ID: 1168687726

View in Genome Browser
Species Human (GRCh38)
Location 19:58358512-58358534
Sequence GAGGAGCAAGAGGCTCCCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 1, 2: 3, 3: 32, 4: 217}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168687726_1168687741 19 Left 1168687726 19:58358512-58358534 CCCAGGGGAGCCTCTTGCTCCTC 0: 1
1: 1
2: 3
3: 32
4: 217
Right 1168687741 19:58358554-58358576 ACCAGCTCCTCTTGGGGCCTGGG 0: 1
1: 0
2: 2
3: 32
4: 409
1168687726_1168687744 21 Left 1168687726 19:58358512-58358534 CCCAGGGGAGCCTCTTGCTCCTC 0: 1
1: 1
2: 3
3: 32
4: 217
Right 1168687744 19:58358556-58358578 CAGCTCCTCTTGGGGCCTGGGGG 0: 1
1: 0
2: 2
3: 30
4: 391
1168687726_1168687739 13 Left 1168687726 19:58358512-58358534 CCCAGGGGAGCCTCTTGCTCCTC 0: 1
1: 1
2: 3
3: 32
4: 217
Right 1168687739 19:58358548-58358570 CTGGGGACCAGCTCCTCTTGGGG 0: 1
1: 0
2: 1
3: 18
4: 221
1168687726_1168687745 25 Left 1168687726 19:58358512-58358534 CCCAGGGGAGCCTCTTGCTCCTC 0: 1
1: 1
2: 3
3: 32
4: 217
Right 1168687745 19:58358560-58358582 TCCTCTTGGGGCCTGGGGGCTGG 0: 1
1: 0
2: 6
3: 79
4: 513
1168687726_1168687743 20 Left 1168687726 19:58358512-58358534 CCCAGGGGAGCCTCTTGCTCCTC 0: 1
1: 1
2: 3
3: 32
4: 217
Right 1168687743 19:58358555-58358577 CCAGCTCCTCTTGGGGCCTGGGG 0: 1
1: 0
2: 14
3: 208
4: 3410
1168687726_1168687740 18 Left 1168687726 19:58358512-58358534 CCCAGGGGAGCCTCTTGCTCCTC 0: 1
1: 1
2: 3
3: 32
4: 217
Right 1168687740 19:58358553-58358575 GACCAGCTCCTCTTGGGGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 238
1168687726_1168687729 -6 Left 1168687726 19:58358512-58358534 CCCAGGGGAGCCTCTTGCTCCTC 0: 1
1: 1
2: 3
3: 32
4: 217
Right 1168687729 19:58358529-58358551 CTCCTCTCCCTCCTCTGTCCTGG 0: 1
1: 1
2: 11
3: 118
4: 796
1168687726_1168687730 -5 Left 1168687726 19:58358512-58358534 CCCAGGGGAGCCTCTTGCTCCTC 0: 1
1: 1
2: 3
3: 32
4: 217
Right 1168687730 19:58358530-58358552 TCCTCTCCCTCCTCTGTCCTGGG 0: 1
1: 0
2: 1
3: 74
4: 667
1168687726_1168687736 11 Left 1168687726 19:58358512-58358534 CCCAGGGGAGCCTCTTGCTCCTC 0: 1
1: 1
2: 3
3: 32
4: 217
Right 1168687736 19:58358546-58358568 TCCTGGGGACCAGCTCCTCTTGG 0: 1
1: 1
2: 2
3: 21
4: 271
1168687726_1168687738 12 Left 1168687726 19:58358512-58358534 CCCAGGGGAGCCTCTTGCTCCTC 0: 1
1: 1
2: 3
3: 32
4: 217
Right 1168687738 19:58358547-58358569 CCTGGGGACCAGCTCCTCTTGGG 0: 1
1: 0
2: 1
3: 20
4: 224
1168687726_1168687732 -4 Left 1168687726 19:58358512-58358534 CCCAGGGGAGCCTCTTGCTCCTC 0: 1
1: 1
2: 3
3: 32
4: 217
Right 1168687732 19:58358531-58358553 CCTCTCCCTCCTCTGTCCTGGGG 0: 1
1: 0
2: 6
3: 83
4: 656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168687726 Original CRISPR GAGGAGCAAGAGGCTCCCCT GGG (reversed) Exonic
901242194 1:7702033-7702055 CAGGAGCAGGAGGCTTCCTTGGG - Intronic
901425522 1:9180501-9180523 GATGAACAAGATGCTGCCCTTGG - Intergenic
902270818 1:15303319-15303341 GAAGAGAAAGAGGCTCCTCAAGG - Intronic
902543041 1:17167752-17167774 GAGGGCAAAGGGGCTCCCCTGGG - Intergenic
902779037 1:18692839-18692861 GAAGAGCAAGAGCCTCCCAATGG + Intronic
903485648 1:23688078-23688100 GAGCAGGAAGTGGGTCCCCTAGG - Intergenic
904947014 1:34206784-34206806 CAGGAGAGAGAGGCTGCCCTGGG + Intronic
905804031 1:40862874-40862896 GGGGAGCAACAGGCTCTCCTGGG - Intergenic
905872517 1:41413185-41413207 TAGGATCATGAGCCTCCCCTGGG + Intergenic
907311863 1:53543405-53543427 GAGGAGACAGAGGCTCCCAGAGG + Intronic
907404685 1:54246706-54246728 GAGGTGCAAGTGGCTCTCCAGGG - Intronic
911467056 1:98268649-98268671 GAGGAGCAAGAGAATGTCCTTGG - Intergenic
911863009 1:102978875-102978897 GAGGTGCAAGAGGTCCCACTGGG - Exonic
916071988 1:161175847-161175869 GAGGAGCTGGAGGACCCCCTGGG + Exonic
916770725 1:167904939-167904961 GATGAGCAACAGGCTCGCGTGGG - Intronic
917725949 1:177827420-177827442 GAGGAGCAAGGGCATTCCCTGGG - Intergenic
917727466 1:177841185-177841207 TAAGAGAAAGAGGCTCCCTTGGG - Intergenic
919535142 1:198778151-198778173 GAAGAGCCACAGGCTCCCTTTGG + Intergenic
920469396 1:206214021-206214043 GAGGGGCTAGAGGCTCCCACTGG + Intronic
920527032 1:206674873-206674895 GAGGAGCAACAGGCTTCCCTGGG - Intronic
921750273 1:218784064-218784086 GAGGAGAAAAAGGCTCCTCTGGG - Intergenic
922754505 1:228088091-228088113 GATGAGCATGAGGCTCCACGGGG + Intronic
922985315 1:229861804-229861826 CAGGCTCCAGAGGCTCCCCTTGG + Intergenic
923475093 1:234324741-234324763 GAGGAGGGAGAGGCTGCCCCAGG - Intergenic
924447328 1:244145463-244145485 GAGGAGCTGGAGGCGCACCTGGG - Intergenic
924612170 1:245582748-245582770 AAGGAGCAAAAGGCTTCCCTAGG - Intronic
924758361 1:246962563-246962585 GAGAAGCAAGTGGCTTCCGTGGG + Intronic
1065010732 10:21418559-21418581 AAGGAGCAAGGGGAGCCCCTAGG - Intergenic
1065170599 10:23023126-23023148 AAGGACCCAGAGGCTTCCCTAGG - Intronic
1069566357 10:69465982-69466004 CAGGGGCCACAGGCTCCCCTAGG + Intronic
1069697385 10:70396759-70396781 AAGAGGTAAGAGGCTCCCCTGGG - Intergenic
1070683187 10:78463292-78463314 GAGGATGGAGAGGATCCCCTAGG + Intergenic
1070720967 10:78756865-78756887 GAGGAGGCTGAGGCTCCCCGAGG - Intergenic
1070925938 10:80221609-80221631 GAGGAGCAACAGGCTTCCTCTGG + Intergenic
1072230492 10:93410266-93410288 GAAGAGCAAGATGATCACCTTGG - Intronic
1072526751 10:96278328-96278350 GAGGAGGGAGAGGATCCTCTTGG - Intergenic
1073511583 10:104045947-104045969 TCAGAGCAAGAGGCTCCCCGGGG - Intronic
1074510874 10:114110722-114110744 CAGGAGAAAGAGGCTTCCCCAGG - Intergenic
1075022732 10:118963523-118963545 GATGAGCAAGAGGCTGACCTGGG - Intergenic
1075202495 10:120416577-120416599 GAAAAGGAAGAGGTTCCCCTGGG - Intergenic
1075871470 10:125774742-125774764 GGGGAGGAAGACGCTCCCCCCGG + Intronic
1076275535 10:129195618-129195640 GAGGAGAAAGAGGCCACCCATGG - Intergenic
1076739988 10:132478253-132478275 GAGGAGCAGGAGGTATCCCTGGG - Intergenic
1076895155 10:133307850-133307872 CACGAGCAAGAGGCTCCTCTAGG - Intronic
1077483320 11:2826692-2826714 GAGAGGCACGGGGCTCCCCTGGG + Intronic
1077556283 11:3227688-3227710 CTGGAGCATGAGGCTCCCCTGGG - Exonic
1081129186 11:39355947-39355969 GACAAGCCAGAGGCTCACCTAGG - Intergenic
1081692149 11:45085995-45086017 CAGGAGCCAGCGCCTCCCCTTGG + Intergenic
1088496355 11:110435120-110435142 GAGGAGGAAGAGGCTGCAATGGG - Intronic
1088990329 11:114948137-114948159 GAAGGGCAAGAGGCCCCCATTGG + Intergenic
1090665908 11:128914810-128914832 GAGGAGCAGGAGGATCCCAAAGG + Intronic
1090669540 11:128936818-128936840 GAGGAACAAAAGGCTCCTCAAGG + Intronic
1091293333 11:134454742-134454764 GAGGAGTAAAAGGATGCCCTCGG - Intergenic
1092941965 12:13418298-13418320 GAGGAGCAAATAGCTCACCTAGG - Intergenic
1094131338 12:27078918-27078940 GAGGAGCAAGAGGGTCCCCTTGG + Intergenic
1102030393 12:109736924-109736946 GATGGGCAAGAGGCTGTCCTAGG - Intronic
1102436219 12:112926007-112926029 GATGAGCAAGAGACTCCTCAGGG + Intronic
1103578194 12:121894431-121894453 GTGGAGGAAGAGGCTGGCCTTGG + Intronic
1104522838 12:129491231-129491253 GTGCAGGAAGAGCCTCCCCTGGG - Intronic
1104939800 12:132389793-132389815 GAGGAGCAAGAACCTTCCCTGGG - Intergenic
1112537420 13:100273810-100273832 GAGAATCAAGTGGCTGCCCTTGG + Intronic
1113450206 13:110403985-110404007 AAGGGACAACAGGCTCCCCTGGG + Intronic
1113461059 13:110482513-110482535 AAGGAGATAGAGGCTCACCTGGG + Exonic
1118363766 14:65077008-65077030 CAGGAGCATGAGGCTCCACAAGG + Intronic
1119326805 14:73764727-73764749 GCGGAGGAGGAGGGTCCCCTGGG - Intronic
1119618553 14:76114423-76114445 GAAGAGCAAGTGGCTCCATTTGG - Intergenic
1119731461 14:76953781-76953803 CCGGTGGAAGAGGCTCCCCTTGG - Intergenic
1124354670 15:28985926-28985948 GCGGAGCAGGTGGCTGCCCTGGG + Intronic
1125501973 15:40245587-40245609 GAGGAGGAAAAGGCTGCCCCAGG + Intronic
1126686502 15:51252903-51252925 GAGGAGAAAGTGACTACCCTAGG + Intronic
1129261763 15:74372481-74372503 GAGCAGGGAGAGGCTGCCCTGGG - Intergenic
1129392772 15:75228855-75228877 GAGGAGCAGGGGCCTCTCCTGGG + Intergenic
1130097529 15:80867146-80867168 AAGCAGCAACAGCCTCCCCTGGG + Intronic
1130136597 15:81186864-81186886 CAGGAGTTCGAGGCTCCCCTGGG - Intronic
1130439844 15:83942674-83942696 GAGGGGCAGGGGTCTCCCCTGGG - Exonic
1130577210 15:85103413-85103435 GATGGGCAAGTGGCTCACCTGGG - Intronic
1130909963 15:88264165-88264187 GAGGAGGATGAGGCTCTGCTAGG - Intergenic
1131085775 15:89574822-89574844 GAGCTGCACGATGCTCCCCTTGG + Intergenic
1131538154 15:93254433-93254455 AAGCAGCAATAGCCTCCCCTGGG - Intergenic
1132353781 15:101156718-101156740 GAGCAACCTGAGGCTCCCCTGGG + Intergenic
1134475318 16:14568504-14568526 GTGGAGCAGGAGGATCCCTTGGG + Intronic
1134750971 16:16624734-16624756 GAGGAGCCAGAGGCAACCCATGG + Intergenic
1134994483 16:18728857-18728879 GAGGAGCCAGAGGCAACCCATGG - Intergenic
1135404705 16:22189988-22190010 CAGGAGCAAGACGCTGCACTCGG + Intronic
1135988645 16:27203529-27203551 GAGGAGCCAGAGGCTAGCATAGG - Intronic
1136288941 16:29260147-29260169 GAGCAGACAGAGGCTCCCCCAGG - Intergenic
1137029068 16:35505873-35505895 GAGGACCAAGCGGCACTCCTGGG + Intergenic
1137061984 16:35799129-35799151 GAGGGGCAAGAGGCACACGTGGG + Intergenic
1137365534 16:47856211-47856233 GAGGAGCAATGAGCTCCCCTGGG - Intergenic
1140813844 16:78603276-78603298 GAGGAGCCAGAAGGTCCCTTTGG + Intronic
1141626870 16:85266098-85266120 AAGGAGCCCGAGGCTCCCCAGGG + Intergenic
1142091437 16:88213635-88213657 GAGGAGGAGGAGGCACCCTTTGG - Intergenic
1142094668 16:88233054-88233076 GAGCAGACAGAGGCTCCCCCGGG - Intergenic
1142150135 16:88509037-88509059 GAGGGGCGAGCGGCTCCCCAGGG - Intronic
1144452103 17:15389754-15389776 GAGGAGCAAGAGTTACCCCAGGG - Intergenic
1147242486 17:39099567-39099589 GAGGAGGAAAAGATTCCCCTGGG + Intronic
1147256707 17:39186035-39186057 GAGGAGGAAGAGGCTGAGCTTGG - Intronic
1147972775 17:44228580-44228602 GAGAAGCAAGATTCTCCCCCAGG + Intergenic
1148019788 17:44546050-44546072 GGGGATCAAGAGGCTACCATTGG + Intergenic
1150288552 17:63967955-63967977 GTGGAGTCAGAGGCTACCCTAGG + Intronic
1150874686 17:68957102-68957124 GAGGAGTAAGAGGCTCAACATGG + Intergenic
1151155000 17:72117997-72118019 GAGGTGCGAGTGGCTCCCCAGGG - Intergenic
1151170464 17:72241472-72241494 GGGGAGCAAGCGTCTCCCCACGG + Intergenic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1151721496 17:75859054-75859076 GAGCAGCAGGAGGCTCCCCTGGG + Intergenic
1151869253 17:76825474-76825496 CAGGAGAGAGAGGCTGCCCTAGG - Intergenic
1152106269 17:78330992-78331014 GAGGGGCAGGAGGCTCCACTGGG - Intergenic
1153465429 18:5382652-5382674 GAGGAGAAAGAGCCTCTCCTAGG - Intergenic
1153821857 18:8838999-8839021 GAGAACTAAGAGGCTTCCCTGGG + Intergenic
1154030199 18:10746710-10746732 AAGGGGCAAGAGACCCCCCTTGG - Intronic
1155051820 18:22155068-22155090 GAGCAGCAAGAGTATCTCCTGGG + Intergenic
1156464544 18:37340432-37340454 GAGAACCTACAGGCTCCCCTTGG - Intronic
1157576952 18:48749978-48750000 GAAGAGCACGCGGCTGCCCTGGG - Intronic
1158633168 18:59133627-59133649 GTGGAACCAGAGGATCCCCTGGG + Intergenic
1161288258 19:3479676-3479698 GAGGAGGAAGAGGCTCAGATGGG + Intronic
1161740798 19:6019976-6019998 AAGAAGCCAGAGGCTTCCCTTGG + Intronic
1161967509 19:7556606-7556628 GAGGAGCAGGGGGCTCCTCCGGG - Intronic
1162794602 19:13080041-13080063 GAGGAGGCAGAGGGTTCCCTGGG - Intronic
1162964598 19:14150004-14150026 AAGGAGTAAGAGGGCCCCCTAGG + Exonic
1163176009 19:15564399-15564421 GAGGAAATAGGGGCTCCCCTCGG - Intergenic
1163290613 19:16376986-16377008 GGGGAGCAAGAGGGTCCCCCCGG - Intronic
1165854626 19:38871927-38871949 GAGGAGCAAGAGCATCCCAGGGG - Intronic
1168121381 19:54254209-54254231 GAGGGGCCACAGGCTCCCCGGGG - Intronic
1168132923 19:54332360-54332382 GAGGGGCCACAGGCTCCCCGGGG - Intergenic
1168687726 19:58358512-58358534 GAGGAGCAAGAGGCTCCCCTGGG - Exonic
925220399 2:2134909-2134931 GAGGTGCAAGAGTTTCACCTGGG - Intronic
925469001 2:4138788-4138810 GAGGACAAACAGGCTCCCCAGGG - Intergenic
925752098 2:7097812-7097834 GAGGGGCCACAGGCTGCCCTGGG + Intergenic
926232662 2:11016713-11016735 GAGGAGCAAGAGGGACTCCAAGG + Intergenic
926688631 2:15717599-15717621 GAGGGGCAAGTGTCTCCCATGGG + Intronic
926688838 2:15718710-15718732 GAGGAGCATGGGGCTGCCCGGGG - Intronic
929460213 2:42097764-42097786 GAGGAGGGAGAGGCTACACTGGG - Intergenic
929563639 2:42970935-42970957 CAGGAGCAGGTGGGTCCCCTTGG + Intergenic
930334695 2:50030085-50030107 GAGGAGAAAGAGGGTCTCTTTGG + Intronic
931223628 2:60310377-60310399 CAGAAGCAAGAGGCTCCCAAGGG + Intergenic
932441206 2:71736762-71736784 GAGGAGCGAGATGTTCCTCTGGG + Intergenic
933977513 2:87523297-87523319 CAGGTGCAAGGGGCTCCACTGGG + Intergenic
935675745 2:105593938-105593960 CAGGAGCAAGGGGCTGTCCTGGG - Intergenic
936252201 2:110875604-110875626 GAGCAGCAAGGGGCTCCCAGAGG - Intronic
936316311 2:111427509-111427531 CAGGTGCAAGGGGCTCCACTGGG - Intergenic
940190891 2:151038934-151038956 GAGGAGGAGGAGGCTGTCCTAGG + Intronic
946054492 2:216889009-216889031 GAGCAGCAGGAAGCTCCCCTGGG - Intergenic
946411093 2:219515508-219515530 GAGGAGCAGCAGGCGCCCCAGGG - Intronic
948113582 2:235476962-235476984 AAGGAGCAGGAGGCTTGCCTTGG - Intergenic
948425787 2:237885929-237885951 GAGGAGCAGGAAGAGCCCCTGGG + Intronic
948557313 2:238822197-238822219 GCTGAGCAGGAGGCTCCCCAGGG + Intergenic
1171250059 20:23639878-23639900 GAGGAGCAAGAGACACCCGTGGG - Intergenic
1171482024 20:25461227-25461249 GAGGAGCCAGAGGCAAGCCTGGG - Intronic
1172178108 20:32984802-32984824 GCTGAGCAAGAGGTTCCCATTGG - Intronic
1174109694 20:48190046-48190068 GAAGAACAAGAGGCTTTCCTTGG + Intergenic
1175861472 20:62152362-62152384 GAGGAGCCAGAGGCTGGCATCGG - Intronic
1175930801 20:62492927-62492949 CAGGAGCCAGATGCTCCACTGGG - Intergenic
1176058521 20:63161473-63161495 GAGGAGGCAGAGGCCCTCCTGGG - Intergenic
1176150226 20:63586982-63587004 GGGGAGGAAGGGGCCCCCCTGGG + Intergenic
1180064120 21:45404551-45404573 GGGGAGGAAGAGGCTCTGCTGGG + Intergenic
1181469192 22:23127513-23127535 GAGGAGGAGGAGGCTGCTCTGGG + Intronic
1181780220 22:25187023-25187045 GAGGAAGAAGAGGGCCCCCTGGG - Intronic
1182624789 22:31638018-31638040 GCTGAGCAAGTGCCTCCCCTCGG + Intronic
1182919974 22:34070257-34070279 GAGGAGCATGAGGCTCATCCTGG + Intergenic
1183335725 22:37244835-37244857 CAGGACCCAGAGGCTCCCCCAGG + Intergenic
1183545020 22:38450810-38450832 GAGGAGCCAGAGGATCCCTGAGG + Intronic
1183828566 22:40406277-40406299 GGGGAGCAAGAGACCTCCCTGGG + Intronic
1185151553 22:49166901-49166923 GAGCAGGAAGGGGCTCCCCTCGG - Intergenic
949283102 3:2369459-2369481 GAAGAGCAAGAGGCTCTCCAAGG + Intronic
951443429 3:22748696-22748718 TAGGAGCAGGAAGATCCCCTAGG + Intergenic
953837639 3:46361130-46361152 GCTGAGCAAGAGGCTCCGCTTGG - Intergenic
953872733 3:46641513-46641535 CAGCAGCAGGAGGCTGCCCTAGG + Intergenic
953906286 3:46869925-46869947 GAGGAGGAACCGGCTCCCCTGGG + Intronic
954146727 3:48638099-48638121 GGGGAGCAGGAGGCTGCCTTGGG + Exonic
954210446 3:49094067-49094089 GAGGAGCAATCGGCTCCTATTGG - Exonic
955682149 3:61513591-61513613 GAGGGGCAAGAGGCCTCCCAAGG - Intergenic
956802943 3:72779377-72779399 GAGGAGAAGGAGGATCCCCTGGG - Intronic
960030778 3:113052823-113052845 AAGGAGCAAGAAGCTCACCCAGG + Intergenic
961069014 3:123903813-123903835 GAGGATCAGGAGGCTACCATGGG - Intronic
961484619 3:127208295-127208317 GGGGGGCAAGTGGCTTCCCTGGG - Intergenic
964507255 3:157412790-157412812 GAGGAGAAAGAGCCTCACCCAGG + Intronic
964682827 3:159361399-159361421 GAAGAGCAAGAAGGTCACCTTGG + Intronic
966173445 3:177109780-177109802 GAGGTGAAAGAGGAACCCCTGGG + Intronic
967306853 3:188067658-188067680 GTGGGGCAAGAGACACCCCTCGG - Intergenic
968086098 3:195874610-195874632 GAGGCACAAGAAGCTCCCCTCGG + Intronic
968086108 3:195874654-195874676 GAGGCACAAGAAGCTCCCCTCGG + Intronic
968086128 3:195874743-195874765 GAGGCACAGGAAGCTCCCCTCGG + Intronic
968086139 3:195874787-195874809 GAGGCACAGGAAGCTCCCCTCGG + Intronic
968086149 3:195874831-195874853 GAGGCACAAGAAGCTCCCCTCGG + Intronic
968086170 3:195874920-195874942 GAGGCACAAGAAGCTCCCCTCGG + Intronic
968086180 3:195874964-195874986 GAGGCACAAGAAGCTCCCCTCGG + Intronic
968086213 3:195875098-195875120 GAGGCACAAGAAGCTCCCCTCGG + Intronic
968086223 3:195875142-195875164 GAGGCACAAGAAGCTCCCCTCGG + Intronic
968086245 3:195875231-195875253 GAGGCACAGGAAGCTCCCCTCGG + Intronic
968086255 3:195875275-195875297 GAGGCACACGAAGCTCCCCTCGG + Intronic
968469420 4:772342-772364 GAGGAAGGAGATGCTCCCCTGGG + Intergenic
969413148 4:7042763-7042785 GAGGAGCAAGCGGCTTCGCAGGG - Exonic
969602634 4:8185965-8185987 GAGGTGCCACAGGGTCCCCTTGG + Intronic
969711435 4:8846541-8846563 CAGGTGTAACAGGCTCCCCTGGG + Intronic
979064033 4:116103581-116103603 GAGGAGAAAGATACTGCCCTGGG + Intergenic
985270719 4:188192252-188192274 GGGGAGCAAGAGGAGCCCCTGGG + Intergenic
991254497 5:64599423-64599445 GTGGAGCTGGAGGCTCCTCTTGG + Intronic
991449881 5:66740702-66740724 CAGGTGGAAGAGGCTCCACTGGG - Intronic
993472343 5:88321344-88321366 GAGGAGAAAGAAAATCCCCTGGG + Intergenic
995526651 5:113055497-113055519 CAGGAGGAAGAGGCTACCCTAGG + Intronic
996022434 5:118605976-118605998 GAGGAACAAGAGGCTGCACTTGG - Intergenic
996532487 5:124541180-124541202 GAGGAGCAAGGGGCTGCTCAGGG - Intergenic
997267401 5:132502877-132502899 GAGGGCCAAGGGGCTTCCCTTGG - Intergenic
997354090 5:133251313-133251335 GATGACCACGAGGCTCCCCTGGG + Intronic
997581405 5:135019612-135019634 GCAAAGCAAGAGGCTTCCCTGGG + Intergenic
998332366 5:141340367-141340389 GAGAAGACAGAGGCTCCTCTGGG - Exonic
999247882 5:150165076-150165098 GAAGAGCAAGAGTCTCACCAGGG + Intergenic
1002618960 5:180473133-180473155 GAGCAGGAAGAAGCTCCCCTTGG - Intergenic
1002690020 5:181044157-181044179 GAGGTGGTAGAGGCTCCCCAGGG - Intronic
1004443097 6:15672245-15672267 TGGGAGCAAGAGGCTTCCCAGGG + Intergenic
1005581378 6:27238441-27238463 GTGGAGCACGAGGATCCTCTAGG + Intergenic
1006796858 6:36737531-36737553 CAGGAGCAAGAGGCAGGCCTGGG - Intergenic
1013586180 6:111581104-111581126 CAGGAGCAGGAGGGTCCCCAGGG + Intronic
1017317197 6:153045274-153045296 GAGGTGTTAGATGCTCCCCTAGG + Intronic
1017579883 6:155852674-155852696 GATGGCCAATAGGCTCCCCTTGG - Intergenic
1017649906 6:156571212-156571234 GAGGCGCACAGGGCTCCCCTGGG - Intergenic
1017809516 6:157974805-157974827 GAGGAGGAAGAGGAACCCCGGGG - Intergenic
1017957002 6:159187051-159187073 GAGGAGCCAGCGGCACTCCTGGG - Intronic
1018459438 6:163983815-163983837 GAGCTACAAGAGGCTCTCCTCGG + Intergenic
1018613256 6:165662781-165662803 GGGGAGCAAGAGGCTCCTCGAGG + Intronic
1018826807 6:167414233-167414255 CGGGAGCAACAGGCTCCCCCAGG + Intergenic
1019275532 7:173625-173647 GAGGAGCAGGAGGTTCTCCAGGG + Intergenic
1020900696 7:13999675-13999697 TAGGAACAAGAGTCTTCCCTTGG + Intergenic
1024359725 7:48455432-48455454 GAGGAGCAAGAGCTTCTCCAAGG - Intronic
1024589313 7:50867540-50867562 GGGCAGCAACAGGCGCCCCTTGG - Intergenic
1028466390 7:91157267-91157289 GAAGAGCAAGAGGCTCACTGTGG + Intronic
1029339243 7:99929543-99929565 GGGAAGCAAGAGGCGCCCCACGG + Exonic
1029706649 7:102279950-102279972 GAGGAAACTGAGGCTCCCCTGGG + Intronic
1030114077 7:106050084-106050106 GGGGAGCATGTGGCTCTCCTTGG + Intergenic
1032310485 7:130781677-130781699 GAAGAACCAGGGGCTCCCCTGGG + Intergenic
1035624756 8:1062467-1062489 GAGTGGCAGGAGGCTCTCCTCGG + Intergenic
1035635267 8:1139475-1139497 GTGGAGCAAGGGGCCTCCCTCGG + Intergenic
1035758001 8:2048611-2048633 GAGGAGCTAGAAGCTACCCCAGG + Intronic
1040636103 8:49274814-49274836 GAGGAAACAGAGTCTCCCCTGGG + Intergenic
1042128281 8:65560551-65560573 GAAGAGGAAGAGGGTCCCCAGGG + Intergenic
1044536966 8:93368587-93368609 GAGGTGCAAGATACTCCACTGGG - Intergenic
1044650563 8:94490042-94490064 AAGGAACAAGAGGCTCCAGTTGG - Exonic
1045287997 8:100808422-100808444 GAAGAGCAAAGTGCTCCCCTGGG - Intergenic
1047198694 8:122745229-122745251 AGGGAGCATGAGGCTCCCATTGG + Intergenic
1047619555 8:126592222-126592244 CAGTAGCAAGAAGCTCCCATGGG - Intergenic
1060901617 9:127262834-127262856 GAGGAGAACAAAGCTCCCCTTGG + Intronic
1061068990 9:128297044-128297066 GAGACTCAAGAGGCTCCACTGGG - Intergenic
1061839299 9:133348321-133348343 GAGGAGCAGGAGGCCCTCCGAGG - Intronic
1185462344 X:339248-339270 GAGCAGCAGGAGGCGCCCCATGG + Intronic
1185612852 X:1402639-1402661 GAGGAGAAAGAGGCTGCATTTGG - Intergenic
1187082683 X:16007625-16007647 CAGGAGCAAGAGGAGCCTCTAGG - Intergenic
1189747092 X:44180359-44180381 GAGGAGCCAGGGGCTTTCCTTGG - Intronic
1191255508 X:58277927-58277949 AAGCAGCAAGAAACTCCCCTGGG - Intergenic
1194986892 X:100500411-100500433 GAGGAGAATGAGGTTCCACTGGG + Intergenic
1196529636 X:116770544-116770566 GAGGAGCAAGAGGATGCCCAGGG + Intergenic
1196581167 X:117380664-117380686 GAGGAGAAAGAGGGTATCCTAGG - Intergenic
1198530502 X:137546853-137546875 GGGGACCCAGAGGCTCCCCCCGG - Intergenic
1200079997 X:153571581-153571603 GAGGAGCAAGAGGCTGCCCCAGG - Intronic
1200092532 X:153642616-153642638 GTGGAGCAAGCGGCGCCCCGGGG + Intronic