ID: 1168672624

View in Genome Browser
Species Human (GRCh38)
Location 19:58252573-58252595
Sequence GTAGTTCAGAGGTTGTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168672624_1168672626 18 Left 1168672624 19:58252573-58252595 CCTTTAGACAACCTCTGAACTAC 0: 1
1: 0
2: 1
3: 8
4: 146
Right 1168672626 19:58252614-58252636 TACCAATAGCACATCTTTTTTGG 0: 1
1: 0
2: 1
3: 16
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168672624 Original CRISPR GTAGTTCAGAGGTTGTCTAA AGG (reversed) Intronic
901597492 1:10397224-10397246 GTAGATCAGAGGTTGGCTGGGGG + Intergenic
902081761 1:13825820-13825842 GTAGATCTGTGGTTGCCTAAGGG - Intergenic
902509202 1:16956462-16956484 CTAGGTCAGAGGTTGGCAAATGG + Intronic
903710904 1:25323412-25323434 GTAGTTCAGTGGTTGCCTTTGGG - Intronic
903716043 1:25368017-25368039 GTAGTTCAGTGGTTGCCTTTGGG + Intronic
904969421 1:34407435-34407457 GTAGTTCAGAGGTTCTCACAGGG + Intergenic
909127886 1:71697902-71697924 GTTTTTAAGAGGTTGTCTATTGG - Intronic
909361410 1:74763668-74763690 GTAGGACAGAGGTTGTCAAGAGG + Intronic
910151990 1:84159774-84159796 GTTGTTGAGAGGTTTTCTCATGG + Intronic
911308754 1:96266456-96266478 ATAGATCAGTGGTTGTCTGAGGG + Intergenic
919191592 1:194228093-194228115 CTAGTTCAGAGGTTGCCAATTGG - Intergenic
921403942 1:214758320-214758342 CCAGTTTAGATGTTGTCTAAGGG - Intergenic
922154490 1:223030400-223030422 GTAGGTCAGGGGTTTTTTAAAGG + Intergenic
924609994 1:245565680-245565702 ATATTTCAGAGGTTGAATAATGG - Intronic
1063647757 10:7902631-7902653 GTAGTTCAGATGGTGTCTATCGG + Intronic
1065478402 10:26165920-26165942 GTTGTTCTGAGGATGCCTAAAGG + Intronic
1068097423 10:52509625-52509647 CTAATTCAGAGGGTATCTAAAGG - Intergenic
1068228603 10:54139699-54139721 CTAGTTCAGAAGTTATCTAAAGG + Intronic
1068959883 10:62855913-62855935 GTAGTTCAGAGATATTCAAAGGG + Intronic
1069359722 10:67627961-67627983 ATAGTTCAGAGATTATGTAAAGG + Intronic
1071370601 10:84947519-84947541 AGAGTTCAGAGGTTGTATAGAGG + Intergenic
1072442564 10:95469969-95469991 GTAGTTCAGTGGTTCTCGACAGG - Intronic
1075141894 10:119845077-119845099 TTAGTTTAGAGGTTGTATTAGGG - Intronic
1077934413 11:6768562-6768584 GTATTTCAGAGGATGACAAATGG + Exonic
1080065314 11:28004488-28004510 CTAATTCAGAGGTTATCTAAAGG + Intergenic
1080894453 11:36437601-36437623 GGAGTTTAGAGATTGTTTAAGGG + Intronic
1082251181 11:49982112-49982134 GTAGTTCAGAGGTTTGCAGATGG + Exonic
1083983594 11:66194265-66194287 GCACTTCAGAGGTTTTCTATAGG + Intronic
1084098713 11:66931018-66931040 GTTATTCAGAGGTTGGCTATCGG + Intronic
1084718610 11:70889802-70889824 GTGGTTCAGAAGCTGTCTTAGGG + Intronic
1093750147 12:22788886-22788908 GCAGATCAGTGGTTGCCTAAGGG - Intergenic
1094433091 12:30391605-30391627 CTAATTCAGAAGTTGTCTAAAGG + Intergenic
1098099231 12:66996108-66996130 GTAGATCAGTAGTTGTCTAGGGG + Intergenic
1100221417 12:92508295-92508317 GTAGCTCAGAGCCTGTCCAAAGG + Intergenic
1102411105 12:112719517-112719539 GTATGTAAGAGCTTGTCTAATGG + Intronic
1105529658 13:21207952-21207974 GTAGTTCAGTGGTTATTCAAAGG - Intergenic
1108383566 13:49877482-49877504 CTGGTTCAGAAGTTATCTAAAGG + Intergenic
1109216891 13:59599238-59599260 GTAGTGAATAGGTTTTCTAATGG - Intergenic
1109917493 13:69010783-69010805 GTGGTTCAGAGGTGGTTGAATGG + Intergenic
1111495365 13:89041949-89041971 GTAATTCACAGGCTGTCTAGAGG + Intergenic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1112662497 13:101527270-101527292 GTAGCTCAGTGGTTGCCTATGGG - Intronic
1115444810 14:33477780-33477802 GTATTTCAAAGGATGTCCAATGG - Intronic
1118277179 14:64395610-64395632 TTAGATCAGAGGTTGTCAAATGG + Intronic
1123777541 15:23595368-23595390 ATAATTCAGAAGTTATCTAAAGG - Intronic
1127323013 15:57865874-57865896 TTAGATCAGAGGTTCTCAAATGG - Intergenic
1136064133 16:27747418-27747440 GGAGTTCAGAGGTTGTCATCAGG + Intronic
1136100160 16:27988427-27988449 CTAGTTTAGAGGTTATTTAAAGG + Intronic
1140040005 16:71400773-71400795 GTAGATCAGGGGTTGTCAAGGGG + Intergenic
1151083029 17:71350321-71350343 GCAGTTCAGTGGTTCTCAAATGG + Intergenic
1154350272 18:13577269-13577291 ATATTTCAGGGGTTGTGTAATGG + Intronic
1156544820 18:37954114-37954136 TTAGCTCAGAGGCTGTCTAATGG + Intergenic
1157834778 18:50890608-50890630 CTAGTTTAGAGGTTATTTAAAGG - Intronic
1160891978 19:1383893-1383915 GGACCTCAGAGGTTGTCTGAAGG + Exonic
1163637525 19:18444258-18444280 GTATTACAGAGGTCGTCGAAAGG - Exonic
1164878204 19:31708081-31708103 GTTGTTGAGAGGTTGAGTAAAGG + Intergenic
1168672624 19:58252573-58252595 GTAGTTCAGAGGTTGTCTAAAGG - Intronic
924980601 2:216722-216744 GTAGATGAGAGGTTGATTAATGG - Intergenic
927197777 2:20559926-20559948 GCAGTTCAGAGGTTGTTCTAGGG + Intergenic
927711041 2:25326410-25326432 GGAGTTCAGATGTTGTAGAAAGG + Intronic
929673590 2:43901389-43901411 GTAGTTCAGAAGATGTTAAATGG - Exonic
930841316 2:55849376-55849398 CTAATTCAGAGGTTATTTAAAGG - Intergenic
937481964 2:122271076-122271098 CAAGTTCTGGGGTTGTCTAAAGG + Intergenic
939122793 2:138137994-138138016 GTACTTCAGAGGATGTGCAAAGG - Intergenic
940584096 2:155622202-155622224 GTAGTTCAGTGGTTCTCAATAGG + Intergenic
946064353 2:216973959-216973981 CTAGTCCAGAGGTTTTCAAAAGG - Intergenic
946114938 2:217453080-217453102 GTTGCTCAGAGGTTGCCAAATGG - Intronic
947483482 2:230524937-230524959 CTAATTCAGAGGTTATCTGAAGG + Intronic
948196667 2:236101856-236101878 GTAGTTCACATTTTTTCTAATGG + Intronic
1169390608 20:5187398-5187420 GTAGTACAGTGCTTGCCTAAAGG + Intronic
1169534394 20:6522477-6522499 CTACTTCAGAGGTTGCATAAAGG + Intergenic
1169609297 20:7361382-7361404 AAAGGTCAGAGGTTGTCAAAGGG - Intergenic
1173637273 20:44571361-44571383 GTTGTTCAAAGATTGTCTTAGGG + Intronic
1173651596 20:44669492-44669514 CTAGTTTAGAGGTTATTTAAAGG + Intergenic
1174096782 20:48096185-48096207 TTATTTCAGGGGTTGGCTAAAGG + Intergenic
1175792649 20:61751347-61751369 GTAGTTCAGTGGTTCTCAAAAGG - Intronic
1176974544 21:15305026-15305048 GTAGTTCACAGTTTATATAAAGG + Intergenic
1177611398 21:23453369-23453391 CTAATTCAGAGGTTATTTAAGGG - Intergenic
1177851392 21:26353070-26353092 GAAGTCCAGAGGCTGTGTAAAGG + Intergenic
1178410983 21:32363595-32363617 GTAGCTGAGTGGTTGTCTCAAGG - Intronic
1180582307 22:16850527-16850549 CTAATTCAGAGGTTATTTAAAGG + Intergenic
1180682973 22:17641715-17641737 GTAGATCAGTGGTTGCCCAAGGG - Intronic
1180986942 22:19910480-19910502 CTAGGTCAGTGGTTGTCAAATGG - Intronic
949275519 3:2275359-2275381 ATAGTTATGAGGATGTCTAATGG - Intronic
949973229 3:9429584-9429606 GGAATTCAGAGTTTGTCCAAAGG + Intronic
957129024 3:76199477-76199499 GTAGGTCAGAGGTTCTATATGGG - Intronic
957366069 3:79225623-79225645 GTATTTCAGGGGCTGGCTAATGG + Intronic
960385199 3:117014368-117014390 GTAGTTCATAGGTGGAATAAAGG - Intronic
960774102 3:121229321-121229343 CTAATTCAAAGGTTATCTAAAGG - Intronic
963867458 3:150378156-150378178 TTAGTTCAGAGGTTGCCTGTAGG + Intergenic
964308503 3:155366287-155366309 CTAGTTTAGAGGTTATTTAAAGG + Intergenic
966348407 3:179003849-179003871 CTAGTTTAGAGGTTATTTAAAGG + Intergenic
967488268 3:190059058-190059080 GTAGTCCAGCCTTTGTCTAAAGG - Intronic
970762538 4:19508550-19508572 GTTCTTCAGAGGTTGTCTTGAGG - Intergenic
971938569 4:33186415-33186437 GTAGTTGAGTTCTTGTCTAAAGG - Intergenic
973260087 4:48154604-48154626 CTAGTTTAGAGGTTATTTAAAGG + Intronic
973606353 4:52591096-52591118 GTACTTCAGAGCTTGTCTCCAGG - Exonic
973802241 4:54490413-54490435 GAATTTCACAGGTTGTCTTATGG + Intergenic
974874167 4:67682644-67682666 GGAGTTCAGATGTTATATAAAGG + Intronic
975792570 4:77970280-77970302 GTAGTTCAGAGTATGGCAAAAGG + Intergenic
981147052 4:141336484-141336506 CTAATTCAGAAGTTATCTAAAGG + Intergenic
982721191 4:158861868-158861890 GTAATTCATAGGTTGTCTTTGGG + Intronic
983936167 4:173504137-173504159 GTAGTTCAGACTTTGTGTGAAGG - Intergenic
984950103 4:185001750-185001772 GTTGGGCAGAGGTGGTCTAAGGG + Intergenic
988030363 5:25756087-25756109 CTAATTCAGAAGTTCTCTAAAGG - Intergenic
993486220 5:88489536-88489558 GAGGTTCAAAGATTGTCTAAAGG + Intergenic
994694195 5:103053905-103053927 CTAGTTTAGAGGTTATTTAAAGG - Intergenic
998576907 5:143326589-143326611 GTACTTCAGAGTTCCTCTAAGGG - Intronic
1000056357 5:157610324-157610346 GATGAACAGAGGTTGTCTAATGG - Intergenic
1000568238 5:162878910-162878932 CTATTTCAGAAGTTATCTAAAGG - Intergenic
1002356189 5:178630926-178630948 TTAGCTCAGAGGTTGTGTAGGGG + Intergenic
1007023956 6:38550775-38550797 GTAGACCATAGGTTGTATAAGGG - Intronic
1007187183 6:39981893-39981915 TTAGGTCAGAGGTTGTATGATGG + Intergenic
1009405020 6:63301406-63301428 CTAGTTTAGAGGTTATTTAAAGG + Intronic
1011594201 6:89000525-89000547 GTAGTTTAGTGGTTATTTAAAGG + Intergenic
1012236017 6:96816642-96816664 CTAGCTCAGAGGTTTTCTCAAGG + Intronic
1012849150 6:104426075-104426097 GTAGTTCAGAGGTAGGCTCTAGG - Intergenic
1013489387 6:110630431-110630453 TTCCTTCTGAGGTTGTCTAAGGG + Intronic
1014300911 6:119680181-119680203 GTATTTCACAGGGTGCCTAAGGG + Intergenic
1015282777 6:131451775-131451797 GTAGCTCAGGAGTTGTCTGAAGG + Intergenic
1017550150 6:155496940-155496962 GTAGACCAGAGGCTGTCCAATGG + Intergenic
1019042101 6:169115581-169115603 CTAGTTTAGAGGCTGTTTAAGGG + Intergenic
1019883377 7:3883069-3883091 GGAGCTCAGAGGTTTTCTACTGG + Intronic
1025811640 7:64879461-64879483 GTGTCTCAGAGGCTGTCTAAGGG - Intronic
1028115413 7:86991668-86991690 GCAGTCCAGAGCTTGTTTAAAGG + Intronic
1028380118 7:90191006-90191028 GTAATTCAGAGGTTATCTAAAGG - Intronic
1034565414 7:151910390-151910412 GTAGTTCAAAGAATGTCTTACGG + Intergenic
1037972699 8:23185335-23185357 CTAATTCAGAAGTTATCTAAAGG - Intergenic
1039909686 8:41815551-41815573 CTAGTTTAGAGGTTATCAAAAGG - Intronic
1040447146 8:47506981-47507003 GTAGCCCAGAGGTTGTTTAGTGG - Intronic
1042272237 8:66966322-66966344 GTACTTGAGAGGTTGGCTATTGG + Intronic
1044113694 8:88307205-88307227 GTAGTTCAGAGATTGTTGGATGG - Intronic
1044613622 8:94118234-94118256 TTAGTTCAGACTTTGTCAAATGG + Intergenic
1046573299 8:115993842-115993864 AAAGTTCAGAGGATGTGTAATGG - Intergenic
1047331285 8:123889684-123889706 CTAATTCAGAAGTTATCTAAAGG + Intronic
1049456358 8:142692938-142692960 CTAATTCAGAAGTTATCTAAAGG - Intergenic
1049481410 8:142825548-142825570 CTAATTCAGAAGTTATCTAAAGG + Intergenic
1050058038 9:1676347-1676369 GTAGTGCACAGGTTGTTTATTGG + Intergenic
1050527081 9:6555406-6555428 GTAATCCAGAGATTGTCTATTGG - Intronic
1051426451 9:16936385-16936407 GTAGTTTAAAGGTAGTCTGAAGG - Intergenic
1051694343 9:19752043-19752065 GTAGTCAAAAGGTTGTCAAATGG + Intronic
1053052477 9:34973120-34973142 CTAGCTCAGAGGTTCTCTACCGG - Intronic
1053559778 9:39179183-39179205 GGAGTCCAGAGGTTGTCTGGAGG - Intronic
1053823889 9:41999427-41999449 GGAGTCCAGAGGTTGTCTGGAGG - Intronic
1054137338 9:61439760-61439782 GGAGTCCAGAGGTTGTCTGGAGG + Intergenic
1054606683 9:67187940-67187962 GGAGTCCAGAGGTTGTCTGGAGG + Intergenic
1056984984 9:91354796-91354818 ATGGTTGAGAGGTTCTCTAAAGG - Intronic
1188908578 X:35818285-35818307 CTAATTCAGAAGTTATCTAAAGG - Intergenic
1189712564 X:43828484-43828506 GTAGGTCACAGGTGGTCAAATGG + Intronic
1191184855 X:57599007-57599029 GTAGTTCTGAGAATGCCTAAAGG - Intergenic
1196140056 X:112251473-112251495 GTAGTCCAGAAGTTTTCAAATGG - Intergenic
1197199601 X:123736471-123736493 GTAGCTCAGTGGTTCTCAAAAGG - Intergenic
1198432933 X:136586072-136586094 GTAGTTAAGAGGTAGGCTTAGGG + Intergenic
1199104626 X:143849429-143849451 GTAGTTCATTAGTTGACTAATGG + Intergenic
1199993339 X:153002630-153002652 GTAGTCCATAGGTTGTAAAAAGG - Intergenic
1201751640 Y:17438357-17438379 GTAGTTGGGGGGTTGTTTAATGG + Intergenic