ID: 1168676215

View in Genome Browser
Species Human (GRCh38)
Location 19:58279585-58279607
Sequence CCGCGGTGCTGGGGTCCCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 223}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168676215_1168676225 -2 Left 1168676215 19:58279585-58279607 CCACCGGGACCCCAGCACCGCGG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1168676225 19:58279606-58279628 GGAGCCCCTGCCCTGGGGCTTGG 0: 1
1: 0
2: 10
3: 81
4: 657
1168676215_1168676221 -9 Left 1168676215 19:58279585-58279607 CCACCGGGACCCCAGCACCGCGG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1168676221 19:58279599-58279621 GCACCGCGGAGCCCCTGCCCTGG 0: 1
1: 0
2: 1
3: 28
4: 290
1168676215_1168676236 24 Left 1168676215 19:58279585-58279607 CCACCGGGACCCCAGCACCGCGG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1168676236 19:58279632-58279654 CAACCTCTTGGGGGCAATGATGG 0: 1
1: 0
2: 2
3: 6
4: 110
1168676215_1168676233 13 Left 1168676215 19:58279585-58279607 CCACCGGGACCCCAGCACCGCGG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1168676233 19:58279621-58279643 GGGCTTGGGCACAACCTCTTGGG 0: 1
1: 0
2: 2
3: 8
4: 146
1168676215_1168676235 15 Left 1168676215 19:58279585-58279607 CCACCGGGACCCCAGCACCGCGG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1168676235 19:58279623-58279645 GCTTGGGCACAACCTCTTGGGGG 0: 1
1: 0
2: 0
3: 3
4: 106
1168676215_1168676232 12 Left 1168676215 19:58279585-58279607 CCACCGGGACCCCAGCACCGCGG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1168676232 19:58279620-58279642 GGGGCTTGGGCACAACCTCTTGG 0: 1
1: 0
2: 1
3: 11
4: 136
1168676215_1168676234 14 Left 1168676215 19:58279585-58279607 CCACCGGGACCCCAGCACCGCGG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1168676234 19:58279622-58279644 GGCTTGGGCACAACCTCTTGGGG 0: 1
1: 0
2: 1
3: 8
4: 98
1168676215_1168676223 -7 Left 1168676215 19:58279585-58279607 CCACCGGGACCCCAGCACCGCGG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1168676223 19:58279601-58279623 ACCGCGGAGCCCCTGCCCTGGGG 0: 1
1: 0
2: 2
3: 18
4: 222
1168676215_1168676226 -1 Left 1168676215 19:58279585-58279607 CCACCGGGACCCCAGCACCGCGG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1168676226 19:58279607-58279629 GAGCCCCTGCCCTGGGGCTTGGG 0: 1
1: 0
2: 3
3: 89
4: 538
1168676215_1168676222 -8 Left 1168676215 19:58279585-58279607 CCACCGGGACCCCAGCACCGCGG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1168676222 19:58279600-58279622 CACCGCGGAGCCCCTGCCCTGGG 0: 1
1: 0
2: 3
3: 20
4: 214
1168676215_1168676237 25 Left 1168676215 19:58279585-58279607 CCACCGGGACCCCAGCACCGCGG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 1168676237 19:58279633-58279655 AACCTCTTGGGGGCAATGATGGG 0: 1
1: 0
2: 1
3: 9
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168676215 Original CRISPR CCGCGGTGCTGGGGTCCCGG TGG (reversed) Exonic