ID: 1168681318

View in Genome Browser
Species Human (GRCh38)
Location 19:58318069-58318091
Sequence CACCCAGCAAACACCTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168681318_1168681327 8 Left 1168681318 19:58318069-58318091 CCACCAAAGGTGTTTGCTGGGTG No data
Right 1168681327 19:58318100-58318122 TGCAGGAGGTGCTCAGGAAAGGG No data
1168681318_1168681324 2 Left 1168681318 19:58318069-58318091 CCACCAAAGGTGTTTGCTGGGTG No data
Right 1168681324 19:58318094-58318116 CTGACCTGCAGGAGGTGCTCAGG No data
1168681318_1168681329 28 Left 1168681318 19:58318069-58318091 CCACCAAAGGTGTTTGCTGGGTG No data
Right 1168681329 19:58318120-58318142 GGGGAGCTGCTGCTGTCATTTGG No data
1168681318_1168681321 -9 Left 1168681318 19:58318069-58318091 CCACCAAAGGTGTTTGCTGGGTG No data
Right 1168681321 19:58318083-58318105 TGCTGGGTGGCCTGACCTGCAGG No data
1168681318_1168681328 9 Left 1168681318 19:58318069-58318091 CCACCAAAGGTGTTTGCTGGGTG No data
Right 1168681328 19:58318101-58318123 GCAGGAGGTGCTCAGGAAAGGGG No data
1168681318_1168681322 -6 Left 1168681318 19:58318069-58318091 CCACCAAAGGTGTTTGCTGGGTG No data
Right 1168681322 19:58318086-58318108 TGGGTGGCCTGACCTGCAGGAGG No data
1168681318_1168681326 7 Left 1168681318 19:58318069-58318091 CCACCAAAGGTGTTTGCTGGGTG No data
Right 1168681326 19:58318099-58318121 CTGCAGGAGGTGCTCAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168681318 Original CRISPR CACCCAGCAAACACCTTTGG TGG (reversed) Intergenic
No off target data available for this crispr