 ATACACAAACACATGCATAAAGG + Intergenic
921052278 1:211519272-211519294 CAAAAAATACATATCCAGAATGG + Intergenic
921339468 1:214120313-214120335 CTGAACAGCCACATGCAGCAAGG + Intergenic
922215936 1:223520027-223520049 CTAAAGGTACACATGGAGGAAGG - Intergenic
922859772 1:228806378-228806400 TTAAACATACAAAAGTAGAAAGG + Intergenic
923822056 1:237455599-237455621 CTAAACAAACAAAACCAGAAAGG + Intronic
924574139 1:245263890-245263912 CTAAGCAGACACACACAGAACGG - Intronic
1062922951 10:1293435-1293457 TTAAACACACACAAGAAGAAAGG - Intronic
1063022560 10:2144290-2144312 CCCAACACACACATGAAGAAGGG + Intergenic
1063330142 10:5150207-5150229 CTTTAAATACACTTGCAGAAAGG - Intergenic
1063751403 10:8952592-8952614 CTAAAAATGCTGATGCAGAAGGG + Intergenic
1066673384 10:37862846-37862868 TTAAACATACATATGCAGGCTGG - Intergenic
1066807982 10:39282727-39282749 CTAAATATCCACTCGCAGAATGG + Intergenic
1066808092 10:39284438-39284460 CTAAATGTCCATATGCAGAATGG + Intergenic
1067955880 10:50789987-50790009 GTAACCATACACATGCATAGTGG + Intronic
1068134269 10:52936190-52936212 GTAGACATACACAAGGAGAAAGG + Intergenic
1068822674 10:61395804-61395826 CTGCACATTCACATGCACAAGGG - Intergenic
1068897551 10:62223978-62224000 ATACACATACATATGCATAATGG + Intronic
1069203155 10:65648373-65648395 TTAAATATAAATATGCAGAAAGG + Intergenic
1069751492 10:70748095-70748117 CTAAACATACGCATGAAAAGTGG - Intronic
1069792711 10:71033523-71033545 GCAAGCATCCACATGCAGAAAGG - Intergenic
1070485582 10:76927644-76927666 CTGAACAACCACATGTAGAAAGG - Intronic
1071524983 10:86353363-86353385 CTAAACATGCCCAGGCAGCATGG + Intronic
1074648704 10:115493304-115493326 GTACACATAGACATGAAGAAGGG - Intronic
1078973666 11:16445994-16446016 CCAAACACACACTTTCAGAAAGG - Intronic
1079956127 11:26867055-26867077 CTAAACCTACACATTCACCATGG + Intergenic
1080365855 11:31573252-31573274 CTAAAGATACGGATGCAGACTGG - Intronic
1080789261 11:35506821-35506843 ATAAATATCCACATGCAGGAAGG - Intronic
1082312071 11:50662968-50662990 CCAAACATCCATTTGCAGAATGG + Intergenic
1082594084 11:55052826-55052848 CTAAACGTCCACTTGCAGAATGG + Intergenic
1082640966 11:55660207-55660229 ATAGACATACACATACACAAAGG - Intergenic
1083483689 11:62967767-62967789 CTACACAAACACCTACAGAAAGG + Intronic
1083970912 11:66074433-66074455 CTCACCATACAAAGGCAGAAGGG - Intronic
1084782436 11:71419063-71419085 CCTGAGATACACATGCAGAAAGG + Intergenic
1085193879 11:74654210-74654232 TTAAACATAAAGATGCAGATAGG + Intronic
1086812172 11:91323597-91323619 TTAAACAAACACACGCAGAGTGG + Intergenic
1087971154 11:104486087-104486109 CTACACATACACATGCACACTGG + Intergenic
1088342318 11:108782455-108782477 CTGAACAGAAGCATGCAGAAAGG - Intronic
1088444644 11:109912421-109912443 ATAAAAATACACCTTCAGAATGG + Intergenic
1091379146 12:44655-44677 TCAAACATATACATGCAGGAAGG - Intergenic
1091672532 12:2462458-2462480 GAACACATACACATACAGAATGG - Intronic
1092216423 12:6686987-6687009 CAAAACACACAACTGCAGAAAGG + Intronic
1092491671 12:8950952-8950974 ATAAACAAAGAAATGCAGAATGG - Intronic
1093370591 12:18360042-18360064 CTAAAAATACACAGCCAGAGAGG - Intronic
1093930083 12:24947352-24947374 TAAGACAGACACATGCAGAATGG - Intronic
1094050071 12:26209703-26209725 CAAAACAAACACATGAAGGAAGG - Intronic
1094864008 12:34507077-34507099 CTAAATATCCATTTGCAGAATGG + Intergenic
1100473264 12:94912856-94912878 CTAAATATCCACATGCAGGCAGG - Intronic
1100887030 12:99082979-99083001 GTAAACATACACAAGCAGAGAGG + Intronic
1101126372 12:101639349-101639371 CTTAACATAGCCATGCAGACAGG + Intronic
1103632384 12:122272481-122272503 CTAAATATACAAATGCAGCCTGG + Exonic
1104187487 12:126446752-126446774 CTAAACACACACACACACAATGG + Intergenic
1106323347 13:28663139-28663161 CTAAACATACAGAAACAAAAAGG - Intronic
1106597555 13:31159917-31159939 ATAACCATACACTTGCAGAATGG + Intronic
1109048853 13:57451114-57451136 CTGAACACAAACATGCACAATGG - Intergenic
1109408206 13:61928286-61928308 CTAAGCATACAAATGAAAAATGG - Intergenic
1110205230 13:72904170-72904192 ATAAACCTTCATATGCAGAAAGG - Intronic
1110564160 13:76941118-76941140 ATAAAAATACAAATGGAGAAGGG + Intergenic
1110593471 13:77291896-77291918 CTAAACATCCACATTCCCAAAGG - Intronic
1112137931 13:96603596-96603618 CTAAACATACACATACCCTATGG - Intronic
1112696374 13:101953535-101953557 ATATATATACACATACAGAAAGG - Intronic
1113454582 13:110438965-110438987 CTGAACACACACAACCAGAAAGG - Intronic
1114367707 14:22047767-22047789 CTAGGCACACACATGGAGAATGG + Intergenic
1114854099 14:26416648-26416670 TTAAACATACACAGACAGAAAGG + Intergenic
1116038022 14:39652333-39652355 CCAAGAATACACATGGAGAAAGG + Intergenic
1116749321 14:48863110-48863132 GTAAACAGACACTTACAGAATGG + Intergenic
1116969113 14:51046322-51046344 CTCAACACACACATGCAAATGGG + Intronic
1118670288 14:68118649-68118671 CTCAAAATACACCTGCACAATGG - Intronic
1119921054 14:78446325-78446347 CCAAAGATACACATGCAAGATGG + Intronic
1119933636 14:78570811-78570833 GTAAACTTCCAAATGCAGAAAGG - Intronic
1120261729 14:82193968-82193990 TTAAACACACACATACACAAAGG - Intergenic
1120693332 14:87617731-87617753 GCAAAGATTCACATGCAGAAAGG + Intergenic
1120948380 14:90019406-90019428 GTAAACTTACAAATGCTGAAGGG - Exonic
1121932639 14:97986795-97986817 ATAAACATAAACATACACAAGGG + Intergenic
1122305140 14:100760562-100760584 CTGACTATCCACATGCAGAAAGG + Intergenic
1202941173 14_KI270725v1_random:147733-147755 ATATACATACACACACAGAATGG - Intergenic
1124255198 15:28135588-28135610 CTTAATAAACACATGCTGAATGG + Exonic
1124883782 15:33665274-33665296 CTAAAGAAACAGATACAGAAAGG - Intronic
1125022892 15:35002466-35002488 CTTCACAGACACATCCAGAATGG + Intergenic
1126072479 15:44876960-44876982 CTGAACATACTCACGCAGGATGG + Intergenic
1126085710 15:45009692-45009714 CTGAGCATACTCATGCAGGATGG - Intergenic
1126905146 15:53356902-53356924 CTAAAATTATACCTGCAGAATGG - Intergenic
1127145270 15:56016832-56016854 CAAAACCTACACGTGGAGAATGG - Intergenic
1128966479 15:72063183-72063205 CTGGACATCCATATGCAGAAGGG + Intronic
1129196385 15:73969700-73969722 CTGAACATACACGTGCACCATGG - Intergenic
1129678532 15:77645165-77645187 CCAAACATACACACTCAGAACGG + Intronic
1132331038 15:101012769-101012791 CTGAGGATACACATGCTGAAGGG - Intronic
1132448352 15:101950464-101950486 TCAAACATATACATGCAGGAAGG + Intergenic
1132935295 16:2477270-2477292 CTTAACAAACACATGTTGAAAGG - Intronic
1133388724 16:5391720-5391742 GAAAACAGACACATACAGAAGGG - Intergenic
1134463866 16:14455725-14455747 ATAAACATACACTTGCAATATGG + Intronic
1135602128 16:23792414-23792436 CTAACCATACTCAGGCAGGAGGG - Intergenic
1137081421 16:36063075-36063097 CCAAATATCCACATGCACAAAGG - Intergenic
1137628603 16:49925668-49925690 CTGTACATCCACATGCAAAAAGG + Intergenic
1138088241 16:54153474-54153496 CTAAGCAAACAAATACAGAAAGG + Intergenic
1140819330 16:78648465-78648487 CCAAAGATACACATGGACAATGG + Intronic
1140826965 16:78715830-78715852 CCAAATAGACACATGCAGAAGGG - Intronic
1143227593 17:5320005-5320027 ATAAATATCCACATGCAGGAAGG + Intronic
1145369853 17:22299251-22299273 CCAAACACACACACGCACAAGGG - Intergenic
1146236284 17:31166799-31166821 CTTAACATCCACATGGAGACTGG - Intronic
1146296895 17:31657396-31657418 CTAAACAGAAACATGCAGCTGGG + Intergenic
1148675963 17:49445186-49445208 CTACAGTTACACATGCAGTAAGG - Intronic
1149130139 17:53290269-53290291 CTAAACATACACACACAAACCGG + Intergenic
1149559428 17:57597676-57597698 CTTTACATAAACAGGCAGAAGGG + Intronic
1149768836 17:59303833-59303855 ATAAACATACATATGCAGATCGG - Intergenic
1150459865 17:65341058-65341080 ATAAACAGACACCTACAGAATGG + Intergenic
1151738550 17:75962812-75962834 TAAAACATGGACATGCAGAATGG + Intronic
1155582246 18:27322793-27322815 CTAAACATGAACATGAAGTAAGG - Intergenic
1155904589 18:31434323-31434345 CTGGACATCCACATGCAGAGAGG + Intergenic
1159328219 18:66951401-66951423 ACAAACATAAACATGGAGAAAGG + Intergenic
1160217725 18:76947694-76947716 AAAAACATACAGATTCAGAAGGG + Intronic
1160636915 19:82089-82111 TCAAACATATACATGCAGGAAGG - Intergenic
1162712937 19:12609783-12609805 GTAAACATGGACATACAGAATGG + Intronic
1163952243 19:20599894-20599916 CTAAACAAAAACATGAAGTAGGG - Intronic
1163952796 19:20606224-20606246 ATAAACATATACATGGAAAATGG - Intronic
1163964157 19:20728504-20728526 CTAAACAAAAACATGAAGTAGGG + Intronic
1164082372 19:21869914-21869936 CGAAACATATACACCCAGAATGG - Intergenic
1164190275 19:22909528-22909550 ATAAACATACACACACAGAATGG - Intergenic
1166943180 19:46380557-46380579 CTAAAAGTACTCAGGCAGAAGGG - Intronic
1168670128 19:58234665-58234687 CTAAACATACACATGCAGAAAGG + Intronic
925770446 2:7277228-7277250 CATAAAATACACATGAAGAATGG + Intergenic
929442432 2:41974653-41974675 CTATACATACACATACGGAATGG - Intergenic
929678005 2:43957085-43957107 CTGAACATACATATGCAAATTGG + Intronic
930202899 2:48561511-48561533 CGAAGCAGACACATACAGAAGGG + Intronic
930797021 2:55404613-55404635 GGAAAGATACACATACAGAAAGG + Intronic
935093010 2:99914998-99915020 TTATACATACATATACAGAAAGG + Intronic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
935644862 2:105326224-105326246 GTATACATACATATGCATAAGGG + Intronic
936564561 2:113572952-113572974 TCAAACATATACATGCAGGAAGG + Intergenic
936816214 2:116464145-116464167 CTAAACAAACACATGCATGGGGG - Intergenic
937103949 2:119293378-119293400 GTAAACATACACATGCCCCAGGG - Intergenic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
940240674 2:151559949-151559971 CAAAACACACACACGCAAAAAGG + Intronic
940632205 2:156254391-156254413 CTAAACAGACAACTACAGAATGG + Intergenic
941042947 2:160643967-160643989 CTAAACATAAACATGGAGGGTGG + Intergenic
941108273 2:161387649-161387671 TAAAATATACACTTGCAGAATGG - Intronic
941479158 2:165984469-165984491 CAAAATATACACATGCATAATGG + Intergenic
943449819 2:188033543-188033565 CTGCACATACACATCCAGATGGG + Intergenic
943489567 2:188533683-188533705 GTAAACAGACACCTACAGAATGG + Intronic
944080798 2:195786444-195786466 GTACTCATACACATGCAGCATGG - Intronic
944136659 2:196406825-196406847 CTAAACATCACCTTGCAGAAAGG + Intronic
944165236 2:196711765-196711787 CTAATTATACACATTCAAAAGGG + Intronic
944318035 2:198304487-198304509 CTAAACAGACAGCTGCAGAGAGG - Intronic
945116251 2:206410749-206410771 CGAAACAAGCACATGCAGATGGG + Intergenic
945564409 2:211378751-211378773 GTAAACATATAAATGCAGATTGG - Exonic
946502249 2:220261894-220261916 TTAAACATACACATGAAAATTGG - Intergenic
947324864 2:228963090-228963112 TTCAACATACACATTCAGGAGGG - Intronic
947925355 2:233916585-233916607 CAAGACATACACTTGCAAAAAGG - Intergenic
1169280448 20:4262680-4262702 CTTAACATACAAATCCACAATGG - Intergenic
1169948970 20:11021049-11021071 GAAAACATACACTGGCAGAAAGG + Intergenic
1170021644 20:11843008-11843030 CTGAACGTACACACGCTGAAGGG + Intergenic
1170021762 20:11844543-11844565 CCAAATATACACATGCTGAAGGG + Intergenic
1171234193 20:23510933-23510955 CTAATCCTACAGATGGAGAAGGG + Intergenic
1171482642 20:25465555-25465577 CCAGACAGACACAAGCAGAAGGG + Intronic
1171909687 20:30935908-30935930 CCAAATATCCACATGCAGATAGG + Intergenic
1173143475 20:40505067-40505089 CTAAATTTACAGATGCAGATAGG - Intergenic
1175078339 20:56394670-56394692 CCAAACATACACATACATAAAGG + Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176581988 21:8539209-8539231 ATATACATACACACACAGAATGG + Intergenic
1177876381 21:26636941-26636963 CTTAAGATACACGTCCAGAAGGG + Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179178883 21:39028650-39028672 CAAAACAGGCACTTGCAGAATGG + Intergenic
1180264825 22:10516257-10516279 ATATACATACACACACAGAATGG + Intergenic
1180727357 22:17956267-17956289 CCAAACAGACAGTTGCAGAAAGG + Intronic
1183694644 22:39414836-39414858 ATGAACAGACACCTGCAGAAGGG - Intronic
1185152983 22:49177039-49177061 ACAAACACACACATGCAGCAGGG + Intergenic
950337107 3:12204345-12204367 CTAAACAAAAACATGCAGAGAGG + Intergenic
952190348 3:31016586-31016608 CTAAACCTACACATGCTGTGGGG + Intergenic
952493276 3:33892586-33892608 CTAAACATCCACAATCAGAAAGG + Intergenic
952996486 3:38887945-38887967 ACAAACATACACATACAAAAAGG + Intronic
953464164 3:43105215-43105237 CTAAACACACACATGGAGTCAGG + Intronic
953650054 3:44794392-44794414 AAAAAGATACCCATGCAGAAGGG + Exonic
957026601 3:75189275-75189297 TTCAACATACACATGAAGACTGG - Intergenic
957289958 3:78267157-78267179 CCAAACAGATACATGCAAAAAGG - Intergenic
958855756 3:99383138-99383160 TTAAGCATTCACCTGCAGAAAGG + Intergenic
959775566 3:110157568-110157590 CTAAAAATACACATATCGAAAGG - Intergenic
960827408 3:121804730-121804752 ATAAACATGCAGATGCAAAAAGG - Intronic
961057486 3:123801354-123801376 CTTAAAATACACAAGGAGAAAGG + Intronic
961102508 3:124212618-124212640 CTTCACATAGACATGCAGAAGGG + Intronic
962637325 3:137344629-137344651 CTTACCATACCCTTGCAGAATGG - Intergenic
963177824 3:142319709-142319731 CTAAACATGGACATACAGAGTGG - Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
965696135 3:171410374-171410396 CTGAAGATACTCATCCAGAAAGG - Intronic
966597265 3:181735963-181735985 ATAGACACACACACGCAGAAGGG + Intergenic
967883837 3:194320077-194320099 CTAGACAAACACATGAATAAGGG + Intergenic
968288617 3:197522462-197522484 CTAAACATACACGTGCAATAGGG - Intronic
969941738 4:10739029-10739051 CCAAACATAAACATGCAGTGTGG - Intergenic
970101868 4:12532445-12532467 ACACACATACACTTGCAGAATGG - Intergenic
970794719 4:19897653-19897675 TTAAAACTAAACATGCAGAAAGG + Intergenic
970821024 4:20214051-20214073 CTACACATACACAAACAAAAAGG + Intergenic
970913088 4:21301550-21301572 CTGAACTTAGACATGCAAAATGG + Intronic
971958696 4:33456522-33456544 CTAAACAAACAACAGCAGAAAGG + Intergenic
972103760 4:35456347-35456369 TTAAACAGACACCTACAGAATGG - Intergenic
975181574 4:71351697-71351719 CTAAAAATACAAGTGGAGAAGGG + Intronic
975306892 4:72859996-72860018 TGAAATATATACATGCAGAAAGG - Intergenic
976090241 4:81449618-81449640 GTAAACCTACAGATGTAGAAAGG + Intronic
978970961 4:114806327-114806349 ATAATCATACAGCTGCAGAATGG + Intergenic
978994794 4:115137548-115137570 GTAAACATAGACATACAGAGTGG + Intergenic
979280851 4:118866103-118866125 ACAAACATACACATGCATCAAGG - Intronic
979616646 4:122750265-122750287 CCACACATGCACATGCAGATGGG - Intergenic
980238286 4:130137223-130137245 ATAAACATACACATGTATGATGG + Intergenic
980279485 4:130701094-130701116 ATAAACATACACATGTGGACTGG + Intergenic
983445007 4:167839135-167839157 CAAAACAGACATATACAGAAAGG - Intergenic
984684721 4:182654135-182654157 CTCAATATACATCTGCAGAAGGG - Intronic
985082844 4:186283919-186283941 CAAAACATGCACATGAAAAATGG - Intronic
985154777 4:186975448-186975470 ATACACATACATATGAAGAAAGG + Intergenic
986725123 5:10589906-10589928 CATAACATACACAGGCAGCATGG - Intronic
986988214 5:13522779-13522801 CAGAACACACACATGTAGAAAGG - Intergenic
987071724 5:14343265-14343287 CTAAACACACACATACACATGGG - Intronic
987249704 5:16086286-16086308 ATAAACATCAAAATGCAGAAAGG + Intronic
988061111 5:26171958-26171980 CTAAGCCTCCACATGCAGAATGG - Intergenic
989526945 5:42464584-42464606 CTCAGCACACACCTGCAGAATGG - Intronic
989776305 5:45212009-45212031 ATAAGCATCCTCATGCAGAAAGG + Intergenic
989864221 5:46426632-46426654 CTAAATATCCACTTGCAGATGGG + Intergenic
990139433 5:52685857-52685879 CAAAACTTACACCTTCAGAAAGG - Intergenic
990328492 5:54701709-54701731 AGAAACACACACATACAGAATGG + Intergenic
993511915 5:88781296-88781318 CTAAATTTACATATGCAAAAAGG + Intronic
993998794 5:94753751-94753773 ATGAACATGCATATGCAGAAGGG + Intronic
994629855 5:102271835-102271857 ATAAACATATACACACAGAATGG + Intronic
995684564 5:114758209-114758231 CTAAACATACCGATACAGTATGG + Intergenic
997697560 5:135873512-135873534 CTAAACAAACACAGGCAGACAGG - Intronic
997829753 5:137139810-137139832 ACAAACATACACATGCAAACGGG - Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999732994 5:154489971-154489993 CTAAAAATACACATGGAAATAGG - Intergenic
1000544835 5:162586006-162586028 TTTAATATACACATGCACAAAGG - Intergenic
1001165430 5:169361369-169361391 ACAGACAAACACATGCAGAAGGG + Intergenic
1002626904 5:180535351-180535373 GTACACATGCACATACAGAATGG - Intronic
1004351874 6:14897265-14897287 ATACACACACACATGCACAATGG + Intergenic
1004539811 6:16539077-16539099 CTACCCATTCCCATGCAGAAAGG + Intronic
1006464644 6:34185343-34185365 ACACACATACACATGCACAAGGG + Intergenic
1007375150 6:41451451-41451473 CGATACAGCCACATGCAGAAGGG - Intergenic
1008074887 6:47135059-47135081 CAAAATAGACACATGAAGAAGGG - Intergenic
1008296112 6:49779906-49779928 TTAAACATACACATATATAAAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1008951267 6:57162231-57162253 CTAAACACACACAAACAGAATGG + Intronic
1009251664 6:61308740-61308762 CTAAATTTACATTTGCAGAATGG - Intergenic
1009261065 6:61488891-61488913 CTAAATGTACATTTGCAGAAAGG + Intergenic
1010406702 6:75514302-75514324 CAAAACAAAAACATGGAGAAAGG - Intergenic
1011544580 6:88469413-88469435 GTAAACATTCACATTCCGAAAGG - Intergenic
1011862794 6:91781743-91781765 CACAAAAAACACATGCAGAAAGG - Intergenic
1011914448 6:92486733-92486755 ATTAACATTCACATGCAAAAGGG - Intergenic
1013021093 6:106219800-106219822 CACAACATATACATGCAGACAGG + Intronic
1014236408 6:118960864-118960886 CTGAACATACCCATGCACAAGGG + Intronic
1014297398 6:119637047-119637069 CTCAACACACACATTCAGTAAGG - Intergenic
1014530912 6:122558083-122558105 CTAAACTTACTGAAGCAGAAAGG + Intronic
1014961930 6:127696802-127696824 TTAGACATACACATGCACAGAGG - Intergenic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015041251 6:128722604-128722626 CTAAACATTCAACTGCAAAAGGG - Intergenic
1015639150 6:135312177-135312199 TAAAACTTACACATGAAGAAGGG + Intronic
1016475010 6:144418086-144418108 GTAAACAAATAGATGCAGAAAGG + Intronic
1016968465 6:149740642-149740664 CAAAACACACACATACAAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1020551218 7:9607290-9607312 GTAAACAAACACCTACAGAATGG - Intergenic
1020811114 7:12851188-12851210 CTAAATTTGCACATGCAGAAAGG + Intergenic
1021626432 7:22597830-22597852 ATAAACACACAAATGCAAAAAGG - Intronic
1022038998 7:26562001-26562023 CTAAATATCCACATGAAAAATGG - Intergenic
1022509233 7:30924626-30924648 ATAAACATACACCAGCATAATGG - Exonic
1023062058 7:36337312-36337334 ATTAACACACATATGCAGAATGG + Intronic
1023104615 7:36751268-36751290 ATAAACATTCACAAGCATAAGGG - Intergenic
1024122510 7:46259315-46259337 TTACACACACACATGCAGAGGGG + Intergenic
1024369770 7:48567971-48567993 CTAAACACACACATGCTCTATGG - Intronic
1024894937 7:54247186-54247208 CTAGACACACACATGATGAAAGG - Intergenic
1025587689 7:62812904-62812926 CCAAATATCCATATGCAGAATGG + Intergenic
1026438264 7:70418700-70418722 AAAAAGATACACATGCACAACGG - Intronic
1027527110 7:79283672-79283694 TTAAACATATACATAAAGAAAGG + Intronic
1027598216 7:80202918-80202940 CTAAACAGAAACATGAATAATGG - Intronic
1028255980 7:88598157-88598179 ATTTACATATACATGCAGAAAGG + Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028918121 7:96282128-96282150 TTAAACATACACCTGCAAAATGG + Intronic
1030710517 7:112743508-112743530 CAAAACATAATCTTGCAGAAGGG + Intergenic
1030729035 7:112962315-112962337 CTATATATACACATGCACAGTGG + Intergenic
1030803434 7:113883676-113883698 ATAAACATGTACATGGAGAAGGG - Intronic
1031846885 7:126815973-126815995 CTAAACATACAAATACACAAAGG + Intronic
1032211507 7:129918755-129918777 TTAAACATATACATAGAGAAAGG - Intronic
1032750413 7:134834449-134834471 CTAATCAAACACAGGCAGAATGG + Intronic
1034516782 7:151587314-151587336 ATAAACAAACAGATGGAGAAGGG + Intronic
1035293980 7:157857482-157857504 CTAAACAGAGCCCTGCAGAAGGG - Intronic
1035461015 7:159039161-159039183 TTAAAAATACACATGCAGCCGGG + Intronic
1037762023 8:21747814-21747836 ATAAACATGCACATGCACACAGG + Intronic
1038550909 8:28467909-28467931 CTAAACAAACACAATTAGAAAGG - Intronic
1040849615 8:51885648-51885670 CTAAAAATACAAATTCACAAAGG + Intronic
1043963765 8:86448190-86448212 CTTAACATACGCTTGTAGAATGG - Exonic
1045165131 8:99595712-99595734 CTAATCATATATTTGCAGAATGG + Intronic
1045435335 8:102157674-102157696 TTACACATAGACATGCACAATGG + Intergenic
1046174776 8:110560996-110561018 CTAAACAGACAACTACAGAATGG - Intergenic
1046640606 8:116726174-116726196 TAAAACATACACACACAGAAGGG + Intronic
1046989037 8:120428544-120428566 ATAAACAGACACCTACAGAATGG + Intronic
1047771636 8:128034596-128034618 CTAAACATACATGTGCAAAATGG + Intergenic
1049887857 9:40262-40284 TCAAACATATACATGCAGGAAGG - Intergenic
1050856669 9:10365972-10365994 CTAAACAGTCAAATGCAGAATGG + Intronic
1050863032 9:10460603-10460625 CCAAAAATACACATGAGGAAAGG + Intronic
1051660726 9:19423892-19423914 CGAAACAAGCACATGCAGATGGG - Exonic
1052482342 9:29047099-29047121 GTAAACAGACACCTACAGAATGG + Intergenic
1053757267 9:41324373-41324395 CTTCACACATACATGCAGAATGG + Intergenic
1054363917 9:64210948-64210970 CTAAATGTACATTTGCAGAAAGG + Intergenic
1054778490 9:69144432-69144454 CTAAACAAACCCATACATAAAGG - Intronic
1057306806 9:93917020-93917042 GGAACCATACAGATGCAGAAGGG - Intergenic
1059207926 9:112483985-112484007 CTTAAAAAACACATGCACAAAGG - Intronic
1059613767 9:115926934-115926956 CTAAACATAAGCCTACAGAATGG + Intergenic
1060083832 9:120678854-120678876 CTGAACAGACACATGAAAAAAGG + Intronic
1060517440 9:124274806-124274828 CTACAAATGGACATGCAGAATGG - Intronic
1060525251 9:124316730-124316752 CTACACAGGCACAGGCAGAAAGG - Intronic
1061604439 9:131698278-131698300 GTAAACAGACACTTGCAGGAAGG + Intronic
1062092567 9:134686074-134686096 CTCAACACAGACATGCAGGATGG - Intronic
1203612006 Un_KI270749v1:17226-17248 ATATACATACACACACAGAATGG + Intergenic
1185727020 X:2430298-2430320 CTAAAGTTACAAATGCAGCAAGG - Intronic
1187671984 X:21676861-21676883 ATAAACATACAGATACAGATAGG + Intergenic
1188252556 X:27915567-27915589 AGAAACATACACATGGATAAAGG - Intergenic
1188290727 X:28384862-28384884 CTAAACTTACACCTTCAGATGGG - Intergenic
1188849056 X:35110021-35110043 GTAAACATACTCATTCTGAAAGG + Intergenic
1189565397 X:42236268-42236290 GCAAACATAAACATGAAGAAAGG - Intergenic
1190469129 X:50759265-50759287 AGACACATGCACATGCAGAAAGG + Intronic
1191943339 X:66503174-66503196 CTTAAGATCCACATTCAGAAAGG - Intergenic
1192926543 X:75760030-75760052 CAAAACCTACTCATGCAGACAGG - Intergenic
1193391495 X:80934440-80934462 AAAAACATACCCATGTAGAATGG - Intergenic
1193630396 X:83879136-83879158 TTATATATACACATACAGAATGG - Intronic
1193885592 X:86981929-86981951 CTGCACATACACATCCAGATGGG + Intergenic
1193998549 X:88397983-88398005 CAGCACATACAAATGCAGAAAGG - Intergenic
1194096370 X:89644686-89644708 GTAAACTGACACATACAGAATGG + Intergenic
1197837907 X:130714797-130714819 CTAAACAGAGATATGAAGAAGGG + Intronic
1199066697 X:143427037-143427059 ATAAACATACCCATGAATAAAGG - Intergenic
1199218452 X:145289218-145289240 ATAAATATCCACATACAGAAAGG - Intergenic
1201499219 Y:14624021-14624043 CTCATCACACACATGCACAAAGG - Intronic