ID: 1168685701

View in Genome Browser
Species Human (GRCh38)
Location 19:58347834-58347856
Sequence GGGGACACTCACGTGTGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 92}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168685701_1168685722 28 Left 1168685701 19:58347834-58347856 CCGCGCCACACGTGAGTGTCCCC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1168685722 19:58347885-58347907 CCAGATTCGGGCCTGCTCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 113
1168685701_1168685716 16 Left 1168685701 19:58347834-58347856 CCGCGCCACACGTGAGTGTCCCC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1168685716 19:58347873-58347895 ACCGTGGAAGTCCCAGATTCGGG 0: 1
1: 0
2: 0
3: 7
4: 100
1168685701_1168685720 27 Left 1168685701 19:58347834-58347856 CCGCGCCACACGTGAGTGTCCCC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1168685720 19:58347884-58347906 CCCAGATTCGGGCCTGCTCTGGG 0: 1
1: 0
2: 0
3: 14
4: 116
1168685701_1168685718 26 Left 1168685701 19:58347834-58347856 CCGCGCCACACGTGAGTGTCCCC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1168685718 19:58347883-58347905 TCCCAGATTCGGGCCTGCTCTGG 0: 1
1: 0
2: 0
3: 7
4: 95
1168685701_1168685707 0 Left 1168685701 19:58347834-58347856 CCGCGCCACACGTGAGTGTCCCC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1168685707 19:58347857-58347879 GCACCCCTCCCCCAGGACCGTGG 0: 1
1: 0
2: 3
3: 23
4: 312
1168685701_1168685715 15 Left 1168685701 19:58347834-58347856 CCGCGCCACACGTGAGTGTCCCC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1168685715 19:58347872-58347894 GACCGTGGAAGTCCCAGATTCGG 0: 1
1: 0
2: 1
3: 8
4: 93
1168685701_1168685703 -7 Left 1168685701 19:58347834-58347856 CCGCGCCACACGTGAGTGTCCCC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1168685703 19:58347850-58347872 TGTCCCCGCACCCCTCCCCCAGG 0: 1
1: 0
2: 2
3: 44
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168685701 Original CRISPR GGGGACACTCACGTGTGGCG CGG (reversed) Intronic
903164520 1:21510785-21510807 GGGGACACCCACAGGTGGGGAGG - Intronic
905206803 1:36347236-36347258 GGGCGCACTCATGTGTGGGGTGG + Intronic
912431071 1:109628796-109628818 AGGGACACTCACAAGAGGCGGGG - Exonic
912551498 1:110488227-110488249 GGGCACACTCAAGGGTGGCTGGG + Intergenic
914909627 1:151774061-151774083 GGGGAGACACACTTGTAGCGTGG + Exonic
921163901 1:212492181-212492203 TGGGAAACTGAGGTGTGGCGAGG + Intergenic
922429287 1:225532224-225532246 GGGGACACACAAGTGTGGGGAGG + Intronic
924172583 1:241357246-241357268 GGGGACAGTCACGTGGGACAGGG + Intergenic
1069604332 10:69730312-69730334 GGGGACACTCAAGGCTGGTGGGG - Intergenic
1076797430 10:132805077-132805099 GGGGTCACACACATGTGGCCTGG - Intergenic
1076841513 10:133048218-133048240 GAGGCCACTCACGTGTGGACAGG + Intergenic
1078552835 11:12292287-12292309 AGGGACACTCACCTGAGGCGGGG - Exonic
1080740449 11:35059065-35059087 GGGAACAATCACGTGGGTCGAGG + Intergenic
1083954172 11:65973980-65974002 GGGGACACTCAAGTCTGGGCAGG + Intronic
1086594193 11:88551697-88551719 GAGGACACTGAAGTGTGGAGAGG - Intronic
1086608450 11:88725176-88725198 TGGGACACTCAAGTTTGGTGGGG + Intronic
1090435920 11:126686204-126686226 GGGCTTTCTCACGTGTGGCGCGG + Intronic
1101945016 12:109130049-109130071 GGGGACACTGAGGTTTGGAGAGG + Intronic
1113225621 13:108156491-108156513 GGGGAAAATCACGAGTGGTGGGG + Intergenic
1113453310 13:110428573-110428595 GGGGATACTCACGGGAGGCCCGG - Exonic
1113629566 13:111872987-111873009 GGGGACGCTCTTGTGTGGAGAGG + Intergenic
1113994890 14:16057153-16057175 GGCGACACGCAAGTGTGGCGTGG - Intergenic
1124023303 15:25943198-25943220 CAGGACCCTCACGTGTGGGGTGG - Intergenic
1125486275 15:40113067-40113089 GTGCACACACACGTATGGCGGGG + Intergenic
1127588323 15:60398161-60398183 GGGGCCGCTCCCGCGTGGCGCGG - Intronic
1128224740 15:65993904-65993926 GGGGACACTGACGTCTGGAAGGG - Intronic
1129961225 15:79686935-79686957 GGGGGCAGTCAAGTGTGGCAAGG - Intergenic
1137447185 16:48539094-48539116 GGGGACAGTCAAGTATGGCTGGG + Exonic
1138539773 16:57680719-57680741 GAGGACACTAACGTGTGGAGGGG - Intronic
1141695067 16:85615204-85615226 TGGGCCCCTCACCTGTGGCGTGG - Intronic
1141742671 16:85904385-85904407 GGGGACAGTCATCTGTGGCTGGG - Intronic
1141841131 16:86574805-86574827 GAGGACACTCACGTGGGCTGTGG + Intergenic
1142227261 16:88883670-88883692 GGGGTCACTCACGTCTCCCGTGG - Intronic
1143013675 17:3880194-3880216 TGGGGCATGCACGTGTGGCGGGG - Intronic
1146581242 17:34040230-34040252 GGGGCCACTCGGGTGCGGCGCGG + Intronic
1148798884 17:50210805-50210827 GGGGACACTGAGGAGAGGCGGGG + Intergenic
1150108516 17:62478907-62478929 GGGGCCACTCGGGTGCGGCGCGG - Intronic
1151581177 17:74979888-74979910 GGGGACAGTCACATGAGGAGTGG - Intergenic
1151965060 17:77426805-77426827 GGGGACACTGACTTGTGTTGTGG + Intronic
1153935136 18:9914347-9914369 GGGGACACCCCCGGGTGGGGTGG + Intronic
1160270123 18:77376128-77376150 AGGAAGACTCACGTGGGGCGGGG + Intergenic
1162002135 19:7751895-7751917 GGGGACACTCACCTGTCCCCAGG - Intergenic
1162188886 19:8929091-8929113 GGGGACACTAAAGTCTGGGGAGG + Intronic
1167356370 19:49006717-49006739 TGGGAGACTGAGGTGTGGCGAGG + Intronic
1168173949 19:54609294-54609316 GGGGACACTGAGGTGGGGCGAGG - Intronic
1168685701 19:58347834-58347856 GGGGACACTCACGTGTGGCGCGG - Intronic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
928310507 2:30205744-30205766 GAGGACACTCAGGTGAGGGGTGG + Intergenic
929810578 2:45186226-45186248 TGAGACACTCAGGTGTGGCTTGG - Intergenic
930860346 2:56065396-56065418 TGGGACACTCAAGTTTGGTGGGG - Intergenic
932445642 2:71779402-71779424 AGGGCCTCTCACATGTGGCGGGG - Intergenic
932879270 2:75485435-75485457 AGGGAGACTCACTTGTGGCCAGG - Intronic
934652212 2:96099157-96099179 AGGTAGACTCACGTGTGGCTGGG - Intergenic
938536579 2:132253603-132253625 GGCGACACGCAAGTGTGGCGTGG + Intronic
941076378 2:161010579-161010601 TGGGACACTCGCGTTTGGTGGGG + Intergenic
948150241 2:235739148-235739170 GGGGACACTGAGATGGGGCGAGG + Intronic
1171865478 20:30485378-30485400 GGTGACACCAAAGTGTGGCGCGG + Intergenic
1173850679 20:46216031-46216053 GGGGTCAGTCCCCTGTGGCGGGG + Intronic
1178827905 21:36031899-36031921 GGGGACACTGGCGTGTCGTGTGG + Intergenic
1178827929 21:36032006-36032028 GGGGACACTGGCGTGTTGTGTGG + Intergenic
1178827938 21:36032048-36032070 GGGGACACTGGCGTGTCGTGCGG + Intergenic
1178827962 21:36032155-36032177 GGGGACACTGGCGTGTTGTGTGG + Intergenic
1178827980 21:36032241-36032263 GGGGACACTGACGTGTTGTGTGG + Intergenic
1178843607 21:36156900-36156922 GGGCGCGCTCACGTGCGGCGCGG - Intronic
1180312202 22:11250256-11250278 GGCGACACGCAAGTGTGGCGTGG + Intergenic
1181567899 22:23750969-23750991 GGGGCCACTCACCTGGGCCGGGG + Exonic
1181604066 22:23969503-23969525 TGGGACACTCAGGTGTGGAATGG - Intronic
1182058919 22:27382654-27382676 GGGGAGACTCAAATGTGGGGAGG - Intergenic
1182282556 22:29225770-29225792 GGTGACACTCCCGTGAGGAGGGG + Intronic
951653708 3:24981505-24981527 TGGGACACTGAAGTGTGGTGGGG - Intergenic
953694298 3:45145950-45145972 GGGGACACTCTCACGTGCCGAGG + Intronic
954462056 3:50632898-50632920 GGGGACACCCATGTGTGGGTGGG + Intronic
954747516 3:52795471-52795493 GGGGCCACTCAGGTGTGTGGGGG + Intronic
963680704 3:148372119-148372141 GAGGACACTGAAGTGGGGCGGGG - Intergenic
966854277 3:184183683-184183705 GGAGACACTGATGTGTGGTGGGG - Exonic
975638789 4:76478269-76478291 TGGGACACTCAAGTTTGGTGGGG + Intronic
983939764 4:173527007-173527029 GAGGACACTCCCGTGTGGTAAGG - Exonic
985481313 5:112786-112808 GGGGACAACCACTTGTGGGGAGG - Intergenic
985688451 5:1294307-1294329 GGGTCCACTAGCGTGTGGCGGGG + Exonic
989571777 5:42952128-42952150 GGGGACACTCACAAGTTGTGTGG + Intergenic
1001841573 5:174880928-174880950 GGGGAGACTCAGGCATGGCGGGG - Intergenic
1006879396 6:37325986-37326008 GGGGACATTCACTTGTGCAGGGG + Intronic
1008407595 6:51136288-51136310 AGGGACACTCAAGTTTGGTGGGG - Intergenic
1017709693 6:157156630-157156652 GGTGACGCTCACGAGTGGCTTGG - Intronic
1020432872 7:8131262-8131284 GGGGACACTCAGTTGTGGATTGG - Intronic
1023056233 7:36292134-36292156 CGGGGCACTCACATGTAGCGTGG - Intronic
1029513746 7:101013132-101013154 GGGGACACTCACAGGCAGCGGGG - Exonic
1032037552 7:128531448-128531470 GGGGCCACTCGGGTGCGGCGCGG - Intergenic
1032223292 7:130010359-130010381 GGGGAAACTGAGGTGTGGAGTGG - Intergenic
1034358858 7:150476760-150476782 GGGGACACTCACAGGTGCCAGGG + Intronic
1037931290 8:22881853-22881875 GGGGAAACTTAGGTGTGGAGAGG - Intronic
1037956389 8:23063722-23063744 GGGTGCACTCAGGTGTGGCCTGG - Intronic
1047248627 8:123165516-123165538 GGAGACAGTGACCTGTGGCGGGG - Intergenic
1049585676 8:143431361-143431383 GGGGACACACGCGTGCGGGGCGG + Intergenic
1057022792 9:91713614-91713636 GAGGAGACTCACGTGTTGTGGGG - Intronic
1059406006 9:114098626-114098648 GGGGACACTCACTAGGGCCGGGG + Intronic
1061023314 9:128031099-128031121 GGAGCCACTCACCTGTGGCTGGG + Intergenic
1062033404 9:134372128-134372150 GGGGAAACTGAGGTGTGGAGAGG + Intronic
1062688188 9:137827231-137827253 AGGGACACTCATGGGAGGCGAGG - Intronic
1203360681 Un_KI270442v1:217698-217720 GGTGACACGCAAGTGCGGCGCGG + Intergenic
1190142588 X:47861177-47861199 GGGGACAGTCTTGTGTGGCTGGG + Intronic
1196352116 X:114744011-114744033 GGGGACAATCATGAGTGGGGTGG + Intronic