ID: 1168685676

View in Genome Browser
Species Human (GRCh38)
Location 19:58347726-58347748
Sequence CCGCGCCTGCGCCTCAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 310}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168685668_1168685676 0 Left 1168685668 19:58347703-58347725 CCAGGCCACACCCCAGGCCGCGC 0: 1
1: 1
2: 6
3: 54
4: 412
Right 1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG 0: 1
1: 0
2: 4
3: 25
4: 310
1168685656_1168685676 26 Left 1168685656 19:58347677-58347699 CCCCAGGCCACGCCCCAGGCCAC 0: 1
1: 1
2: 7
3: 75
4: 552
Right 1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG 0: 1
1: 0
2: 4
3: 25
4: 310
1168685659_1168685676 19 Left 1168685659 19:58347684-58347706 CCACGCCCCAGGCCACACCCCAG 0: 1
1: 3
2: 10
3: 111
4: 1117
Right 1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG 0: 1
1: 0
2: 4
3: 25
4: 310
1168685666_1168685676 2 Left 1168685666 19:58347701-58347723 CCCCAGGCCACACCCCAGGCCGC 0: 1
1: 1
2: 11
3: 60
4: 477
Right 1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG 0: 1
1: 0
2: 4
3: 25
4: 310
1168685662_1168685676 13 Left 1168685662 19:58347690-58347712 CCCAGGCCACACCCCAGGCCACA 0: 1
1: 2
2: 16
3: 113
4: 612
Right 1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG 0: 1
1: 0
2: 4
3: 25
4: 310
1168685667_1168685676 1 Left 1168685667 19:58347702-58347724 CCCAGGCCACACCCCAGGCCGCG 0: 1
1: 0
2: 1
3: 37
4: 354
Right 1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG 0: 1
1: 0
2: 4
3: 25
4: 310
1168685658_1168685676 24 Left 1168685658 19:58347679-58347701 CCAGGCCACGCCCCAGGCCACAC 0: 1
1: 2
2: 7
3: 68
4: 477
Right 1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG 0: 1
1: 0
2: 4
3: 25
4: 310
1168685669_1168685676 -5 Left 1168685669 19:58347708-58347730 CCACACCCCAGGCCGCGCCCGCG 0: 1
1: 1
2: 4
3: 72
4: 465
Right 1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG 0: 1
1: 0
2: 4
3: 25
4: 310
1168685661_1168685676 14 Left 1168685661 19:58347689-58347711 CCCCAGGCCACACCCCAGGCCAC 0: 1
1: 3
2: 13
3: 90
4: 709
Right 1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG 0: 1
1: 0
2: 4
3: 25
4: 310
1168685657_1168685676 25 Left 1168685657 19:58347678-58347700 CCCAGGCCACGCCCCAGGCCACA 0: 1
1: 1
2: 3
3: 71
4: 468
Right 1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG 0: 1
1: 0
2: 4
3: 25
4: 310
1168685670_1168685676 -10 Left 1168685670 19:58347713-58347735 CCCCAGGCCGCGCCCGCGCCTGC 0: 1
1: 0
2: 4
3: 41
4: 390
Right 1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG 0: 1
1: 0
2: 4
3: 25
4: 310
1168685663_1168685676 12 Left 1168685663 19:58347691-58347713 CCAGGCCACACCCCAGGCCACAC 0: 1
1: 2
2: 17
3: 86
4: 640
Right 1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG 0: 1
1: 0
2: 4
3: 25
4: 310
1168685664_1168685676 7 Left 1168685664 19:58347696-58347718 CCACACCCCAGGCCACACCCCAG 0: 1
1: 2
2: 16
3: 254
4: 2299
Right 1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG 0: 1
1: 0
2: 4
3: 25
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168685676 Original CRISPR CCGCGCCTGCGCCTCAGCCC CGG Intronic
900088674 1:909972-909994 CCGCGCCGCCGCCCCTGCCCAGG - Intergenic
900101099 1:962466-962488 CCGCGGCCGCGCCTCACCCGTGG - Exonic
900191771 1:1355147-1355169 CCGCGCCCCCTCCGCAGCCCCGG - Exonic
900564992 1:3327815-3327837 CCTCGCCTGCCCCCCAGCACTGG + Intronic
900606607 1:3526367-3526389 CCACGCCTGCTACTCAGGCCAGG + Intronic
901064013 1:6486153-6486175 CCGCCTCGGAGCCTCAGCCCAGG + Intronic
902398529 1:16145146-16145168 CCCTGCTGGCGCCTCAGCCCTGG - Intronic
902451501 1:16499352-16499374 CCCCGCCCCCGCCTCGGCCCCGG - Intergenic
903563421 1:24246139-24246161 CTGAGCCTGAGCCTGAGCCCAGG + Intergenic
904267273 1:29325218-29325240 CTGCGCCTGCGCCACGGTCCTGG + Exonic
904467836 1:30718630-30718652 CTCCGTCTGCGCCTCAGCCTCGG + Intronic
906326678 1:44850497-44850519 CCACGCCTGAGCATCAGCCCAGG - Intergenic
908128750 1:61054054-61054076 CAGCTCCTGCGCCTCAGGCTCGG + Intronic
908355492 1:63322695-63322717 CCGCTCCTGCGCCCCACGCCAGG + Intergenic
908523489 1:64966441-64966463 CCGCGACCCCTCCTCAGCCCTGG - Exonic
911055179 1:93702531-93702553 CCCCACCTGGGCCTGAGCCCAGG - Intronic
911176258 1:94820648-94820670 CCCCGCCTCCGCCCCAGCACTGG - Intronic
913274172 1:117121709-117121731 CCTCTCCCGCGCCTCGGCCCGGG + Exonic
914192781 1:145425612-145425634 CTGCGCCTGCGCCTGCGCCTTGG - Intergenic
914386165 1:147172233-147172255 CCGCCCCTGCGCCTCGGGACAGG + Intronic
915031460 1:152883459-152883481 ACGTCCCTGGGCCTCAGCCCAGG - Intronic
915236767 1:154489151-154489173 CCGCGCCTTCCCCTCTGCCCTGG + Exonic
916786335 1:168089746-168089768 CTGCCCATGCGCCTCTGCCCAGG + Intronic
916792513 1:168136709-168136731 CCGCGCCCGCGCCCCACGCCGGG + Intronic
921089558 1:211830408-211830430 CCGCGCCCCCGCCTCCTCCCCGG + Intronic
923631153 1:235650099-235650121 CCCCGCCCCCGCCCCAGCCCGGG + Intronic
924527424 1:244864381-244864403 CTGCGGCTGCTCCTCGGCCCGGG + Exonic
924624661 1:245688457-245688479 GCGCGCCTCCGCCTCGGGCCCGG - Exonic
1062982517 10:1737147-1737169 CCGCGCCTGGGTCTCGGCCATGG - Exonic
1063407737 10:5813170-5813192 CCGCCCCGGCTGCTCAGCCCCGG + Intronic
1063407741 10:5813184-5813206 CAGCCCCGGCCCCTCAGCCCTGG + Intronic
1064081135 10:12308910-12308932 CCGGGACTGAGCCTGAGCCCGGG - Intergenic
1064622443 10:17229379-17229401 CCGCGCCACCGCCGCCGCCCAGG + Exonic
1067102433 10:43342902-43342924 CAGGGCCTGCTCCTCACCCCAGG + Intergenic
1069720571 10:70547193-70547215 CAGCGCCTGGGCCTTAGGCCTGG + Intronic
1069830412 10:71279291-71279313 CCACCCCTGCCCCGCAGCCCTGG + Intronic
1069993411 10:72328676-72328698 CCTCGCCTACTCCTCTGCCCAGG - Intergenic
1070098190 10:73358861-73358883 CTGCGCCTGCGCCCTAGCGCCGG + Intergenic
1070284437 10:75072860-75072882 ACGGGCCTGCGTCTCAGACCAGG - Intergenic
1070752780 10:78973863-78973885 CCGCGCCCCGGCCCCAGCCCCGG - Intergenic
1071573377 10:86709985-86710007 CCGCCCCTGCACCCAAGCCCCGG + Exonic
1071573667 10:86711326-86711348 GCTCGCCTGGGCCCCAGCCCGGG - Intronic
1071618173 10:87094969-87094991 CCGGGCCTCCGCCTCCGCCGCGG + Intronic
1073079266 10:100847700-100847722 CTGAGCCTGTGACTCAGCCCTGG - Intergenic
1074829857 10:117240941-117240963 CCGCGGCCGCGCCTCTTCCCCGG - Intergenic
1076373310 10:129968255-129968277 CCGCGCCTGCAGCTCAGCACTGG - Intergenic
1076420745 10:130330014-130330036 CCGTGCCGGCTCCTGAGCCCAGG - Intergenic
1076606975 10:131695490-131695512 CCCGCCCTGAGCCTCAGCCCTGG - Intergenic
1076809732 10:132880256-132880278 CAGTGCCTGGGCATCAGCCCAGG - Intronic
1076864718 10:133160962-133160984 CCGCTCCTGAACCTCAGCTCCGG - Intronic
1077044300 11:537674-537696 CCGCGCCCACGCCTCGGCGCAGG - Intronic
1077058246 11:606306-606328 CTGCGCCTCCCCCACAGCCCTGG - Intronic
1077076566 11:705043-705065 CAGTGCCTGCCCCTGAGCCCAGG - Intronic
1077632326 11:3819156-3819178 CCTCGCCTCAGCCTCAGCCTTGG + Intronic
1080386505 11:31813941-31813963 CCGCGCCCGCACCTCAGTCTCGG - Intronic
1083924355 11:65796915-65796937 CTGGGCCTGAGCCTGAGCCCGGG - Exonic
1085043743 11:73341901-73341923 CTGCAGCTGTGCCTCAGCCCTGG - Intronic
1085519530 11:77129978-77130000 CCGCACCTGGGCCTGGGCCCGGG - Intronic
1085561049 11:77473485-77473507 CCACCCCCGCGCCCCAGCCCTGG + Intronic
1085593671 11:77789454-77789476 CCTTGCTTGTGCCTCAGCCCCGG - Intronic
1089511173 11:118998190-118998212 CTGCGCCGGCGCCATAGCCCGGG - Exonic
1091124273 11:133082157-133082179 CCGGGCCTGGGCCTCCGCCTCGG + Intronic
1091397811 12:164423-164445 CCCCGCCCTCTCCTCAGCCCTGG + Intronic
1091445749 12:543429-543451 CCGCCCCAGCTCCTCAGCTCCGG - Intronic
1091445805 12:543639-543661 CCGCCCCAGCTCCTCAGCTCCGG - Intronic
1091445860 12:543849-543871 CCGCCCCAGCTCCTCAGCTCCGG - Intronic
1091445905 12:544017-544039 CCGCCCCAGCTCCTCAGCTCCGG - Intronic
1091445916 12:544059-544081 CCGCCCCAGCTCCTCAGCTCTGG - Intronic
1091588270 12:1828170-1828192 GCGAGCCTGCCCCTCTGCCCAGG - Exonic
1092242020 12:6841064-6841086 CCCTGCCTGCGCCCCAGCCCAGG - Intronic
1093175676 12:15911253-15911275 CCGGGCCCGCGACTCCGCCCCGG + Exonic
1093890174 12:24510632-24510654 ACGTGCCTGGGCCACAGCCCTGG + Intergenic
1096784419 12:54009067-54009089 CGCCGCCCGCGCCCCAGCCCCGG + Intronic
1097191113 12:57220121-57220143 CTCCTCCTGCGCCTGAGCCCTGG - Intronic
1097192523 12:57226284-57226306 CAGGGCCAGGGCCTCAGCCCAGG - Exonic
1097820868 12:64128039-64128061 CCAGGCCTGCGCCTCCGCTCAGG - Exonic
1099917722 12:88915768-88915790 CCTCACTTGTGCCTCAGCCCTGG + Intergenic
1100469054 12:94873827-94873849 CCGCGCCTCCGCCGCAGCCCGGG - Intergenic
1100564504 12:95782336-95782358 ACGCCCCTGCACCTCAGCCTGGG - Intronic
1100611400 12:96194356-96194378 CCGCGCCTCCCCCGCCGCCCCGG - Intergenic
1103764709 12:123271823-123271845 CCGCCCCTGCGCCGCACCCGGGG - Exonic
1103856325 12:123973102-123973124 CCGCCCCCGCCCCCCAGCCCCGG - Exonic
1104030944 12:125065515-125065537 CCCGGCCCTCGCCTCAGCCCCGG + Exonic
1105004310 12:132711306-132711328 CCGCCCCTGCGAGTCCGCCCTGG + Intronic
1105578631 13:21674461-21674483 CCGCGCCCCCGCCTCCGCTCCGG + Intronic
1105964416 13:25371961-25371983 CCGCCCCCACGCCGCAGCCCGGG + Intergenic
1106208326 13:27620181-27620203 CCACGCCAGCCCCGCAGCCCGGG + Intronic
1106517167 13:30465403-30465425 CCGCGCCGGCCCCGCCGCCCCGG + Intronic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1110444229 13:75559328-75559350 CCGCGCCCGGCCCTCAGCCCCGG + Intronic
1113085633 13:106567443-106567465 CCGCGCCCGGTCCCCAGCCCCGG + Intronic
1113513706 13:110874751-110874773 CCGCCCCTGCGCCTCTCTCCCGG + Intergenic
1113513724 13:110874805-110874827 CCGCGCCGGCGCCCCGCCCCCGG + Intergenic
1113562261 13:111291220-111291242 CCCAGCCTGCCTCTCAGCCCAGG + Intronic
1113861570 13:113490699-113490721 CCGCGCCTGCGCAGAAGGCCGGG - Exonic
1113947455 13:114052193-114052215 CCACGCTTGCGCCTCACCCCCGG + Intronic
1116835736 14:49767976-49767998 CCGCGCCTCCGCCTACGGCCTGG - Exonic
1117478306 14:56118759-56118781 CCCCGCCCGCGCCGCTGCCCGGG - Intronic
1118255076 14:64198714-64198736 CCACTCGTGCTCCTCAGCCCTGG - Intronic
1118725876 14:68628671-68628693 CCACGCCCGCGACTCAGCCCAGG - Intronic
1121448332 14:93992521-93992543 CCCTGGCTGCCCCTCAGCCCTGG + Intergenic
1121853051 14:97240309-97240331 CTGCGCTTGCGCTTCAGCCTGGG + Intergenic
1122081704 14:99271334-99271356 CCGCACCTCCTCCTCTGCCCGGG + Intronic
1122271898 14:100572048-100572070 AGGCACCTGCTCCTCAGCCCTGG + Intronic
1122502560 14:102210994-102211016 CCACCCTAGCGCCTCAGCCCAGG + Intronic
1122905813 14:104800962-104800984 CGGCTCCTGCGCCTGAGTCCCGG + Exonic
1123110471 14:105864763-105864785 CCCTGCCTGGGTCTCAGCCCGGG - Intergenic
1124340309 15:28886005-28886027 CCGGGCCTGCGCCCCCGCCCCGG - Exonic
1125541190 15:40471036-40471058 CCGCTTCGGCGCCGCAGCCCGGG + Exonic
1126982094 15:54255735-54255757 CCACGCCTGGGCCTCTGCCCAGG - Intronic
1128124970 15:65185421-65185443 GCGCGCCTGCGCCCTAGGCCCGG + Intergenic
1128480820 15:68036448-68036470 CCTCACTTGTGCCTCAGCCCCGG - Intergenic
1128841454 15:70854184-70854206 GCGCGCCTGCCGCTCGGCCCAGG + Intronic
1129263294 15:74380952-74380974 CTGCCCCTGCCCCTCACCCCAGG + Intergenic
1130076676 15:80695579-80695601 CGGCGCCGGCGCGTCCGCCCCGG + Exonic
1131144052 15:90000476-90000498 CAGGGCCTGGGCCTCGGCCCCGG - Intergenic
1132079490 15:98852345-98852367 CCGCGCCCGCGCCGCCGCCGTGG + Intronic
1132697954 16:1210267-1210289 CCACGCCTCCACTTCAGCCCCGG - Intronic
1132758770 16:1498958-1498980 CCTTCCCTGCACCTCAGCCCGGG - Intronic
1132793288 16:1705865-1705887 CAGCGCCTGCGCCTCAATCCCGG - Intergenic
1132871260 16:2116738-2116760 CAGCCCCTCCTCCTCAGCCCAGG + Intronic
1132892454 16:2210930-2210952 CTGCGCCTCCCCCTCAGCTCTGG + Exonic
1133286339 16:4692577-4692599 CCGAGGCTGTGCCCCAGCCCTGG + Intergenic
1134521266 16:14920156-14920178 CAGCCCCTCCTCCTCAGCCCAGG - Intronic
1134708941 16:16318807-16318829 CAGCCCCTCCTCCTCAGCCCAGG - Intergenic
1134716151 16:16358841-16358863 CAGCCCCTCCTCCTCAGCCCAGG - Intergenic
1134950664 16:18349838-18349860 CAGCCCCTCCTCCTCAGCCCAGG + Intergenic
1134958602 16:18393318-18393340 CAGCCCCTCCTCCTCAGCCCAGG + Intergenic
1136861550 16:33707235-33707257 CCGCGCCTGCGCCGCCGCCGTGG + Intergenic
1136861558 16:33707264-33707286 CCGCGCCTGCGCCGCCGCCCTGG + Intergenic
1137056889 16:35750260-35750282 CTGCGCTTCCGCCACAGCCCAGG + Intergenic
1137665283 16:50246058-50246080 CCGCCCCCGCGCCCCAGGCCTGG + Intergenic
1138241955 16:55434608-55434630 CCGCCCCTGCCCCCCAACCCCGG + Intronic
1141695309 16:85616280-85616302 CAGCTCCTGCCCCTCAGCTCGGG - Intronic
1141972431 16:87492712-87492734 CGCCGCCCGCGCCTCCGCCCAGG + Intergenic
1143023712 17:3929297-3929319 CCCCGCCTGCCCCACTGCCCTGG - Intronic
1143174618 17:4948985-4949007 CCGCGCCTGCGCCTGCGCCGGGG + Exonic
1143474720 17:7196083-7196105 CCCTGGCTGCGCCTCAGGCCTGG + Intronic
1143924261 17:10355952-10355974 CCAGGCCTGAGCCTGAGCCCGGG - Intronic
1146022587 17:29292806-29292828 CCGCCCCCGCCCCTCACCCCAGG + Intronic
1147970973 17:44219078-44219100 CCCCGCCGGCGCCCCCGCCCCGG + Intronic
1148935688 17:51163188-51163210 CCGCCTCTGCACTTCAGCCCGGG + Intronic
1150638255 17:66931713-66931735 CCGCGCCCGCCCCCCAACCCCGG - Intergenic
1151536321 17:74740915-74740937 CCATGCCTGAGCCACAGCCCTGG - Intronic
1151605414 17:75132174-75132196 CCGCCACTGCGCCGCAGCCTGGG - Intergenic
1151653013 17:75481558-75481580 CGGCAACTGAGCCTCAGCCCTGG - Intronic
1151780200 17:76240424-76240446 CCGCGGCGGCGCCTCTGCCAAGG + Intergenic
1152206522 17:78977305-78977327 CCCCGCCTGCCACACAGCCCAGG - Intronic
1152515649 17:80822296-80822318 CCCGGCCCGCGCCTCACCCCGGG - Exonic
1154210774 18:12377106-12377128 CCGCGCCTGCGCAGCGTCCCGGG - Exonic
1154450775 18:14473976-14473998 CCTCTCCCGCGGCTCAGCCCTGG + Intergenic
1155209231 18:23586565-23586587 TCGCGGCGGCGCCCCAGCCCGGG - Exonic
1157848920 18:51030024-51030046 CTGGGCCTGGGCCTCAGCGCGGG - Intronic
1160100685 18:75916852-75916874 CTGCGCCTGGGCCTCCGCGCAGG - Intergenic
1160765718 19:806653-806675 CTGTGTCTGCGCCTCTGCCCTGG + Intronic
1160967638 19:1753623-1753645 CCGCGCGCGCTCCTCAGCGCCGG - Exonic
1161001387 19:1912833-1912855 CCCCGCCTGCTCCTTCGCCCCGG + Exonic
1161425036 19:4198540-4198562 CCGCTCCTGCGCCCCCTCCCCGG - Intronic
1161490119 19:4556905-4556927 CGGCCCCTGCGAATCAGCCCTGG - Intronic
1161646138 19:5454648-5454670 CCCTGCCTGAGCTTCAGCCCTGG - Intergenic
1161925338 19:7294915-7294937 CCGCGAGTGCGCCCCGGCCCAGG + Intergenic
1162378319 19:10317718-10317740 GGGCTCCTGGGCCTCAGCCCCGG - Exonic
1162772407 19:12957106-12957128 CCGCCCCCGCGCCGCAGGCCGGG - Exonic
1163489001 19:17606048-17606070 CCGCGCCTGCGCCTTAGCGCGGG - Exonic
1163890770 19:20010612-20010634 TCGCGCCTGCACTCCAGCCCGGG + Intronic
1165445894 19:35856659-35856681 CCTTGCCTGCCCCTCAACCCCGG + Intronic
1165493545 19:36139539-36139561 CAGCGCCTGCGCCGCCTCCCAGG - Intergenic
1165573663 19:36796237-36796259 CCGCCCCTGCGCTCCAGCCTGGG - Intergenic
1165950036 19:39469194-39469216 CCGCCCCTGCTCCTTGGCCCAGG - Intronic
1166297564 19:41896486-41896508 CCGCCCCTGCACCCCAGCCTGGG - Intronic
1167040040 19:47018761-47018783 CCGCCACTGCGCTCCAGCCCGGG - Intergenic
1167688268 19:50969607-50969629 CTGGGCCTGCTCCCCAGCCCGGG - Intronic
1168685676 19:58347726-58347748 CCGCGCCTGCGCCTCAGCCCCGG + Intronic
927496760 2:23556294-23556316 CCACGCCTGCGCCTCCGCGAGGG - Intronic
927881491 2:26692818-26692840 CCCGGCCCGCGCCTCGGCCCCGG - Exonic
928341494 2:30447131-30447153 CCGCGCTTGCTCCACAGCCCGGG - Intergenic
933995348 2:87664098-87664120 CAGGGCCAGCGGCTCAGCCCTGG + Intergenic
934534491 2:95121805-95121827 CCGCGCCTCGGCCTCCGCCCAGG + Exonic
936298512 2:111286818-111286840 CAGGGCCAGCGGCTCAGCCCTGG - Intergenic
937908703 2:127065016-127065038 CCCAGCCTGGGCCCCAGCCCCGG - Intronic
941526038 2:166608434-166608456 CATGGCCTGGGCCTCAGCCCTGG + Intergenic
943394199 2:187312645-187312667 CCGCGCCTGCCCCTCACATCAGG - Intergenic
943947841 2:194090487-194090509 CCACGCCTGAGCCCCACCCCAGG - Intergenic
946334730 2:219029254-219029276 CCACTCCTGGGCCCCAGCCCTGG - Intronic
946404076 2:219483587-219483609 CAGCGCCGGAGCCCCAGCCCGGG + Exonic
948280861 2:236747118-236747140 CCTCGCCTGCCCCACAGCCCCGG - Intergenic
948410378 2:237755204-237755226 CCCCACCTGAGGCTCAGCCCAGG - Intronic
1168760496 20:347079-347101 TCGCGCCTGCGCCGCAGTTCGGG - Exonic
1168965222 20:1894682-1894704 CCGCGCCGGCGCCCGGGCCCCGG - Intronic
1170226312 20:13995359-13995381 CTGCGCCTGCGCGTGCGCCCTGG + Exonic
1170612773 20:17928306-17928328 CCACGCCCTAGCCTCAGCCCAGG + Intergenic
1172252469 20:33489796-33489818 CCGAGCCTGGGCCACTGCCCTGG + Intergenic
1172387420 20:34543898-34543920 TCATGCCTCCGCCTCAGCCCTGG + Intergenic
1172905895 20:38369052-38369074 CCGCTCCTGAACTTCAGCCCTGG + Exonic
1174091519 20:48052395-48052417 CCCCACCTGCACCTCAGGCCAGG + Intergenic
1174246720 20:49187785-49187807 CCCCGCCTGCGCCCCAGCCCCGG + Intronic
1174374002 20:50113186-50113208 GCGCGCCTGCGCATCAGGGCCGG - Intronic
1175108228 20:56629219-56629241 CGGCGCCTGGGCCTCCGCGCCGG + Intergenic
1175699230 20:61125143-61125165 CTGGGCCTGCGCCTCTGACCTGG - Intergenic
1175715823 20:61253410-61253432 CCGCCCCTCCGCCTCCGCCCAGG - Intronic
1175961085 20:62636672-62636694 ACGCGCCGCCGACTCAGCCCTGG + Intergenic
1176015545 20:62929359-62929381 GCGCGCCTGGGCCTCGGCGCTGG + Intronic
1176099717 20:63359369-63359391 CCCCGCCTGAGCCCCAGCCAAGG - Intronic
1176182177 20:63755127-63755149 CCGCAGCTGCGGCTCTGCCCTGG - Intronic
1176207215 20:63895493-63895515 CCGCGCCCCCGCCCCGGCCCAGG - Intronic
1176445456 21:6816598-6816620 CCTCTCCCGCGGCTCAGCCCTGG - Intergenic
1176547782 21:8208965-8208987 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1176574608 21:8436199-8436221 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1176611221 21:8987491-8987513 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1176823624 21:13681631-13681653 CCTCTCCCGCGGCTCAGCCCTGG - Intergenic
1177920301 21:27143751-27143773 CCGCAGCGGCGCCTCGGCCCCGG - Intergenic
1178544245 21:33479917-33479939 CCGCGGCTCCACCTCAGCCCCGG + Exonic
1178914580 21:36699385-36699407 CAGCGCCTCCGCCTCCGCGCCGG + Exonic
1178948391 21:36966676-36966698 CCGCCCCAGCGCCCCAGGCCCGG + Intronic
1179197892 21:39183168-39183190 CCGCGACGGCGCCTAAGGCCGGG - Intronic
1179833500 21:44012690-44012712 CCCCGCCTCAGCCGCAGCCCTGG - Intronic
1179924616 21:44527619-44527641 CGACTCCTGCGCCTCAGCCTCGG + Intronic
1179962034 21:44773002-44773024 CTGCCTCTGGGCCTCAGCCCAGG + Intronic
1180781758 22:18524260-18524282 GCGCTACTGCTCCTCAGCCCGGG + Intergenic
1180791451 22:18577598-18577620 TCCCGCGTGCGCCCCAGCCCAGG + Intergenic
1181023738 22:20116463-20116485 CAGGGCCGGGGCCTCAGCCCGGG - Exonic
1181230288 22:21417713-21417735 TCCCGCGTGCGCCCCAGCCCAGG - Intronic
1181248362 22:21517150-21517172 TCCCGCGTGCGCCCCAGCCCAGG + Intergenic
1181270819 22:21657619-21657641 CCGCACCTGCGCCGCGGCCGTGG + Intronic
1181514361 22:23402664-23402686 CCGCGCCCGCGCCGGCGCCCAGG - Intergenic
1182586323 22:31346097-31346119 CCGCTCCGGCGCCCCCGCCCCGG - Exonic
1183326840 22:37199029-37199051 CCGCGCCAGGCCCTCTGCCCCGG + Intronic
1183488964 22:38106715-38106737 CAGCCCCTGCGCCCAAGCCCTGG + Intronic
1183732396 22:39625994-39626016 TCGCCCCTGCGCCACAGCCTGGG - Intronic
1183821135 22:40346721-40346743 CCGGCCCAGCCCCTCAGCCCGGG - Intronic
1203252656 22_KI270733v1_random:125250-125272 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1203260712 22_KI270733v1_random:170336-170358 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
952644651 3:35640123-35640145 CCGAGCCGCCGCCGCAGCCCTGG + Intronic
954440041 3:50516769-50516791 AGGCCCCTGCCCCTCAGCCCTGG - Intergenic
955060404 3:55488057-55488079 CCGCGGCGGCGACTCAGCTCCGG + Intronic
955140103 3:56260437-56260459 TCGCCCCCGCGCCCCAGCCCTGG + Intronic
958894858 3:99818088-99818110 CCTTCCGTGCGCCTCAGCCCTGG + Intronic
959530739 3:107431552-107431574 CCGCGCTTCCGCCCGAGCCCCGG - Intergenic
961121941 3:124380209-124380231 CTGCTTCTCCGCCTCAGCCCAGG + Intronic
961346596 3:126267411-126267433 CCGCCCCAGCGCCACAGCCTGGG - Intergenic
961367411 3:126408823-126408845 CTGCACCTGCACCTCAGCCTGGG - Intronic
961502828 3:127349985-127350007 CCCCGCCTGCGCAGCAGCCTCGG - Intergenic
961858248 3:129893663-129893685 CGCCGCCGCCGCCTCAGCCCCGG + Intergenic
962222320 3:133574043-133574065 CCGCTCCTCCGTCTCAGCCATGG - Exonic
962263178 3:133927704-133927726 CCGCCCCTCCGCCGCGGCCCGGG - Intergenic
966298505 3:178451995-178452017 GCACACCTGCTCCTCAGCCCTGG + Intronic
967969593 3:194989128-194989150 CCACTCCTAAGCCTCAGCCCAGG + Intergenic
968236661 3:197035475-197035497 TCCTGCCTGAGCCTCAGCCCTGG - Intergenic
968372873 4:11579-11601 CCGCGCCTGCGCCTTGTCCTCGG - Intergenic
968907978 4:3463325-3463347 TCGCCCCGGCGCCCCAGCCCAGG - Exonic
969115010 4:4865968-4865990 CCCTCCCTGCGCCGCAGCCCGGG + Intergenic
969297892 4:6280305-6280327 CGGCCCCTGCCCATCAGCCCTGG - Intronic
969461036 4:7329083-7329105 CCAAGCCTGTGCCCCAGCCCTGG + Intronic
972321623 4:37977558-37977580 CCGCGCCTGCCGCTCCGCTCCGG - Intronic
972396521 4:38663733-38663755 CCGCGCCGCCGCCCGAGCCCGGG - Intergenic
973551302 4:52038325-52038347 GCGCGCCTGCGCTTGCGCCCTGG + Exonic
975622162 4:76306571-76306593 CCGCCCCTGGGCTGCAGCCCCGG - Intronic
978126956 4:105146595-105146617 CCCGGCCTGCGCCGCCGCCCTGG - Exonic
979582787 4:122379621-122379643 CTGCTGCTGCGCCTCAGGCCGGG - Intronic
981579592 4:146238399-146238421 CAGCGCCACAGCCTCAGCCCTGG - Intergenic
981998512 4:151001219-151001241 CCCCGCTTGTGCCTCAGTCCTGG - Intronic
982191035 4:152855508-152855530 CAGTGCTTGTGCCTCAGCCCTGG + Intronic
985264357 4:188144403-188144425 GCGCCCCTGCGCTCCAGCCCGGG - Intronic
985299202 4:188469589-188469611 GCGCCCCTGCACTTCAGCCCCGG + Intergenic
985462523 4:190120988-190121010 CCGCGCCTGCGCCTTGTCCTCGG + Intergenic
991330207 5:65485570-65485592 CCACGCCTGAGCCTCCCCCCCGG - Intergenic
997350797 5:133230158-133230180 ACTGGCCTGTGCCTCAGCCCTGG + Intronic
1001826695 5:174751211-174751233 CCGAGCCGGCTCCTCCGCCCCGG - Intergenic
1001907456 5:175484665-175484687 CGGCGCATCCTCCTCAGCCCAGG + Intronic
1002424384 5:179166800-179166822 CCGAGTCTGTGCCCCAGCCCTGG + Intronic
1002465765 5:179407691-179407713 CTGAGCCTGTGCCTCGGCCCTGG + Intergenic
1002541310 5:179907994-179908016 CCGCGCCGCCCCCTCAGCCCCGG + Intergenic
1002718419 5:181243511-181243533 CCGAGCCTAGGCCTCAACCCGGG - Intronic
1005623987 6:27646241-27646263 TGCCACCTGCGCCTCAGCCCAGG + Intergenic
1006611654 6:35297838-35297860 CCGGGCGGGCGCCTCAGCCATGG + Exonic
1006932765 6:37697614-37697636 CGGCGCCCGCGCCGCAGCCCCGG - Exonic
1008660823 6:53665793-53665815 CCGAGCCTGCGCTTTGGCCCGGG + Intergenic
1009437727 6:63636476-63636498 GCGCGCCCGCGCCTCAGCGGCGG - Intronic
1013306109 6:108848454-108848476 CCGCGCCAGCGCTGCATCCCTGG + Exonic
1013651338 6:112198161-112198183 CAGGTCCTGGGCCTCAGCCCTGG + Intronic
1016340922 6:143060817-143060839 CCGCGCCCGCGCCCGCGCCCGGG + Intronic
1016596991 6:145814492-145814514 CAGCGCCAGCGCCTCGGTCCCGG + Intronic
1018661148 6:166088371-166088393 CCCCTCCTGAGCCTCAGCCAGGG + Intergenic
1018793498 6:167168635-167168657 CCCCTCCTGAGCCTCAGCCGGGG - Intronic
1018823217 6:167389743-167389765 CCCCTCCTGAGCCTCAGCCGGGG + Intergenic
1018883887 6:167915372-167915394 CAGCCCCTGCTTCTCAGCCCAGG - Exonic
1019145873 6:169975343-169975365 CCACGCCTGCCCCTCAGTCGAGG + Intergenic
1019343180 7:518059-518081 CCGCGGCTGGGCCGGAGCCCGGG - Intronic
1019596588 7:1861177-1861199 CCGAGCCCCAGCCTCAGCCCCGG - Intronic
1020125309 7:5530028-5530050 GCCCGCCTTCGCCCCAGCCCAGG + Intronic
1020257681 7:6510981-6511003 CCACGCCTGAGCCCCAGCCGCGG - Exonic
1023262656 7:38373397-38373419 CCGGTCATGGGCCTCAGCCCAGG + Intergenic
1024953429 7:54889467-54889489 CCCCTCCTCTGCCTCAGCCCAGG + Intergenic
1025032831 7:55571879-55571901 CCGCGCCTGCGCCGCGCCCGAGG + Intronic
1026440263 7:70438001-70438023 CAGTGCCTGGGCCTCATCCCAGG + Intronic
1029367881 7:100127852-100127874 CAGCCCCTGCGCCTGGGCCCGGG + Exonic
1029539338 7:101173552-101173574 CCCCGCCTGCGCCCCTGCCAGGG + Intronic
1032119904 7:129148251-129148273 CAGCCCCTGTGTCTCAGCCCAGG + Intronic
1032194428 7:129780958-129780980 CCGCGTCCGCGCCCCAGCCCCGG - Intergenic
1032947701 7:136871077-136871099 CAGCCCCTGCTCCACAGCCCGGG + Intronic
1033186567 7:139231825-139231847 CCGCGGCGGCTGCTCAGCCCGGG - Exonic
1033365950 7:140672912-140672934 CCCCGCCTGCGCCCGCGCCCTGG + Intronic
1033595333 7:142854929-142854951 CGGCGCCCGCTCCTCCGCCCCGG - Intergenic
1034254072 7:149714917-149714939 CCGCCCCTCCCCCTCGGCCCAGG + Intronic
1034345105 7:150381180-150381202 CCTCCCCTGCGCCACACCCCTGG - Intronic
1034490401 7:151390175-151390197 CCTCCCCTGCTCCGCAGCCCTGG - Intronic
1035249070 7:157585218-157585240 CTGCAGCTGCTCCTCAGCCCTGG - Intronic
1035472426 7:159119070-159119092 CCAAGGCTGGGCCTCAGCCCTGG - Intronic
1036593894 8:10194816-10194838 CCCAGCCTGGCCCTCAGCCCTGG + Intronic
1036789439 8:11708474-11708496 CAGAGCCCGCGCCTCCGCCCTGG - Exonic
1037450647 8:19013533-19013555 CCGCGCCCGCGCCCCGGCCCCGG + Intronic
1037803907 8:22049123-22049145 CCTCGCCTGCGCCTCGGGCCTGG - Intronic
1037903819 8:22703738-22703760 CCGCGTCTGAACCGCAGCCCGGG + Intergenic
1038596581 8:28891148-28891170 TCACGCCCGCCCCTCAGCCCAGG - Intronic
1048976094 8:139673944-139673966 CCGCCCCTGCCCCACCGCCCTGG + Intronic
1053643123 9:40106765-40106787 CGGCGGCTGCGGCGCAGCCCGGG + Intergenic
1053763027 9:41358724-41358746 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1054333332 9:63781653-63781675 CCGCGCCTGCGCCGGCGCTCTGG - Intergenic
1054541633 9:66269838-66269860 CGGCGGCTGCGGCGCAGCCCCGG - Intergenic
1059176768 9:112175256-112175278 GCGCGCCCGCGCCTCCTCCCGGG + Exonic
1060770111 9:126326615-126326637 CCGAGCCCGCGCCGCCGCCCCGG - Intergenic
1061287889 9:129634459-129634481 CCGAGCCTGTCCCTCAGTCCTGG - Intronic
1061326157 9:129866042-129866064 CCACGCGTACACCTCAGCCCCGG + Intronic
1062279516 9:135745720-135745742 CAGCGCCTGGGCCTCCTCCCTGG - Intronic
1062443495 9:136583821-136583843 CCGGGGCTGCCCCTCTGCCCCGG - Intergenic
1062629521 9:137457604-137457626 CAGCCCCTGCGCGCCAGCCCTGG - Exonic
1203523739 Un_GL000213v1:67927-67949 CCTCTCCCGCGGCTCAGCCCTGG + Intergenic
1203469059 Un_GL000220v1:108401-108423 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1203476880 Un_GL000220v1:152373-152395 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1186029984 X:5357368-5357390 GCGCCCCTGCGCTCCAGCCCGGG + Intergenic
1191184261 X:57592644-57592666 CCGCTCCTGCCCAGCAGCCCGGG + Exonic
1191213133 X:57909815-57909837 CCGCTCCTGCCCAGCAGCCCAGG - Exonic
1191842382 X:65522488-65522510 CTTCCCCTGCTCCTCAGCCCGGG - Intronic
1192452866 X:71254319-71254341 CGGCGCCTGAGCCCCCGCCCGGG + Intronic
1195923230 X:110002808-110002830 CCGCGCCTCCCGCCCAGCCCCGG - Intronic
1197734893 X:129843406-129843428 CCGCGCCCGCGGCTCGGCCCCGG - Intronic
1199500379 X:148500704-148500726 CCGCGCCGCTGCCTCTGCCCCGG + Exonic
1200128763 X:153830207-153830229 CCGCGCCCCCGCCGCAGCGCCGG + Intronic
1200142110 X:153907538-153907560 TCCTGCCTGCCCCTCAGCCCTGG - Exonic
1200177173 X:154125440-154125462 CCGCGCCCCAGCCTCAGCCCCGG + Intergenic