ID: 1168672098

View in Genome Browser
Species Human (GRCh38)
Location 19:58248356-58248378
Sequence TGCTGTGGCACCTGAGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 1, 1: 0, 2: 3, 3: 70, 4: 524}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168672098_1168672107 22 Left 1168672098 19:58248356-58248378 CCCCAGCCTCAGGTGCCACAGCA 0: 1
1: 0
2: 3
3: 70
4: 524
Right 1168672107 19:58248401-58248423 GTAAAAATTTTTTGTAGAGATGG 0: 1
1: 124
2: 1106
3: 4216
4: 10986
1168672098_1168672103 -6 Left 1168672098 19:58248356-58248378 CCCCAGCCTCAGGTGCCACAGCA 0: 1
1: 0
2: 3
3: 70
4: 524
Right 1168672103 19:58248373-58248395 ACAGCATGCACCACCATGCCTGG 0: 14
1: 48
2: 526
3: 6572
4: 20394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168672098 Original CRISPR TGCTGTGGCACCTGAGGCTG GGG (reversed) Intronic
900095265 1:937613-937635 AGCTCTGGCACGGGAGGCTGTGG + Intronic
900170061 1:1262888-1262910 TGTGGTGGCACCTGGGGCTTCGG - Intronic
900175901 1:1291242-1291264 AGCTGCGGCACCTGCGGGTGGGG - Exonic
900187660 1:1339882-1339904 TGCTGGGGGACATGCGGCTGTGG - Intronic
900187673 1:1339921-1339943 TGCTGGGGGACATGCGGCTGCGG - Intronic
900408290 1:2501970-2501992 GGCTGGGCCACCTCAGGCTGGGG - Intronic
900870527 1:5299026-5299048 GGCTGTACCACATGAGGCTGGGG + Intergenic
900979219 1:6036784-6036806 AGCAGTGGCAGCTGAGGGTGGGG + Intronic
901481693 1:9529634-9529656 TGCTGTGGGTCCAGATGCTGTGG + Intergenic
902751261 1:18513015-18513037 TGCTGTCGCTACTGAAGCTGTGG - Intergenic
903176775 1:21586269-21586291 TTCTGTGGCTCATGGGGCTGGGG - Intergenic
903218227 1:21854749-21854771 TGGGCTGGCATCTGAGGCTGGGG + Exonic
903658583 1:24963645-24963667 GGCTGTGACACCTGAGACTGGGG - Intronic
905872802 1:41414824-41414846 TGCTGTCCCTGCTGAGGCTGGGG + Intergenic
908987924 1:70047265-70047287 TGCTGTGGCAAGTGACTCTGGGG + Intronic
910289900 1:85589456-85589478 TGCTGAGCCACCTGGGGCTTGGG - Intergenic
910560330 1:88582785-88582807 TGCTGAGTCACCTGGAGCTGGGG - Intergenic
910859785 1:91732188-91732210 TGCTGTGGAAACTGAGGCTCTGG + Intronic
911536533 1:99106564-99106586 TTCTGAGCCACCTGAAGCTGGGG - Intergenic
911733682 1:101314930-101314952 CACTGTGGACCCTGAGGCTGAGG + Intergenic
911853113 1:102843050-102843072 TTCTGAGCCACCTGAAGCTGGGG - Intergenic
912520249 1:110240218-110240240 TGCTGTCCCACCTAAGGCTGGGG - Intronic
913197810 1:116472547-116472569 ATCTGTGGCCCCTGAGGCTGTGG + Intergenic
914900364 1:151708237-151708259 TGCTGTGGCAACCCAGGGTGGGG - Intronic
915246317 1:154558522-154558544 TGCTGCTGCCCCTGCGGCTGCGG + Exonic
915524780 1:156468840-156468862 TGCTGAGGCTGCTGTGGCTGTGG + Exonic
915524782 1:156468855-156468877 GGCTGTGGCTGCTGTGGCTGCGG + Exonic
915681082 1:157582548-157582570 TTCTGTGGTACCTGTGTCTGAGG - Intronic
917364126 1:174209872-174209894 TTCTGTGCCACCTGGGGCTGAGG - Intronic
917692929 1:177487595-177487617 TGCTGTTGCAGCTCAGCCTGTGG + Intergenic
917798344 1:178548252-178548274 TGCAGAGGAACATGAGGCTGGGG - Intronic
918488991 1:185060134-185060156 TGCTGTGGCATATGAGGCCCTGG + Intronic
919745452 1:201005783-201005805 AGATGTGGAAACTGAGGCTGTGG + Intronic
919804027 1:201370031-201370053 TGATGAGGCACCTGAGGCTCAGG - Intronic
920086623 1:203422206-203422228 TGCTGTCTCACCTGGGGCTCAGG - Intergenic
920688692 1:208129393-208129415 TGTTGTAGCAGCTGGGGCTGGGG + Intronic
920928110 1:210361882-210361904 TGCTGTGGGAGCCGATGCTGAGG - Intronic
920956718 1:210626355-210626377 GGCTGTGGCACCTGAGTCCAAGG - Intronic
921123847 1:212159612-212159634 TGCTGTGGCCCATGAGCCTGTGG - Intergenic
921188401 1:212689205-212689227 TGCTGTGGCGCATCAGGCAGGGG - Intronic
922499030 1:226083428-226083450 CTCTCTGGCACCTGGGGCTGGGG - Intergenic
922701453 1:227763566-227763588 TGCTGTGGCACCGCGGGCTCGGG + Intronic
922728118 1:227935185-227935207 TGCTTGGCAACCTGAGGCTGTGG - Intronic
923499304 1:234551132-234551154 TGGTGAGGCAGCTGAGGCAGTGG - Intergenic
924798980 1:247313293-247313315 TGGTGTGGAAGCTGGGGCTGAGG + Intronic
924885373 1:248210015-248210037 TGCTGTGGCAGATGGGGGTGTGG + Intergenic
1064078484 10:12288949-12288971 GGCTGAGGCACGGGAGGCTGAGG + Intergenic
1064261535 10:13790401-13790423 TGCAGTGGCAGCTGTGGATGGGG + Intronic
1064767947 10:18694066-18694088 TGCTGAGGAATCTGGGGCTGAGG + Intergenic
1065145965 10:22768393-22768415 TGATGTGGCTGCTGTGGCTGGGG + Intergenic
1066339075 10:34511839-34511861 CGCTGTGGCTCGGGAGGCTGAGG - Intronic
1067343353 10:45421373-45421395 TGCTGGGGCACCTGAGGTCCCGG - Intronic
1067407473 10:46036198-46036220 GGCAGTGGAGCCTGAGGCTGGGG - Intronic
1067560324 10:47300580-47300602 CGCTGGCGCACCGGAGGCTGCGG - Exonic
1067782084 10:49215097-49215119 GCCTATGGCACCTGAGGCTTTGG - Intergenic
1068000780 10:51331553-51331575 AGCTGTGCAACCTGAGGTTGGGG + Intronic
1068713020 10:60155217-60155239 TGCTGTGCTGCCTGGGGCTGGGG - Intronic
1069395084 10:67978751-67978773 TTCTGAGGCACCTGGAGCTGGGG - Intronic
1069576993 10:69537827-69537849 TGGTGTGGATCCTGAGGGTGGGG + Intergenic
1069579030 10:69552538-69552560 TAATGTGGGATCTGAGGCTGTGG - Intergenic
1069719272 10:70539439-70539461 GGCTGTGACCCCTGAGGCTTGGG + Intronic
1069744007 10:70703486-70703508 AGCTGTGGCACCAGAGCCAGAGG + Intronic
1069821906 10:71233627-71233649 TGCTGTGGCAGCTGAGGGGCTGG - Intronic
1069837733 10:71319636-71319658 AGCTGCGGGGCCTGAGGCTGGGG + Intronic
1069933452 10:71899439-71899461 TTCTGAGCCACCTGAAGCTGGGG + Intergenic
1070602261 10:77874004-77874026 TGCTGTGGTTCGTCAGGCTGTGG - Intronic
1072044672 10:91643095-91643117 TGCTGAGGTTCCTGAGTCTGGGG - Intergenic
1072107471 10:92288374-92288396 TGCTTGAGCCCCTGAGGCTGAGG + Intronic
1072115503 10:92366743-92366765 TGCAGAGACACCTGGGGCTGGGG + Intergenic
1072572029 10:96666871-96666893 GGCAGTGGCACCTGGGGGTGGGG - Intronic
1072605885 10:96982361-96982383 TGCTGTGGGAGCTGAGACTGTGG - Exonic
1072742424 10:97917515-97917537 AGATGTGGCTGCTGAGGCTGGGG - Exonic
1072817720 10:98526078-98526100 AACTGTGGCTTCTGAGGCTGTGG - Intronic
1074997251 10:118768308-118768330 TGCTGAGGAGCCTGAGGGTGAGG + Intergenic
1075135918 10:119786215-119786237 TGCTGTGGAGCTTGTGGCTGTGG + Intronic
1075157469 10:119990013-119990035 GGGTGTGGCATCAGAGGCTGTGG + Intergenic
1075157501 10:119990173-119990195 AGGTGTGGCATCAGAGGCTGTGG + Intergenic
1075733015 10:124647587-124647609 TCGTGTGGCAGCTGAGGCTCAGG + Intronic
1076009147 10:126973159-126973181 TCCTGTGGCCCCTGGGCCTGTGG + Intronic
1076457323 10:130609386-130609408 TTTGGTGGCACCTGAGGCTGGGG - Intergenic
1077259388 11:1607757-1607779 TGCTGCTGCTCCTCAGGCTGTGG - Exonic
1077259402 11:1607844-1607866 TGCTGCTGCTCCTCAGGCTGTGG - Exonic
1077259421 11:1607961-1607983 TGCTGCTGCTCCTCAGGCTGTGG - Exonic
1077262541 11:1630327-1630349 TGCTGCTGCTCCTCAGGCTGTGG + Exonic
1078067514 11:8088064-8088086 TGCTCTGGCAGCTGAGGGTTTGG + Intronic
1078089087 11:8252773-8252795 AGGTGTGTCACCTGGGGCTGTGG - Intronic
1078822300 11:14894342-14894364 TGCTGAGGCACCAGGAGCTGAGG + Intergenic
1079049669 11:17142927-17142949 TGGTGTGGCTCCTGCGGCAGGGG + Intronic
1079161541 11:17999537-17999559 GGCTGTGGCAGCTGAGGCTCAGG - Intronic
1079205197 11:18408800-18408822 AGCTGAGGCACAAGAGGCTGAGG + Intergenic
1079626079 11:22618729-22618751 AGCTGTGCCACCTGAGGTTAGGG + Intergenic
1080123179 11:28700911-28700933 CTCAGTGACACCTGAGGCTGTGG + Intergenic
1081164187 11:39786966-39786988 TGCTGTGGCACCAGCTGCAGTGG - Intergenic
1081627112 11:44662668-44662690 TGAGGTGCCACCTGTGGCTGGGG + Intergenic
1081671370 11:44944448-44944470 TGCTGTGGAATCTGAGGCCAGGG + Intronic
1081975144 11:47229141-47229163 TGCTGGGGCCCCTGAAGCTGAGG + Intronic
1083773819 11:64883434-64883456 TGCTGGGGCTGATGAGGCTGGGG + Intronic
1084041262 11:66543995-66544017 TGCTGGGGGAACTGACGCTGTGG - Intronic
1084646245 11:70460279-70460301 TACTGTGGCCTCTGATGCTGAGG - Intergenic
1084704684 11:70809280-70809302 TGCTGTGGCCTCTGAGGCGATGG + Intronic
1084798824 11:71527601-71527623 TGCTGCTGCTCCTCAGGCTGTGG + Exonic
1084800157 11:71538335-71538357 TGCTGTTGCTCCTCAGGCTGTGG + Exonic
1084801644 11:71548008-71548030 CTCTGTGGCAACTGTGGCTGAGG - Intronic
1084801806 11:71548913-71548935 TGCTGTTGCTCTTCAGGCTGTGG + Exonic
1084803973 11:71566029-71566051 TGCTGCTGCTCCTCAGGCTGTGG + Exonic
1084806071 11:71579802-71579824 TGCTGCTGCTCCTCAGGCTGTGG - Intronic
1085240633 11:75051073-75051095 TGCTGTGGCTCCTGTGTCAGGGG + Intergenic
1085391131 11:76182884-76182906 GTCTGTGGTTCCTGAGGCTGTGG - Intergenic
1085603938 11:77880630-77880652 TGCTATGCCAACTGGGGCTGTGG - Intronic
1087019270 11:93585976-93585998 TGCTGGGGCAGCTGGGGCAGTGG - Intergenic
1087380346 11:97398015-97398037 TTCTGAGTCACCTGAAGCTGGGG + Intergenic
1087381331 11:97408759-97408781 TGCTGTGCTGCCTGGGGCTGGGG - Intergenic
1087690936 11:101320175-101320197 TGCTGAGGTACATGAGGCTATGG + Intergenic
1088154739 11:106789872-106789894 TGCTGAGCCACCTGGGGCTTGGG + Intronic
1089352319 11:117828615-117828637 TGTCGTGGCACCTGAGGCACCGG + Intronic
1089391498 11:118104987-118105009 TCCTGAGGAACCTGAGGCTTAGG - Intronic
1089456939 11:118631260-118631282 TGATGGGGGACCTGAGGCTGGGG + Exonic
1089832764 11:121343273-121343295 TGCAGTCCCAGCTGAGGCTGAGG - Intergenic
1090934362 11:131328750-131328772 TGGTTTGGGAACTGAGGCTGTGG + Intergenic
1091812202 12:3409100-3409122 TACTGTGGCACCTGGGACTTGGG + Intronic
1092074353 12:5660904-5660926 TGGTGTGTCACCTGAAGCAGTGG - Intronic
1092239772 12:6829421-6829443 TGCTGCGGTACCGGCGGCTGCGG - Intronic
1092290432 12:7156971-7156993 GGCACTAGCACCTGAGGCTGGGG - Intronic
1092319735 12:7459822-7459844 TGCTGTGTTGCCTGAGGCTGGGG - Intronic
1092846137 12:12586910-12586932 TGCTCTGCCATATGAGGCTGCGG - Intergenic
1093667996 12:21837292-21837314 TGCTGTGGAACATGATGTTGTGG + Intronic
1094493596 12:30976205-30976227 TGCTGTGGGACCTGGAGCTCTGG + Intronic
1096734471 12:53641787-53641809 TGCAGGGGCCCCGGAGGCTGAGG + Intronic
1096825944 12:54277956-54277978 TACTCTGGAAGCTGAGGCTGAGG - Intronic
1097225362 12:57474071-57474093 AGTGGTGGCACCAGAGGCTGGGG + Exonic
1098271916 12:68777638-68777660 TTCTCTGACACCTGAGGGTGGGG - Exonic
1099882351 12:88481306-88481328 TGCTGAGCCACCTGGAGCTGTGG - Intergenic
1100163808 12:91893688-91893710 TGCTGTGATCCCTGAGGCTCTGG - Intergenic
1100590882 12:96027918-96027940 TGCTGTGGCACCTGCTGCTGTGG - Intronic
1102166084 12:110807884-110807906 TGCTGTGGGACAAGAGACTGTGG + Intergenic
1102413701 12:112742361-112742383 TGCCGTGGCTCCTGCTGCTGTGG - Intronic
1104181605 12:126386819-126386841 AGCTGAGGCTCCCGAGGCTGAGG + Intergenic
1104776384 12:131392465-131392487 TGCCCTGGCACCTGAGACAGCGG - Intergenic
1104780569 12:131417373-131417395 AGCTGTGGAAACTGAGGCTCAGG + Intergenic
1104880519 12:132067678-132067700 TGATGTGACAAGTGAGGCTGAGG + Intronic
1105544573 13:21342218-21342240 TCCTCTGCCACCTGGGGCTGGGG - Intergenic
1105881124 13:24607255-24607277 GGCTGTGGCAGCTGGTGCTGGGG + Intergenic
1106131343 13:26942179-26942201 GGCTGTGACACCAGAGGCAGAGG + Intergenic
1106516117 13:30455407-30455429 TACAGTGGCACCTGAGGCTGTGG + Intergenic
1106884117 13:34164854-34164876 TTCCCTGGCACCTGAGGCGGAGG + Intergenic
1108298725 13:49052898-49052920 TGCTGTGGGAGATGAGGGTGTGG + Intronic
1108469791 13:50756395-50756417 TGCTGTGGGAGATGAGGGTGAGG + Intronic
1108494010 13:51006659-51006681 TGCTGGAGCCTCTGAGGCTGTGG + Intergenic
1108831663 13:54487001-54487023 TGCTGTGGGGCATGAGGGTGTGG - Intergenic
1110239151 13:73247501-73247523 TGCTGGGGCACCAGAGTCTTGGG - Intergenic
1110885987 13:80636479-80636501 CGCTGTGGCAACTGCCGCTGTGG + Intergenic
1111426587 13:88092695-88092717 TTCTGAGCCACCTGAAGCTGGGG + Intergenic
1112085314 13:96025024-96025046 TCCTGTGGGAACTGAGGCTCAGG + Intronic
1112600827 13:100854303-100854325 GGCTGTGGCAGCTGGGTCTGGGG + Intergenic
1113419963 13:110163551-110163573 TCCTGTAACACCTGAGGCAGAGG + Exonic
1113768852 13:112895999-112896021 TGCTGTGAAACCTGAGATTGTGG + Intronic
1114072548 14:19126363-19126385 TTCTGAGGCACCTAAAGCTGGGG + Intergenic
1114987840 14:28252257-28252279 TTCTGAGCCACCTGAAGCTGGGG + Intergenic
1115956747 14:38789743-38789765 TGCTGGTGCACCAGAGGTTGGGG - Intergenic
1117110470 14:52447543-52447565 TTCTGAGCCACCTGGGGCTGGGG - Intronic
1117943065 14:60989680-60989702 TGCTGTTGCACTTCAGCCTGGGG + Intronic
1118084294 14:62398049-62398071 TGCTGGGCTACCTGAGGCTAGGG + Intergenic
1118613393 14:67558720-67558742 TTCTGTGGCAACTAAGGCTATGG - Intronic
1119291182 14:73496459-73496481 TGATGTGGCATCTGTGTCTGGGG + Intronic
1120860249 14:89248614-89248636 TGCTGTGCTACGTGAGGCAGTGG + Intronic
1120999714 14:90442866-90442888 TGCTGCTCCATCTGAGGCTGGGG - Intergenic
1121262441 14:92576145-92576167 AGCTGTGCCACAGGAGGCTGGGG + Intronic
1121324417 14:93011679-93011701 TGCAGGGGCACCTGGGGCTGAGG + Intronic
1121578761 14:95010610-95010632 TGCTGAGGAATCTGAGGCTCAGG - Intergenic
1122255292 14:100471915-100471937 GTCTGTGGCACGTTAGGCTGAGG + Intronic
1122883063 14:104698795-104698817 GGCTGAGGCCCCGGAGGCTGAGG - Intronic
1123117369 14:105900745-105900767 TGCGGGGGCTCCGGAGGCTGTGG + Intergenic
1123698009 15:22893170-22893192 TGCTGTGGCCCCTGAGCTTTGGG - Intronic
1123886153 15:24729960-24729982 TGCTAGGCCACCTGAAGCTGAGG - Intergenic
1125516446 15:40323785-40323807 GGCTGTGGCGGCTGTGGCTGTGG + Intergenic
1127256387 15:57297210-57297232 TGCTTAGCCACCAGAGGCTGAGG + Intronic
1127453480 15:59138281-59138303 CACTGTGGCACCTGAGGCTTGGG + Exonic
1128300601 15:66564367-66564389 GGCTGTAGGCCCTGAGGCTGTGG + Intronic
1128635239 15:69298738-69298760 TTTGGTGGCACCTCAGGCTGTGG + Intergenic
1128751465 15:70153115-70153137 TGATGAGGCACCTGGGGCTGGGG - Intergenic
1129266535 15:74396427-74396449 TGCTGTGGCACCGTGGGGTGGGG - Intergenic
1130871285 15:87974171-87974193 TGCGGTCACACCTGTGGCTGGGG + Intronic
1132091387 15:98950426-98950448 TGCAGTCTCACCTGAGGCTCAGG + Intronic
1132464905 16:72784-72806 TGCGGGGACACCTGGGGCTGGGG + Intronic
1132718905 16:1306381-1306403 GGCTGTGGCAGGTGAGGGTGAGG - Intergenic
1132751335 16:1459245-1459267 TCCTGGGGCTCCTGGGGCTGAGG - Intronic
1134013791 16:10874444-10874466 AGCTGTGGCAGGTGAGGGTGTGG - Intergenic
1135716748 16:24777079-24777101 TGCTGTGGCTGCTGCTGCTGCGG - Exonic
1135716752 16:24777118-24777140 TGCTGTGGCTGCTGCTGCTGCGG - Exonic
1136073874 16:27805023-27805045 GGCTGTGGCAGCTGGGGTTGGGG + Intronic
1136399703 16:30010759-30010781 AGAGGTGGCATCTGAGGCTGGGG - Intronic
1136591250 16:31219089-31219111 TGCTGTGGCAGCTGTGTCTGGGG - Exonic
1137300266 16:47143026-47143048 TGCTGCGGCCACGGAGGCTGCGG - Intronic
1138112596 16:54336854-54336876 TGCTGTGGCAGCTGCTGCTGGGG - Intergenic
1139854527 16:69969863-69969885 TTCTGTGCCAGCAGAGGCTGTGG - Intergenic
1139883507 16:70192778-70192800 TTCTGTGCCAGCAGAGGCTGTGG - Intergenic
1140224516 16:73067008-73067030 AGCTCTTGCACCTGGGGCTGAGG - Intergenic
1140369003 16:74402741-74402763 TTCTGTGCCAGCAGAGGCTGTGG + Intergenic
1141160914 16:81628518-81628540 TGATGTGGAAACTGAGGCTGAGG + Intronic
1141191706 16:81829826-81829848 TGCTGTGGTAGCTGTGGATGGGG + Intronic
1142419852 16:89963491-89963513 TGGTGAGGCACCTCAGGCTCAGG + Intronic
1143537465 17:7549717-7549739 GGTTGTGCCACCTGAGTCTGAGG + Intronic
1143592300 17:7892906-7892928 TGTGGCAGCACCTGAGGCTGAGG - Intronic
1143725733 17:8844128-8844150 TGCTGTGGCATCAGAGGCACAGG - Intronic
1144948854 17:18983324-18983346 TGCTGTGGGACCTGGGCGTGTGG - Intronic
1145764823 17:27451403-27451425 GGGTTTGGCACCTGAGGGTGTGG + Intergenic
1146465599 17:33083879-33083901 TGCTGTGACCACTGAGGATGTGG + Intronic
1147376132 17:40023416-40023438 TACAGTGGCACCTGAGCCTCAGG - Intronic
1147585648 17:41652760-41652782 GGCTGTGGGAGCAGAGGCTGAGG - Intergenic
1147742279 17:42676159-42676181 TGCTGGGGGCCCTGAGGCAGGGG - Intronic
1148022482 17:44562586-44562608 ACCTGTGGCACCTGGGCCTGGGG + Intergenic
1148050461 17:44767654-44767676 TGCCGGGGCAGCTGGGGCTGGGG - Intronic
1148451596 17:47781528-47781550 TGCTCTGACACTTGAGGCTATGG + Intergenic
1148505253 17:48122063-48122085 TGCTGTGACTCCTGCTGCTGGGG + Exonic
1148656403 17:49286907-49286929 TGCGGTGGCTCAGGAGGCTGAGG + Intergenic
1149014034 17:51887589-51887611 AGATGTGGAAACTGAGGCTGAGG - Intronic
1149180540 17:53931564-53931586 TGCTGAGCCACCTGGAGCTGGGG + Intergenic
1149363081 17:55914194-55914216 TGCTTGGGCATCTGAGGCTACGG + Intergenic
1149590062 17:57822388-57822410 AGCCGGTGCACCTGAGGCTGTGG - Intergenic
1149608478 17:57941709-57941731 GGATGTGGGAACTGAGGCTGAGG - Intronic
1150540060 17:66088274-66088296 GGCTTTGGAACCTGGGGCTGTGG - Intronic
1152039192 17:77892218-77892240 CACTGTGGCCCCTGAGGATGGGG + Intergenic
1152082919 17:78199694-78199716 TGCTGTGGCCACCAAGGCTGGGG + Intronic
1152421852 17:80197922-80197944 GGCAGTGGGGCCTGAGGCTGAGG + Intronic
1152636273 17:81431731-81431753 AGCTGAGGAAACTGAGGCTGAGG + Intronic
1152662194 17:81547719-81547741 AGATGTGGCACCTGGTGCTGTGG - Intronic
1152703544 17:81831711-81831733 TGCTGTGGCCCCGGAGGCCCTGG - Intronic
1152844399 17:82591005-82591027 TGCTGTGGGACCCGGGGCTCAGG + Intronic
1153537511 18:6117958-6117980 TTCTCAGGCACCTGAGCCTGTGG - Intronic
1153599555 18:6766446-6766468 AAGTGTGGCAACTGAGGCTGTGG - Intronic
1154316118 18:13304502-13304524 TGCTGTCGCAGCACAGGCTGTGG + Intronic
1155371031 18:25100989-25101011 TTCTGTGGCACATGCAGCTGTGG + Intronic
1155526505 18:26721303-26721325 TTCTGTGGCAGCTGGGGATGGGG + Intergenic
1156481012 18:37436442-37436464 AGATGTGGAAACTGAGGCTGGGG + Intronic
1158203774 18:54968530-54968552 CGTGGTGGCGCCTGAGGCTGAGG - Intergenic
1158920591 18:62187301-62187323 TGCTGGTGCAGCAGAGGCTGAGG + Exonic
1160165274 18:76506388-76506410 CGCTGTGGGACCTGTGCCTGGGG - Intergenic
1160584232 18:79903877-79903899 TGCTGTGGCCCCTGCAGGTGTGG - Exonic
1160780904 19:877658-877680 TGCTGGGGCACGTGGGTCTGGGG - Intronic
1160780920 19:877714-877736 TGCTGGGGCACGTGGGGCAGGGG - Intronic
1160780946 19:877788-877810 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160780978 19:877900-877922 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781000 19:877968-877990 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781018 19:878030-878052 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781040 19:878092-878114 TGCTGGGGCACGTGGCGCTGGGG - Intronic
1160781083 19:878248-878270 TGCTGGGGCCCGTGGGGCTGGGG - Intronic
1160781100 19:878304-878326 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781122 19:878372-878394 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781149 19:878446-878468 TGCTGGGGCACGTGGGGCCGGGG - Intronic
1160781166 19:878502-878524 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781185 19:878564-878586 TGCTGGGGCATGTGGGGCTGGGG - Intronic
1160781202 19:878626-878648 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781218 19:878682-878704 TGCTGGGGCACGTGGGGTTGGGG - Intronic
1160781255 19:878794-878816 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781280 19:878862-878884 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781315 19:878948-878970 TGCTGGGGCACGTGGAGCTGCGG - Intronic
1160781351 19:879072-879094 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781376 19:879140-879162 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781434 19:879372-879394 TGCTGGGGCATGTGCGGCTGGGG - Intronic
1160781448 19:879428-879450 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781465 19:879484-879506 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781517 19:879676-879698 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781541 19:879764-879786 TGCTGGGGCACGTGGGGCTGGGG - Intronic
1160781584 19:879908-879930 TGCTGGGGCACGTGGGGCCGGGG - Intronic
1160816040 19:1036261-1036283 TGCCGTGGTCCCTGGGGCTGGGG - Intronic
1161153916 19:2722570-2722592 TCCTGTTGCCACTGAGGCTGGGG + Intronic
1161192961 19:2969496-2969518 TGGTGTGGAGCCTGAGGGTGGGG + Intergenic
1161303641 19:3555541-3555563 TCCTGGGGTACCTGAGGCGGCGG - Intronic
1161398223 19:4055969-4055991 AGCTGGGGAAACTGAGGCTGGGG - Intronic
1161398249 19:4056121-4056143 AGCTGGGGAAACTGAGGCTGGGG - Intronic
1161479610 19:4503997-4504019 TGCTGTGGCATCCCAGGCTCCGG - Exonic
1162535906 19:11262614-11262636 GGCTGGGGAAACTGAGGCTGGGG + Intergenic
1162535942 19:11262719-11262741 GGCTGGGGAAACTGAGGCTGAGG + Intergenic
1162997388 19:14344846-14344868 TGATGAGGAAGCTGAGGCTGGGG - Intergenic
1163295925 19:16412777-16412799 AGCAGTGGCATCTGGGGCTGGGG + Intronic
1163368490 19:16889206-16889228 TCCTGTGGCCCCTGGTGCTGGGG + Exonic
1163370009 19:16896618-16896640 TGCCGTGGCCCCTGAGGAGGGGG - Exonic
1164477191 19:28584950-28584972 GGCATTGGGACCTGAGGCTGGGG + Intergenic
1164580622 19:29432879-29432901 TACCGTGGCACCTGGGGCTGGGG - Intergenic
1164887017 19:31787571-31787593 TCAGGTGGCAGCTGAGGCTGGGG + Intergenic
1165256117 19:34578053-34578075 GTGTGTGGCACCTGAGGTTGGGG + Intergenic
1165490449 19:36120320-36120342 TGCTCTGGGGCCTGAGGTTGGGG + Intronic
1165733200 19:38159417-38159439 AGGAGTGGGACCTGAGGCTGAGG - Intronic
1165733976 19:38164293-38164315 AGATGTGGAAACTGAGGCTGAGG + Intronic
1166007695 19:39918393-39918415 GGCTCTGGCTCCTGACGCTGTGG - Exonic
1166731908 19:45064125-45064147 TGCTGCGGCAGCAGCGGCTGCGG - Exonic
1166732574 19:45067376-45067398 TGCTGTGGTGCCTGAGGCCCCGG - Exonic
1166890672 19:45990571-45990593 TGTTGTGGTGCCAGAGGCTGGGG - Intergenic
1167043371 19:47036022-47036044 TGCTGGAGCAACTGGGGCTGCGG + Exonic
1167053598 19:47095154-47095176 GTCAGTGCCACCTGAGGCTGAGG + Intronic
1167384219 19:49154760-49154782 GGCTGTGGCTCCTGTGGCTGGGG + Exonic
1167534556 19:50041483-50041505 AGCTGTGACAGCTGGGGCTGGGG - Intronic
1168113879 19:54209939-54209961 TGTTCTAGCACATGAGGCTGAGG + Intronic
1168419625 19:56192831-56192853 AGCTGTGCCATCTGTGGCTGAGG - Exonic
1168421341 19:56206113-56206135 AGCTGTGCCATCTGTGGCTGAGG + Exonic
1168424118 19:56224825-56224847 AGCTGTGCCATCTGTGGCTGAGG - Exonic
1168426596 19:56244242-56244264 AGCTGTGCCATCTGTGGCTGAGG + Exonic
1168672098 19:58248356-58248378 TGCTGTGGCACCTGAGGCTGGGG - Intronic
925074876 2:1007456-1007478 TACTGTGGAAACTGAGGCTCAGG - Intronic
925348118 2:3184424-3184446 TGCGGTGTCGCCTGTGGCTGTGG - Intergenic
925671017 2:6310024-6310046 AGCTGGGGCAGCTGAGGCTGTGG + Intergenic
925984832 2:9207042-9207064 TGCTGCGGCAGTTGAGGCGGCGG + Exonic
926423822 2:12723504-12723526 TGCTGCGGGACCTCAAGCTGCGG + Exonic
927570164 2:24152645-24152667 TGCTGAGCCACCTGGAGCTGGGG + Intronic
927989917 2:27440839-27440861 TGCTGTGGCTGCTGGGGCCGAGG - Exonic
928786108 2:34887953-34887975 AGCTGTGCAGCCTGAGGCTGAGG + Intergenic
928871564 2:35987149-35987171 TGGTGTAGCACATGAGGCAGTGG - Intergenic
929242418 2:39666156-39666178 CGCTGTCGCACCTGCCGCTGCGG + Exonic
929552805 2:42905144-42905166 TGCTGAGGCAACTGAGGCTCAGG + Intergenic
929558104 2:42937887-42937909 TAGTGTGACCCCTGAGGCTGTGG - Intergenic
930042673 2:47140178-47140200 TCCTGTGCCACCTAAGGGTGAGG - Intronic
930065084 2:47321753-47321775 TGCTGTGGCTCAGGGGGCTGGGG + Intergenic
931440541 2:62287316-62287338 GACTGTGGCACCAGAGGCAGAGG - Intergenic
931564473 2:63600943-63600965 TGTTGTTTCACCTGAGGCTTTGG + Intronic
932140557 2:69273625-69273647 GGCTGTGGAACGTGAGGCTGAGG - Intergenic
932314433 2:70770131-70770153 TGCTGTGGCTCCAGAGTTTGTGG + Intergenic
932405784 2:71511966-71511988 GGCAGTGGCACTTGAGCCTGGGG + Intronic
932436348 2:71704509-71704531 TGGTGAGGCAGCTGAGGCTGAGG + Intergenic
933168798 2:79102139-79102161 TGCTGTAACATATGAGGCTGAGG - Intergenic
933601090 2:84330895-84330917 TGCTGAGCCACCTGAAACTGGGG - Intergenic
933774003 2:85760983-85761005 TGCAGTGGCAGCCCAGGCTGGGG + Intronic
934054388 2:88239907-88239929 TGCTGTGGCCCCTGAGCCTGCGG + Intergenic
934116934 2:88807564-88807586 TGAGGTTGCAACTGAGGCTGTGG - Intergenic
934864341 2:97792577-97792599 GGCTGCGGCTCCTGGGGCTGAGG + Exonic
935576420 2:104716305-104716327 TGCTGAGTCACCTGAAGCTGCGG - Intergenic
935576465 2:104716795-104716817 TGCTGAGCCACCTGAAGCTGGGG + Intergenic
935586535 2:104804657-104804679 TGCTCCATCACCTGAGGCTGTGG - Intergenic
936160432 2:110080516-110080538 TGAGGTTGCAACTGAGGCTGTGG - Intergenic
936184232 2:110290838-110290860 TGAGGTTGCAACTGAGGCTGTGG + Intergenic
936493147 2:112993092-112993114 TCCTTTGGCAGCAGAGGCTGAGG + Intergenic
937224159 2:120358638-120358660 TGCTGGAGCAACTGAGGCTGAGG + Intergenic
937269440 2:120638800-120638822 TGGTGAGGCTCCTGGGGCTGTGG - Intergenic
937303754 2:120858625-120858647 TGCTGTGGACCCTGTGGCTCAGG + Intronic
937382718 2:121395137-121395159 TGCAGTCTCATCTGAGGCTGAGG - Intronic
937512446 2:122611459-122611481 AGCTGTGCTGCCTGAGGCTGGGG - Intergenic
937925120 2:127162262-127162284 TGCTGTGGGTGCTGAGGGTGAGG - Intergenic
938079594 2:128362707-128362729 TGCTGTGGCCCCTGAGGGCTGGG + Intergenic
938130830 2:128714591-128714613 AGCTGGGTCACATGAGGCTGTGG - Intergenic
939480906 2:142745946-142745968 TACTGTGGGAGCTGAAGCTGTGG + Intergenic
940266532 2:151844720-151844742 TCCTGTGCCATCTGAGTCTGTGG - Intronic
940328510 2:152450965-152450987 AGCTGTGCCAACTGAGGATGGGG - Intronic
940503673 2:154526775-154526797 TTCTGTGCCACCTGGAGCTGGGG + Intergenic
941309445 2:163910994-163911016 TCCTGTGGCACCTGACAGTGTGG - Intergenic
941858626 2:170255020-170255042 TGGTGTGGCACCTGTGGCCTGGG - Intronic
942456067 2:176139310-176139332 TGCGGGGGCACCGGAAGCTGGGG + Intergenic
943288994 2:186043766-186043788 GGCTGAGACACCTGAGGTTGAGG + Intergenic
943400911 2:187409927-187409949 AGCTGTGTCAGGTGAGGCTGTGG + Intronic
943913209 2:193594072-193594094 TGCTGAGACACCTGGAGCTGGGG - Intergenic
944822261 2:203442657-203442679 TCATTTGGCACCTGAGACTGAGG + Exonic
945210345 2:207375860-207375882 TGCTGAGCCACCTGGAGCTGGGG - Intergenic
946197567 2:218044167-218044189 TGCTGTGGCACCCAGGGGTGGGG + Intronic
946405179 2:219488655-219488677 GGCTGTGGCCCGTGAGCCTGGGG + Exonic
948816836 2:240514859-240514881 GGCTGGGGCATCTGAGGCAGAGG - Intronic
948884989 2:240877919-240877941 TCCTCTGGAACCTGAAGCTGGGG + Intronic
1168836240 20:879693-879715 TGCTCTGAAACCTGGGGCTGGGG - Intronic
1168838954 20:896703-896725 GGCTGTGTGACCTTAGGCTGGGG + Intronic
1169049956 20:2567259-2567281 TCCTTTGACACCTGAGGCTGAGG - Intronic
1169194006 20:3673780-3673802 TGCAGTGGCGCCGGGGGCTGTGG - Exonic
1169597240 20:7214228-7214250 AGCTGTACCACCTGAGGTTGGGG - Intergenic
1169987181 20:11458331-11458353 TGCTGTGGGACCAGAGACAGTGG - Intergenic
1170372481 20:15664660-15664682 TGGTCTGGAACCTCAGGCTGAGG + Intronic
1170587709 20:17747658-17747680 TGCTGTGTCAGCTCAGGTTGTGG - Intergenic
1170774025 20:19359628-19359650 GGCTGAGGCACCTGGGGCTGGGG - Intronic
1170863984 20:20137125-20137147 TGTTGAGCCACCTGAAGCTGGGG + Intronic
1170943543 20:20869247-20869269 TTCTGTGGAATCTGAGGCTCAGG + Intergenic
1172225995 20:33305740-33305762 TGGTGGGGCCCCTGAGGATGGGG + Intronic
1172413414 20:34743221-34743243 TGCTGAGGCAGTTGTGGCTGTGG + Exonic
1172447796 20:35002223-35002245 TGCTGTTGCACATCTGGCTGAGG + Exonic
1172634431 20:36400646-36400668 TGATGGGGAAACTGAGGCTGGGG + Intronic
1173252587 20:41372400-41372422 AGCTGTGCCCCCTCAGGCTGTGG + Intergenic
1173480570 20:43395650-43395672 TGATGTGGAAACTGAGGCTCAGG - Intergenic
1173596278 20:44260613-44260635 TTCTGTGGCCCCGGAGGCTGGGG - Intronic
1173843706 20:46175039-46175061 TGTGGTGGCGCCTGAGGGTGAGG + Exonic
1174515683 20:51090695-51090717 AGCTGTGGGACCTGTAGCTGTGG - Intergenic
1175492341 20:59387684-59387706 TGTTGTCACATCTGAGGCTGAGG + Intergenic
1175613759 20:60374602-60374624 TGCTCTGGCATCTGAGGCCTTGG - Intergenic
1175954762 20:62603612-62603634 TGCTATGGCACCTCGAGCTGGGG + Intergenic
1176258885 20:64168653-64168675 TGCTCTGGCAACTGAGTGTGTGG + Intronic
1177876289 21:26635746-26635768 TCCTATGGCAGCTGAAGCTGTGG + Intergenic
1178329131 21:31671970-31671992 TGCTGGGGCGCCTGCGGCTGTGG + Exonic
1178596654 21:33960379-33960401 TGCAGAGGCACAAGAGGCTGAGG - Intergenic
1179132169 21:38647678-38647700 TTCTGTGTCACCTGAGGCACTGG - Intronic
1179435283 21:41358444-41358466 TGCTGGGGCCCCTGAGGAAGGGG - Intergenic
1179984244 21:44912278-44912300 TGCTGTGGCCCGGGAGGCTCGGG + Intronic
1180198926 21:46213335-46213357 TGCTGAGGCACCAGAGGAAGAGG + Intronic
1180962167 22:19766963-19766985 CGCGGTGGCCCCTGGGGCTGGGG - Exonic
1181025899 22:20127524-20127546 TGCTGTGGGCCTTGAAGCTGAGG + Intergenic
1181273788 22:21676058-21676080 TGCTGTAGCACCTGAGGCCAAGG + Intronic
1181480688 22:23197509-23197531 AGATGTGGAACTTGAGGCTGTGG + Intronic
1184116511 22:42425821-42425843 GCCTGAGGCACGTGAGGCTGTGG - Intronic
1184175538 22:42786833-42786855 GGCTGTGAGATCTGAGGCTGGGG + Intergenic
1184296234 22:43527248-43527270 TGTTGTGGGACCTGGGCCTGTGG - Intergenic
1184466506 22:44671531-44671553 TGCTGGGCCACCAGAAGCTGAGG - Intronic
1184694791 22:46133288-46133310 TGCTGGGGGGCCTGAGGCTCTGG + Intergenic
1184986613 22:48140334-48140356 TGCTGTGGGAGCTGAGCCTGTGG + Intergenic
1185050303 22:48550872-48550894 TCCTGTGTCACCTGGGGGTGAGG + Intronic
1185053626 22:48566645-48566667 TGCTGAGGAAACTAAGGCTGAGG - Intronic
949230448 3:1744146-1744168 GGCTGTGGCTTCAGAGGCTGTGG - Intergenic
949529276 3:4938329-4938351 TACTGTGGCTCATGAGTCTGTGG + Intergenic
949853929 3:8442649-8442671 TGCCTTGGAACCTGTGGCTGTGG - Intergenic
949881111 3:8661660-8661682 TCCTGTGGAAACTGAGGCTGAGG - Intronic
950683733 3:14602453-14602475 TCCTTTGGCCCCCGAGGCTGCGG - Intergenic
950695519 3:14698640-14698662 TGCTGAGCCACCTGGAGCTGGGG + Intronic
950788421 3:15454087-15454109 CGCTGTGGGACCAGAGCCTGTGG - Intronic
951109361 3:18783944-18783966 TCCTGTGGGAACTGAGGCTCAGG - Intergenic
951388427 3:22071841-22071863 TGCTCTGCCATCTGTGGCTGGGG + Intronic
951591158 3:24266576-24266598 TGCAGTGGATCCTGTGGCTGTGG - Intronic
953349913 3:42207683-42207705 TGCTGTGGCATCTGGGACTCGGG + Intronic
953391031 3:42533857-42533879 TGCTGTGGGACCTCAGGCCTTGG + Intronic
953551385 3:43906438-43906460 GGCTGTGGCTGCTGAGGCTTGGG + Intergenic
954313408 3:49787124-49787146 TGCTGTGGCAGCACAGACTGCGG - Intergenic
959717142 3:109444935-109444957 TGCTGAGCTGCCTGAGGCTGGGG - Intergenic
961058337 3:123807858-123807880 TGATGCAGCACCTAAGGCTGGGG - Intronic
961313386 3:126017813-126017835 GTCTGGGGCACCTGAGGCAGAGG - Intronic
961471647 3:127117174-127117196 TGCTGTGGACCATGGGGCTGTGG + Intergenic
961573402 3:127816514-127816536 GGGTGTGGCACCTGTGGCTCTGG - Intronic
962069679 3:132020335-132020357 TGATGTGGAGGCTGAGGCTGGGG + Intronic
962784495 3:138754184-138754206 TGCTGTGGCTCTGAAGGCTGAGG + Intronic
963515417 3:146301936-146301958 TTCTGAGCCACCTAAGGCTGGGG - Intergenic
964384493 3:156132557-156132579 GTCTGTGGCACCAGAGTCTGTGG - Intronic
966222749 3:177566775-177566797 TGCTGTGTGGCCTGGGGCTGGGG - Intergenic
966517126 3:180830183-180830205 TGCTGCAGCAGCAGAGGCTGAGG - Intronic
967609380 3:191484767-191484789 TGCTGAGTCACCTGGAGCTGTGG - Intergenic
968284860 3:197502544-197502566 AGCTGGAGCACCTGTGGCTGTGG - Intergenic
968584643 4:1410538-1410560 TGCGGAGGCACACGAGGCTGGGG - Intergenic
968897875 4:3415384-3415406 TGCTGTGAAAGCTGTGGCTGAGG - Intronic
968899178 4:3422899-3422921 TGGTGCAGCACCAGAGGCTGAGG - Exonic
968912897 4:3484940-3484962 AGCTGTGCCACCTGGAGCTGGGG - Intronic
968917047 4:3501113-3501135 TGCTGTGGCATCTCAGGCAGAGG + Intronic
970225401 4:13851863-13851885 TGCTGTGGCCCCTGGTGATGAGG - Intergenic
971682938 4:29724720-29724742 TGGTGTGGCACCTGATGATCAGG + Intergenic
972278328 4:37580624-37580646 TACTGAGCCACCTGAAGCTGGGG + Intronic
972561444 4:40232418-40232440 TGGTGAGGCACCGGAGGCGGGGG + Intronic
972629662 4:40832509-40832531 GGGTGTGGCACGTGAGGCAGGGG - Intronic
975252832 4:72198893-72198915 TTCTGAGGCACCTGGAGCTGGGG - Intergenic
976617006 4:87088348-87088370 TGCTGTCTCTCCTGAGGCTGTGG + Intronic
976963819 4:91011474-91011496 TATTGTGGCACCTGAGTCTTGGG + Intronic
977184997 4:93925664-93925686 TTCTGAGCCACCTGAAGCTGGGG - Intergenic
977753473 4:100636196-100636218 TTCTGAGCCACCTGAAGCTGGGG - Intronic
977960769 4:103082664-103082686 TGCTTGGGAAGCTGAGGCTGGGG - Intronic
977984304 4:103363645-103363667 AGATGTGGCACTTGGGGCTGTGG - Intergenic
978381208 4:108131082-108131104 TGCTCTGGCGGCTGAGGCGGAGG - Intronic
980283776 4:130756235-130756257 CACTGTGTTACCTGAGGCTGGGG + Intergenic
981558494 4:146022424-146022446 TTCTGAGACACCTGGGGCTGGGG + Intergenic
982475663 4:155847389-155847411 TGCTGTGGGGCCTGAAGATGAGG - Intronic
982493750 4:156063977-156063999 GGCTGTGCCCACTGAGGCTGTGG + Intergenic
983690634 4:170465138-170465160 TGATGTGGCACCTGTGGCTTGGG + Intergenic
985587209 5:746625-746647 TGCTCTGCCACCTGAGGCAAGGG + Intronic
985693056 5:1324043-1324065 TGCGGTGCCTCCTGGGGCTGTGG - Intronic
986195831 5:5535775-5535797 CTCTGTGGCACCTCAGTCTGAGG + Intergenic
987129455 5:14847326-14847348 TGCTGTGGAGGCTGAGGATGTGG + Intronic
987436900 5:17905906-17905928 TGCTGTGGCATATGAGGGTGTGG + Intergenic
987631567 5:20478881-20478903 AGCTGAGTCATCTGAGGCTGAGG - Intronic
988114938 5:26874708-26874730 TGCTGTGGGATGTGAGGCTCGGG + Intergenic
988558619 5:32260345-32260367 TGCTGGGGCACCAGTGGATGGGG + Intronic
990237955 5:53788145-53788167 TGCTGTGGGAGTTTAGGCTGGGG + Intergenic
990810391 5:59715879-59715901 TGCTGTGGCCTCTGGGTCTGGGG + Intronic
993200198 5:84806038-84806060 TGCCGTGGCACATGTGGCTATGG - Intergenic
993981382 5:94546494-94546516 TGCTGAGCCACCTGGAGCTGGGG - Intronic
994397993 5:99242663-99242685 TGCTGTGGCTTTTGGGGCTGTGG + Intergenic
994845670 5:104986378-104986400 TTCTGAGCCACCTGAAGCTGGGG + Intergenic
995509388 5:112892965-112892987 TGCGGTGGCTCCTGCGGCTCTGG - Exonic
997724611 5:136110053-136110075 TGCTCTAGAACCTGAGTCTGAGG + Intergenic
997790506 5:136755375-136755397 TGCTCTGGGACAAGAGGCTGAGG - Intergenic
997838701 5:137218350-137218372 TCCTCTGGCACCTGATGATGTGG - Intronic
997944243 5:138184969-138184991 TGCTCTGTCACCTGAGACAGAGG + Intronic
998005922 5:138657025-138657047 TCCTGTGGTCCCTGGGGCTGAGG + Intronic
998095950 5:139395541-139395563 TGCTAAGGCACCCGGGGCTGAGG - Exonic
999373465 5:151070100-151070122 AGATGAGGCACCTGAGGCTCAGG - Intronic
999500899 5:152145539-152145561 TGCTGTTGAAACTGAGGCAGTGG + Intergenic
999973694 5:156890088-156890110 TGCTGAGGAACCTGAGGATAAGG - Intergenic
1001051943 5:168420747-168420769 TGCAGGAGCAGCTGAGGCTGAGG - Intronic
1001562775 5:172680238-172680260 TGCTGAGGGAGCTGAGGCTCTGG + Intronic
1001571647 5:172734069-172734091 CACTGTGGGACATGAGGCTGGGG - Intergenic
1001780956 5:174368750-174368772 TGCTGTGGCTACTGATGATGAGG - Intergenic
1002334227 5:178466937-178466959 AGCTGGGGAAACTGAGGCTGTGG - Intronic
1002444126 5:179278736-179278758 TGCGGTGGCACCTGAAGGTCAGG - Intronic
1002567382 5:180119555-180119577 AGCTGAGGCACTTGAGGCTCAGG + Intronic
1002831880 6:829857-829879 GTCTGTGGCAAGTGAGGCTGTGG + Intergenic
1003325367 6:5086290-5086312 TGCTGTGGCTCCAGCGGCTCGGG - Exonic
1003564184 6:7208545-7208567 TGCTTTTGCACCTGGGGCTCCGG + Intronic
1003874781 6:10425942-10425964 GGCTGTGGTGCCTGAGGCTGGGG - Intergenic
1004628022 6:17394292-17394314 TGCAGAGGCAACTGAGACTGGGG + Intronic
1006001159 6:30966141-30966163 TGCAGTGGCCCCAGAGGCTGTGG - Intergenic
1006018478 6:31102508-31102530 TGCTGAGCCACCTGGAGCTGGGG + Intergenic
1006189209 6:32197310-32197332 TGCTGTGGCTGCTGATGCTCGGG - Exonic
1006897619 6:37480945-37480967 TGCTGGGGCCCCTGCTGCTGTGG - Exonic
1007497274 6:42268854-42268876 TGCACTGGCACCTGAGCCAGAGG + Exonic
1007895670 6:45355097-45355119 TCCTGTGGCTCCTGATGCTTGGG - Intronic
1008545251 6:52577493-52577515 GGCTGTGGCCCCGGGGGCTGAGG + Intergenic
1008613894 6:53207895-53207917 TGCTGTGTAGGCTGAGGCTGGGG - Intergenic
1008880880 6:56378854-56378876 TTCTGAGCCACCTGAAGCTGGGG - Intronic
1009771128 6:68144463-68144485 TTCTGAGCCACCTGAAGCTGGGG + Intergenic
1011008953 6:82681932-82681954 TGATGTGCCACCTGAGGCCATGG - Intergenic
1011033314 6:82945234-82945256 TGCTGAGCCACCTGGGGCTGAGG - Intronic
1011291067 6:85778305-85778327 TGCTGAGCCACCTGGAGCTGGGG + Intergenic
1015498921 6:133910020-133910042 TCCAGTGACACCTGAGGGTGGGG - Intergenic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1016682351 6:146845347-146845369 TGCTGTGGCTTCAGAGGGTGTGG - Intergenic
1016842467 6:148538190-148538212 TGCTGTGTCTGCTGAGGCTGGGG + Intronic
1017030794 6:150219885-150219907 TGCTCTGTCACCCCAGGCTGGGG + Intronic
1018092073 6:160354282-160354304 TGCTGAGGAAACTGAGGCTCAGG - Intronic
1018345254 6:162892872-162892894 GGCCGAGGCTCCTGAGGCTGAGG - Intronic
1018345265 6:162892912-162892934 GGCCGAGGCTCCTGAGGCTGAGG - Intronic
1018345287 6:162892998-162893020 GGCCGAGGCTCCTGAGGCTGAGG - Intronic
1018477136 6:164154292-164154314 TGCTTTGGCTATTGAGGCTGTGG + Intergenic
1019139414 6:169934144-169934166 TGCTGAAGCACCTTTGGCTGTGG + Intergenic
1019273987 7:166333-166355 TGCTGTGTCCCCCAAGGCTGGGG - Intergenic
1019291129 7:250875-250897 GGCGCTGGCACCTGAGGATGGGG - Intronic
1019452097 7:1104282-1104304 TGCAGTGGCCCGGGAGGCTGAGG + Intronic
1019552483 7:1610090-1610112 CGCTGTGGCACCTGAGACACAGG - Intergenic
1019727892 7:2612933-2612955 TGCTTTGGCACTTGACGCTGGGG - Exonic
1020132793 7:5569062-5569084 AGCAGTGGCACAGGAGGCTGAGG + Intergenic
1021301298 7:18976075-18976097 TGCTGTGGCATCTGTGGCTTTGG - Intronic
1021467824 7:20966241-20966263 AGATGAGGCAACTGAGGCTGAGG + Intergenic
1021765399 7:23943657-23943679 AGCTGTTGTTCCTGAGGCTGGGG + Intergenic
1022348366 7:29539848-29539870 TTCTGAGCCACCTGAAGCTGGGG - Intergenic
1022522887 7:31019352-31019374 TGATGTGGGTCCTGTGGCTGTGG - Intergenic
1022671785 7:32462638-32462660 GTCTGTGTCACCTGAGGCTCTGG - Intergenic
1022710555 7:32845225-32845247 GGCAGTGACACTTGAGGCTGAGG + Intergenic
1024282249 7:47728962-47728984 TGCAGTGGCAGTGGAGGCTGGGG - Intronic
1024343154 7:48287222-48287244 GGTGGAGGCACCTGAGGCTGCGG + Intronic
1025936127 7:66038976-66038998 GGATGTGGAACCTGAGGCTAAGG - Intergenic
1025948089 7:66120258-66120280 GGATGTGGAACCTGAGGCTAAGG + Intronic
1026992949 7:74597959-74597981 GGCTGTGCCACCCCAGGCTGTGG - Intronic
1027233642 7:76285723-76285745 TGCTGTAGCTCCCGTGGCTGTGG - Exonic
1027857498 7:83531460-83531482 TACTCTGGAACCAGAGGCTGAGG - Intronic
1029414775 7:100436000-100436022 TCCTGCGGCACCGCAGGCTGCGG + Exonic
1030957095 7:115867438-115867460 TGATGTGACAAATGAGGCTGGGG + Intergenic
1031758722 7:125682222-125682244 TGCTGAGCCACCTGGAGCTGAGG - Intergenic
1033691451 7:143741060-143741082 TTCTGTGCCACCTAAAGCTGGGG - Intergenic
1033806257 7:144957362-144957384 AGCTGTGGCATCTGGTGCTGGGG + Intergenic
1034092291 7:148374999-148375021 TGACAGGGCACCTGAGGCTGAGG + Intronic
1034196321 7:149250886-149250908 ACCTGTGGCTCCTGTGGCTGTGG + Intronic
1034658045 7:152744932-152744954 TGCTGAGGCAATGGAGGCTGAGG - Intergenic
1034934163 7:155187781-155187803 TGCTGTGTAATCTGGGGCTGAGG + Intergenic
1035013228 7:155739751-155739773 TGCTGAGGTTGCTGAGGCTGAGG - Exonic
1035068231 7:156123167-156123189 GGCCGTGTCACCTGAGGATGAGG - Intergenic
1035216937 7:157374742-157374764 TGCTGTGAGAACTGAGGCTCTGG + Intronic
1035352411 7:158255960-158255982 TCCTGTGGCATCTAAGTCTGAGG - Intronic
1037731841 8:21532568-21532590 TGCAGAGGCACCTGTGGGTGGGG + Intergenic
1038446586 8:27608804-27608826 GGCTGTGTCAGCTGATGCTGAGG - Intronic
1040831775 8:51684907-51684929 TGCTGTCTCATCTGAGGCTGGGG - Intronic
1041253416 8:55957145-55957167 TGATGTGGAAACTGAGGCTAGGG - Intronic
1042146996 8:65740358-65740380 TTCTGTGACATATGAGGCTGTGG - Intronic
1045537464 8:103045267-103045289 TGCTGTGGCAATAGAGACTGAGG + Intronic
1046329620 8:112698027-112698049 GGCAGTGGCACCAGAGGTTGAGG + Intronic
1047500096 8:125433561-125433583 TGCTGGGGGACCTGAAGCTTAGG + Exonic
1049024046 8:139976594-139976616 TGGTGAGGCACCTGAGCCTTTGG - Intronic
1049734615 8:144198291-144198313 TGCTGTGACACCTGCGAGTGGGG + Intronic
1049833530 8:144717950-144717972 TGCTGTGGACCCTGGGACTGAGG - Intergenic
1050577467 9:7012174-7012196 TACTGTGGAAGCTGAGGCAGAGG - Intronic
1050827372 9:9965220-9965242 TGCTGTGGAACCTCAGGTTGGGG + Intronic
1052970809 9:34376369-34376391 AGCTGTGGCAGCCAAGGCTGAGG - Intronic
1053001264 9:34578363-34578385 AGATGTGGCACTTGATGCTGGGG + Intronic
1053028121 9:34748505-34748527 TGCTGAGCCATCTGAGGCTGGGG - Intergenic
1055387377 9:75776583-75776605 TGCTGAGTCACCTGGAGCTGGGG - Intergenic
1055474072 9:76643968-76643990 TACAGTGGCACCTCAGGCTCGGG + Intronic
1056589102 9:87951370-87951392 TGGTGTGGCACCTGTGGCCCAGG + Intergenic
1056601810 9:88052765-88052787 AGCTGTGGCAGCTGGGGGTGGGG - Intergenic
1057226932 9:93297317-93297339 TGATGTGGGACCTGTGGCAGTGG + Intronic
1057506384 9:95636730-95636752 TGCTGTGGTATCTAAGGATGGGG - Intergenic
1058093441 9:100831555-100831577 TGCTGTGGCAGATGTTGCTGTGG - Intergenic
1058798408 9:108520507-108520529 GGCTGTGGAAACTGAGGCTCGGG - Intergenic
1059637016 9:116180876-116180898 TGCTGTGGGACTTTAGGCAGGGG + Intronic
1059877952 9:118657292-118657314 TGCTGTGCCTCCTAAGGGTGGGG - Intergenic
1060084008 9:120680495-120680517 TGCTGAGCCACCTGAAACTGGGG + Intronic
1060268818 9:122127319-122127341 TGCTTTGGGTGCTGAGGCTGGGG + Intergenic
1060519497 9:124286360-124286382 AGCCGGGGAACCTGAGGCTGGGG - Intronic
1061022662 9:128026348-128026370 TGCTGTGGCCCCTGTGTCTGGGG + Intergenic
1061606812 9:131717046-131717068 GGCTGTGGGACCCGAGGCTGTGG - Intronic
1061785138 9:133023319-133023341 TGCTGGGGCAACTGAGGGCGGGG + Intergenic
1061803499 9:133125930-133125952 TGCTGTGGGGACTGAGGCCGTGG + Intronic
1062266873 9:135690587-135690609 TGCTGGGTCACATGAGGGTGGGG - Intergenic
1062519649 9:136952335-136952357 TGCTGTGTGGCCTGTGGCTGTGG + Exonic
1062614768 9:137391368-137391390 TGCTGAGGTGCCTGGGGCTGGGG - Intronic
1189597498 X:42584925-42584947 TGCTGTGGCTGGTGAGGGTGGGG - Intergenic
1192822301 X:74658001-74658023 TGCTGAGCCACCTGAAGCTAGGG + Intergenic
1193799220 X:85914729-85914751 TGCTGTGGCAGCTGGGGCACAGG - Intronic
1194505028 X:94723836-94723858 TGCTGTGGGACATGAGGGTGCGG + Intergenic
1195330702 X:103796941-103796963 AGCTGTAGCCCCAGAGGCTGCGG + Intergenic
1195971393 X:110477654-110477676 TTCTGAGCCACCTGAAGCTGGGG + Intergenic
1196030613 X:111091969-111091991 GGCTGTGGGACTTGAGGCAGGGG + Intronic
1196215962 X:113051469-113051491 TGCTGAGCCACCTGGAGCTGTGG - Intergenic
1196809717 X:119619573-119619595 GGCTGTGGCTCCTGAGGATGAGG + Intronic
1197562030 X:128035178-128035200 TGCTGAATCACCTGGGGCTGAGG - Intergenic
1197602510 X:128547448-128547470 TGCTGAGGCTCCTAAAGCTGGGG + Intergenic
1197664860 X:129212554-129212576 GTCTGTGGCACCTGATGCTGAGG - Intergenic
1198286197 X:135194437-135194459 TGCTGTGGGCCCTGCTGCTGTGG + Intergenic
1198286209 X:135194483-135194505 TGCTGTGGGTCCTGCTGCTGTGG + Intergenic
1198286212 X:135194498-135194520 TGCTGTGGGTCCTGCTGCTGTGG + Intergenic
1198286230 X:135194573-135194595 TGCTGTGGGCCCTGCTGCTGTGG + Intergenic
1198286234 X:135194588-135194610 TGCTGTGGGCCCTGCTGCTGTGG + Intergenic
1198466624 X:136909655-136909677 TGAGGTGGCTGCTGAGGCTGGGG + Intergenic
1199162470 X:144629042-144629064 TTCTGAGCCACCTAAGGCTGAGG - Intergenic
1199274740 X:145927261-145927283 TTCTGAGACACCTGATGCTGGGG - Intergenic
1200138499 X:153886153-153886175 TGCTGCGGCAGCAGCGGCTGTGG + Intronic
1200370648 X:155720575-155720597 TTCTGAGCCACCTGAAGCTGGGG - Intergenic