ID: 1168673808

View in Genome Browser
Species Human (GRCh38)
Location 19:58261860-58261882
Sequence GTGTAATAAGTTTGGATCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168673808_1168673810 -4 Left 1168673808 19:58261860-58261882 CCAGAGATCCAAACTTATTACAC 0: 1
1: 0
2: 2
3: 17
4: 167
Right 1168673810 19:58261879-58261901 ACACATCAGCGAATTCACACTGG 0: 1
1: 4
2: 62
3: 291
4: 841

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168673808 Original CRISPR GTGTAATAAGTTTGGATCTC TGG (reversed) Exonic
900986799 1:6077979-6078001 GGGTACCGAGTTTGGATCTCTGG - Intronic
903437478 1:23362076-23362098 GTGTGATGAGGTTGGAGCTCTGG + Exonic
903611242 1:24615006-24615028 TTATAATAAGTTTGGAAATCAGG + Intergenic
904252390 1:29234477-29234499 GAGTAATAAGTTCTGATCTCTGG - Intergenic
907744066 1:57194983-57195005 GTGTAATAACTTTGGGTCTTGGG + Intronic
907833954 1:58091803-58091825 GAGTAATTAGTTTTGAGCTCAGG - Intronic
908701210 1:66902948-66902970 GTGTAATAAGTTTTAAAATCAGG + Intronic
909269849 1:73608868-73608890 GTGTGATAAGTATGGAATTCTGG - Intergenic
911105477 1:94127805-94127827 CTGTAATAATTTTGGACCTCAGG + Intergenic
912000969 1:104834252-104834274 GTGCAATAAGATTAGAACTCAGG + Intergenic
915781584 1:158557436-158557458 TTGTAAGAAGTTTGGCTCTGAGG + Intergenic
917296658 1:173526803-173526825 GTATAATAAGTATGCTTCTCAGG - Intronic
918019021 1:180666194-180666216 TTGTAGTAAGTTTGGAAATCAGG + Intronic
918748553 1:188240100-188240122 TTGTAATAAGTTTTGAAATCAGG - Intergenic
921363065 1:214348084-214348106 GTGAAACTAGTTGGGATCTCTGG + Intergenic
921836043 1:219779668-219779690 ATGGAATAAGTTTGGATATGAGG + Intronic
922584358 1:226722548-226722570 TGGTAATTAGTTTCGATCTCAGG - Intronic
924327141 1:242907181-242907203 CTGTAATAAGTTTTGAAATCAGG - Intergenic
1063201737 10:3790829-3790851 GTGTTTTAAGTTCTGATCTCAGG + Intergenic
1064810342 10:19190529-19190551 TTGTAATAAGTTTTGAAATCAGG - Intronic
1067353463 10:45499839-45499861 TTGTAATAAGTTTTGAAGTCAGG + Intronic
1069088318 10:64168470-64168492 TTGTAATAAGTTTTGAAATCAGG + Intergenic
1070223094 10:74471409-74471431 GTGTAATATGTTTTGAAATCAGG + Intronic
1070686122 10:78483731-78483753 ATGTAATCACTTTGGAACTCAGG + Intergenic
1070975690 10:80603978-80604000 TTGTAATAACTTTGGAGTTCTGG + Intronic
1072600444 10:96921976-96921998 TTGTAATAAGTTTTGAAATCAGG + Intronic
1072703180 10:97659826-97659848 ATGTAATTATTTTGGAGCTCTGG - Intronic
1076782734 10:132733199-132733221 GTGTAACTAGTTAAGATCTCGGG - Intronic
1081411957 11:42769926-42769948 TTGTACTAAGTTTGGAAGTCAGG + Intergenic
1086670312 11:89538884-89538906 GTGTTATGAGGTTGGACCTCTGG + Intergenic
1087452374 11:98341388-98341410 ATGTAACAATTTTGGAACTCTGG - Intergenic
1087665725 11:101045130-101045152 TTTTCATAAGTTTGTATCTCTGG - Intronic
1088681404 11:112245935-112245957 TTGTAATAAGTTTTGAAGTCCGG - Intronic
1093282811 12:17216286-17216308 TTGTAATAGGTTTAGTTCTCTGG + Intergenic
1093738526 12:22653264-22653286 GTGTAATAAGTTTTGAAATCAGG + Intronic
1095805586 12:46316214-46316236 GTGTAGTAAGTTTTGAAATCAGG - Intergenic
1098021954 12:66165294-66165316 TTGTAATAAGTTTTGAAATCAGG - Intronic
1106139132 13:26996706-26996728 CTGTAATAAGTTTTGAAATCAGG + Intergenic
1107514951 13:41119999-41120021 TTGTAATAAGTTTTAATATCAGG + Intergenic
1108565080 13:51688652-51688674 GTGAAAGAAGTTTGGATCTTTGG - Intronic
1108890657 13:55254136-55254158 GTGAAAGGAGTTTGGATCTAGGG - Intergenic
1109017271 13:57033368-57033390 GTGAAACAAGTTTGGGACTCTGG - Intergenic
1114697045 14:24635106-24635128 ATGTAAGAAGTGTGGCTCTCTGG - Intergenic
1115791614 14:36885368-36885390 TTGTAATAGGTTTGGAAGTCAGG + Intronic
1116038013 14:39652189-39652211 TTGTAATAGGTTTTGATGTCAGG - Intergenic
1116557854 14:46335638-46335660 GTGTAATAAGGTTGGTTCTGGGG + Intergenic
1120425977 14:84349036-84349058 GTTTAATATGTTTGGACCTACGG + Intergenic
1121766994 14:96496204-96496226 TTGTAATAAGTCTTGATATCTGG - Intergenic
1124699526 15:31900827-31900849 TTGTAGTAAGTTTGGAAATCAGG - Intergenic
1125117034 15:36106559-36106581 GACTCATTAGTTTGGATCTCTGG + Intergenic
1126203022 15:46010185-46010207 TTGTAATATATTTGGATGTCAGG + Intergenic
1126217170 15:46169212-46169234 TTGTAGAAAGTTTGGATATCAGG + Intergenic
1126263282 15:46720233-46720255 TTGTCATAAGTTTTGATATCAGG + Intergenic
1127640259 15:60909434-60909456 ATGGAATAAGTTTTGATCTTGGG - Intronic
1127648197 15:60978914-60978936 TTGTAATAAGTTTTGAAATCAGG + Intronic
1130905477 15:88237574-88237596 GTGTTTTAAATTTAGATCTCAGG - Intronic
1132259754 15:100412458-100412480 TTGTAGTAAGTTTGGAAATCAGG + Intronic
1133122254 16:3616728-3616750 TTGTAATAAGTTTTGATATAAGG - Intronic
1134665330 16:16014595-16014617 CTGTCATAATTTTGGATCTCAGG - Exonic
1134767355 16:16772327-16772349 GTGTAATCAAATTAGATCTCAGG - Intergenic
1136518672 16:30782818-30782840 GGGTAATAAGGTTGGAGCTCTGG + Exonic
1137749698 16:50850512-50850534 TTGTAATAAGTTTTGAAGTCAGG + Intergenic
1148286109 17:46393870-46393892 TTGTAATAAGTTTTGAAATCAGG - Intergenic
1148308276 17:46611460-46611482 TTGTAATAAGTTTTGAAATCAGG - Intronic
1150187858 17:63204738-63204760 TTGTAATAAGTTTTGAAATCAGG - Intronic
1155672255 18:28386305-28386327 ATGTAATAAGTTTTGAAATCAGG - Intergenic
1156240155 18:35245926-35245948 GTCTAATGAGTTTTGAGCTCTGG - Exonic
1156874184 18:41986553-41986575 GAGTATTAAGGTTGGAACTCTGG + Intronic
1157769286 18:50331319-50331341 GTGTAATAAGCTTTGAAATCAGG + Intergenic
1158314427 18:56194982-56195004 TTGTAATAAGTTTTGAAATCAGG + Intergenic
1158536300 18:58311148-58311170 GTGTACTAAGTTGTGATCTAAGG - Intronic
1162686266 19:12387312-12387334 TTGTAATAAGTTTTGAAATCAGG + Intronic
1162690582 19:12426836-12426858 TTGTAATAAGTTTTGAAATCAGG + Intronic
1166638901 19:44477034-44477056 GTGCAATAAGTTTATAGCTCTGG + Exonic
1167400081 19:49260142-49260164 GTATAATAAGTTTTGAAATCAGG - Intergenic
1168182715 19:54673123-54673145 GTGTAATAAATTTGTCCCTCAGG - Intronic
1168673808 19:58261860-58261882 GTGTAATAAGTTTGGATCTCTGG - Exonic
1168673837 19:58262196-58262218 GCGTAATAAGTTTGGAACTCTGG - Exonic
925540926 2:4967350-4967372 GTTTCATAAGTTTGGAGCTGGGG - Intergenic
926082885 2:10003082-10003104 GTGTCTTAGCTTTGGATCTCTGG + Intergenic
929495155 2:42434713-42434735 TTGTAGTAAGTTTGGAAATCAGG - Intergenic
930526689 2:52539184-52539206 ATGTAGTAAGTTTGCATCACAGG + Intergenic
930876595 2:56225541-56225563 GTGTAGTAAGTTTTGAAATCAGG + Intronic
932650910 2:73555206-73555228 ATGTAATAAGTCTTGATGTCTGG - Intronic
932867463 2:75359805-75359827 CAGTAATAAGTTTTGATATCAGG - Intergenic
934704131 2:96464459-96464481 CTGTCATAAGTTTGGTTTTCTGG - Intergenic
936925622 2:117733840-117733862 GTCCAATAAGTTTGGATCAGAGG - Intergenic
938697343 2:133846367-133846389 ATGTAATAAGTTGGGATTTCAGG - Intergenic
938697832 2:133850574-133850596 ATGTAGTAAGTTAGGATTTCAGG - Intergenic
940905050 2:159161375-159161397 TTGTAATAAGTTAGGTTCACAGG - Intronic
941639102 2:167968451-167968473 GTGAAATAAGCTGGTATCTCAGG - Intronic
943876286 2:193071761-193071783 GTGAAAGATGTTTGGATCTTGGG + Intergenic
945857490 2:215085954-215085976 GTGGAAGAAGTCAGGATCTCTGG + Intronic
947883958 2:233547956-233547978 TTGTAATAAGTCTTGATCTCTGG - Intronic
1170586816 20:17741093-17741115 GGGTAATAAGTATGAGTCTCTGG + Intergenic
1180722621 22:17920662-17920684 GTTTAGTAGCTTTGGATCTCTGG - Intronic
1184447686 22:44559833-44559855 GTGGAATAAGTTAAGATTTCAGG - Intergenic
950245455 3:11412587-11412609 TTGTAGTAAGTTTGGAAATCAGG + Intronic
951995193 3:28719703-28719725 TTGTAAGAAATGTGGATCTCAGG - Intergenic
953000410 3:38927542-38927564 TTGTAATAAATTTCGATATCAGG - Intronic
953522013 3:43652231-43652253 TTGTAGTAAGTTTGGAAATCAGG - Intronic
953764384 3:45725091-45725113 GTGTAATAAGTTTTAAAATCGGG + Intronic
957429567 3:80084477-80084499 GAGAAATAAGTTTGTAACTCAGG + Intergenic
957666390 3:83235216-83235238 TTTTAATCAGTTTTGATCTCAGG - Intergenic
959235292 3:103713602-103713624 GTGTAATAATTTTAGATATTGGG - Intergenic
960144553 3:114186762-114186784 ATGTAATTATTTTGGAACTCTGG - Intronic
965163601 3:165167122-165167144 GTGTAATAAAATTAGAACTCAGG - Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
969381504 4:6802038-6802060 GTGTCACAAGTTGGGTTCTCTGG + Intronic
971645546 4:29196619-29196641 TTGTAATATGTTTTGAACTCAGG + Intergenic
972104737 4:35469093-35469115 GAATAAAAAGTTTGGATCTGAGG + Intergenic
972143589 4:35993078-35993100 GTGTAATAAGTTTTGAGATCAGG - Intronic
974171524 4:58272070-58272092 GTGTAAGGAGTTTGGAATTCTGG - Intergenic
974512127 4:62856541-62856563 GTGTAATACATTTGGATTTCAGG - Intergenic
974817582 4:67025130-67025152 GTTTATTAGGTTTGGGTCTCTGG + Intergenic
976164420 4:82238996-82239018 TTGTAATAATTTTTGATATCTGG - Intergenic
977999180 4:103535601-103535623 TTGTAATAAATTTGGATGCCTGG - Intergenic
978849961 4:113322979-113323001 GTTTAGTAAGGTTGGATTTCCGG + Intronic
979615462 4:122737759-122737781 TTGTAGTAAGTTTGGAAATCAGG - Intronic
980804728 4:137796928-137796950 CTGTAGTAAATTTGGATTTCAGG + Intergenic
981262082 4:142732901-142732923 TTATAATAAGTTTTGATATCTGG - Intronic
983924278 4:173381157-173381179 TTGTAATAAGTTTTGAAATCAGG + Intergenic
984465282 4:180092762-180092784 GTGGAATAAGCTTTGATCACAGG + Intergenic
985479386 5:98786-98808 TTGTAATAAGTTTTGAAATCAGG + Intergenic
986060347 5:4183361-4183383 GTTTAATAATTTTGTATCTGTGG - Intergenic
987554261 5:19426143-19426165 TTATAATAAGTCTGGATATCAGG - Intergenic
988251014 5:28758142-28758164 GTGCAATAAAATTGGAACTCAGG - Intergenic
988918408 5:35919198-35919220 GTGAAATTAGTTTGGATCTCAGG + Intronic
989224944 5:39016095-39016117 TTCTAATAAGTTTGGCTATCAGG + Intronic
990520506 5:56574680-56574702 TTGCAATAAGTTTGGAAATCTGG - Intronic
994596326 5:101841875-101841897 TTATAATAAGTTTGGAAATCAGG - Intergenic
994982193 5:106889753-106889775 GTTGAATAAGTTTTTATCTCAGG + Intergenic
998663516 5:144268011-144268033 ATGTAATAATTTTGAAACTCTGG + Intronic
999403947 5:151290572-151290594 GTGAAATAACTTGGGGTCTCTGG - Intronic
1000498338 5:162014658-162014680 TTGTAATAAGTTTTGATGTCAGG - Intergenic
1002920420 6:1565977-1565999 CTGTAATAAGTTTTGAATTCAGG + Intergenic
1003955341 6:11159439-11159461 TTGTAATAAGTTTTGAAATCAGG - Intergenic
1006024302 6:31137755-31137777 GAGGACTAAGTATGGATCTCAGG + Exonic
1008282109 6:49609133-49609155 ATGTAAGTAGTTTGGTTCTCAGG + Intronic
1008716987 6:54300584-54300606 TTTTAATAAGTTGGCATCTCTGG + Intergenic
1011300721 6:85870230-85870252 TTGTAGTAAGTTTTGAACTCAGG + Intergenic
1011955386 6:93018917-93018939 GTGTAATAAGTATGTAACTTGGG - Intergenic
1013018163 6:106180163-106180185 GGGTATTAAGTTTGGAGCTCAGG + Intergenic
1015898789 6:138043206-138043228 TTGTAATAAGTTTTGAAATCAGG + Intergenic
1017174537 6:151490953-151490975 GTGTCGTAAGTTTAGAACTCTGG - Intergenic
1018750915 6:166805069-166805091 GAGTAATTATTTTGGAACTCTGG + Intronic
1018942948 6:168321707-168321729 TTGTAATAAGTTTTGAAGTCAGG + Intergenic
1020154024 7:5707163-5707185 TTGTAATAAGTTTTGAAGTCAGG + Intronic
1021609617 7:22444680-22444702 GAGTAACAGGTTTTGATCTCAGG + Intronic
1022676811 7:32508871-32508893 TTGTAATAAGTTTTGATACCTGG + Intronic
1023906209 7:44523358-44523380 GTGTAACGATTTTGGAACTCTGG + Intronic
1023979267 7:45057530-45057552 GTGTAGTAAGTTTTGAAATCAGG + Intronic
1027026645 7:74857332-74857354 TTGTAATAAGTTTTGAAATCAGG - Intergenic
1027061110 7:75086782-75086804 TTGTAATAAGTTTTGAAATCAGG + Intergenic
1028555574 7:92120340-92120362 TTGTAATAAGTTTTGAATTCGGG - Intronic
1028561009 7:92175995-92176017 TTGTAATAAATCTGGATATCTGG + Intronic
1031645130 7:124216316-124216338 GTGTAATCAGTTTGGATTACTGG - Intergenic
1033383242 7:140845000-140845022 GTGTAGTAAGTTTTGAAATCAGG - Intronic
1038812424 8:30863016-30863038 GTGTAACTATTTTGGATCTCTGG + Intronic
1041111093 8:54483177-54483199 TTGTATTAAGTTTTGAACTCAGG - Intergenic
1041229345 8:55733229-55733251 TTGTAGTAAGTTTGGAACTGAGG - Intronic
1041412388 8:57571178-57571200 GTGAAATTACTTTGGATCTAGGG - Intergenic
1045088793 8:98716757-98716779 TTGTAATAAGTTTTGAAATCAGG - Intronic
1045850797 8:106696450-106696472 GTGTGGTAAGTTTTCATCTCAGG + Intronic
1047644362 8:126854274-126854296 GTGAAATAACCTTGGACCTCAGG - Intergenic
1048481239 8:134795720-134795742 GTGATATAAGTTTTAATCTCTGG + Intergenic
1051133048 9:13884128-13884150 ATGTAATTATTTTGGAACTCTGG + Intergenic
1051133425 9:13889809-13889831 TTGTAATAAGTTTTGAAATCAGG - Intergenic
1058697422 9:107571376-107571398 GTGCAATAAGTTTTGATTTTGGG + Intergenic
1185644280 X:1606153-1606175 GTGTCTTCAGTTGGGATCTCAGG + Intergenic
1186195126 X:7103155-7103177 TTGTAATATGTTTGGAAATCAGG - Intronic
1186251643 X:7673770-7673792 TTGTAATAAGCTTGGAAATCAGG - Intergenic
1187471327 X:19571746-19571768 GTCTTATAAGTTTTGATCTTTGG - Intronic
1192702923 X:73495373-73495395 GTGCAATAAATTTAGAACTCAGG - Intergenic
1193589436 X:83369579-83369601 TTGTAAAAACTTTGGATATCAGG - Intergenic
1193787457 X:85776875-85776897 TTGTAATAAGTTTTGAAGTCAGG + Intergenic
1194362495 X:92970298-92970320 TTGTAATAAGTTTTGAAATCAGG + Intergenic
1194832406 X:98640256-98640278 TTGTAATAAGTTTTGAAATCAGG - Intergenic
1195448812 X:104985821-104985843 ATGTAATGCGTCTGGATCTCAGG - Intronic
1196317481 X:114245535-114245557 TTGTAATAAGTTTGAAAATCAGG - Intergenic
1197494218 X:127157234-127157256 ATGTAACAATTTTGGAGCTCTGG - Intergenic
1198112255 X:133512214-133512236 GTGTGATAAGTTTGGGACTGTGG + Intergenic
1200403776 Y:2787642-2787664 GTAAAATAAGTTTCGAACTCTGG - Exonic
1200670745 Y:6086518-6086540 TTGTAATAAGTTTTGAAATCAGG + Intergenic
1201224575 Y:11806094-11806116 CTGTAATAAGTTTTGAAATCAGG - Intergenic
1202341947 Y:23878978-23879000 GTGGAATAAGATTAGAACTCAGG - Intergenic
1202528821 Y:25791107-25791129 GTGGAATAAGATTAGAACTCAGG + Intergenic