ID: 1168672457

View in Genome Browser
Species Human (GRCh38)
Location 19:58250990-58251012
Sequence TATACAGGACCACGCATAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 27}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168672457_1168672461 -10 Left 1168672457 19:58250990-58251012 CCCATTATGCGTGGTCCTGTATA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1168672461 19:58251003-58251025 GTCCTGTATACACAGGCTGTGGG 0: 1
1: 1
2: 0
3: 8
4: 94
1168672457_1168672463 2 Left 1168672457 19:58250990-58251012 CCCATTATGCGTGGTCCTGTATA 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1168672463 19:58251015-58251037 CAGGCTGTGGGTGACCATTATGG 0: 3
1: 1
2: 2
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168672457 Original CRISPR TATACAGGACCACGCATAAT GGG (reversed) Intronic
1073579470 10:104651385-104651407 TATAAAGGGCCTAGCATAATAGG + Intronic
1073593783 10:104780423-104780445 TACACTGAACCACGCATACTCGG + Intronic
1073936858 10:108642750-108642772 CATACAGGACCATACATAAAAGG - Intergenic
1093026080 12:14246650-14246672 TATACATGACCAAGGATAAGAGG - Intergenic
1099926166 12:89020553-89020575 TTTACAGGATCATGCATAAAAGG + Intergenic
1101853470 12:108423087-108423109 TATACAGGACCCTGAATAAGTGG + Intergenic
1108841287 13:54619042-54619064 TATACACGACCAAGCAGAATTGG - Intergenic
1124403415 15:29371271-29371293 CATTCTGGACCACGCATACTAGG + Intronic
1124568938 15:30842313-30842335 TGTACAGGAGCATGCATATTTGG + Intergenic
1127109945 15:55658240-55658262 TATACAGGGTCACTTATAATTGG - Intronic
1149320513 17:55476492-55476514 TTTACACGGACACGCATAATAGG + Intergenic
1154959514 18:21294104-21294126 CATACTGGACCATGCAGAATAGG - Intronic
1158617326 18:59000282-59000304 TATACAGGAGCTTGGATAATCGG + Intergenic
1161613144 19:5254920-5254942 TTCACAGGACCATGCATACTCGG - Intronic
1168672457 19:58250990-58251012 TATACAGGACCACGCATAATGGG - Intronic
931185491 2:59947078-59947100 TAAACAGGACTATGCAGAATTGG + Intergenic
942489884 2:176479112-176479134 TATACAGGACAATTTATAATGGG - Intergenic
943499066 2:188664317-188664339 AATACAGGCACATGCATAATGGG - Intergenic
947408647 2:229809698-229809720 TCTTCAGGACCACTCAAAATAGG + Intronic
1178146575 21:29747292-29747314 TAGCCAGGACCATGCATAAATGG - Intronic
956942483 3:74179746-74179768 TATAGAGGACAAGCCATAATTGG + Intergenic
962989376 3:140564620-140564642 TATACAGTATCTGGCATAATGGG - Intronic
974571715 4:63659639-63659661 TATACAGTTGCACGCATTATAGG + Intergenic
985121425 4:186646558-186646580 TATAAAGGATCAGACATAATTGG - Intronic
994862243 5:105212161-105212183 TAGGTAGGACCAAGCATAATGGG - Intergenic
1008498057 6:52152788-52152810 GATACAGGAACACACATAAAGGG - Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1041860630 8:62508987-62509009 TATACAGAGCCATGCATACTGGG - Intronic
1195144604 X:102000471-102000493 TATCCAGGACCACCCATCAGAGG + Intergenic