ID: 1168689628

View in Genome Browser
Species Human (GRCh38)
Location 19:58368844-58368866
Sequence GACCTCACACAGTTGAGTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168689623_1168689628 6 Left 1168689623 19:58368815-58368837 CCTGGTTGGCACGGCCAACAGTC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1168689628 19:58368844-58368866 GACCTCACACAGTTGAGTCCGGG 0: 1
1: 0
2: 1
3: 5
4: 105
1168689625_1168689628 -8 Left 1168689625 19:58368829-58368851 CCAACAGTCCGTGTGGACCTCAC 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1168689628 19:58368844-58368866 GACCTCACACAGTTGAGTCCGGG 0: 1
1: 0
2: 1
3: 5
4: 105
1168689621_1168689628 12 Left 1168689621 19:58368809-58368831 CCAGTCCCTGGTTGGCACGGCCA 0: 1
1: 0
2: 0
3: 8
4: 110
Right 1168689628 19:58368844-58368866 GACCTCACACAGTTGAGTCCGGG 0: 1
1: 0
2: 1
3: 5
4: 105
1168689622_1168689628 7 Left 1168689622 19:58368814-58368836 CCCTGGTTGGCACGGCCAACAGT 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1168689628 19:58368844-58368866 GACCTCACACAGTTGAGTCCGGG 0: 1
1: 0
2: 1
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168689628 Original CRISPR GACCTCACACAGTTGAGTCC GGG Exonic
901791763 1:11657367-11657389 GAGGTCACACAGCTGAGTACTGG + Intronic
902988166 1:20168363-20168385 GACCCCACACTGCTTAGTCCAGG + Intronic
907494915 1:54837250-54837272 GACAACACAGAGTGGAGTCCAGG - Intronic
909213151 1:72850007-72850029 GATCACATACAGTAGAGTCCTGG + Intergenic
911622589 1:100082191-100082213 GTCGTCACACATTTGTGTCCTGG - Exonic
912092897 1:106103583-106103605 AAGCTCACACAACTGAGTCCAGG - Intergenic
921269423 1:213453844-213453866 GACCTGCCACAGTTCAGACCTGG - Intergenic
922976249 1:229785807-229785829 GAGCAGACTCAGTTGAGTCCTGG + Intergenic
923079055 1:230636460-230636482 TACCTCCCAGAGTGGAGTCCTGG + Intergenic
1065548846 10:26850064-26850086 GTCCTCACACAGTTGTGTAGTGG - Intronic
1066517482 10:36179167-36179189 CAGCTCAAACAGTTAAGTCCTGG - Intergenic
1067139636 10:43646371-43646393 GACCACACACAAATGAGTCTAGG + Intronic
1067544604 10:47183960-47183982 GGCCTCACACAGAGGAGTCAGGG + Intergenic
1069729409 10:70601197-70601219 CACCACCCACAGTTGTGTCCTGG - Intronic
1069959776 10:72072868-72072890 GACCACACAGAGTGGGGTCCTGG + Intronic
1070325848 10:75388422-75388444 GACCTCACCCAGTGGTGTGCTGG - Intergenic
1071264837 10:83955903-83955925 GCCCTCACACAGAGGTGTCCAGG - Intergenic
1073817306 10:107222193-107222215 GAACTCAAACAGCTGATTCCAGG - Intergenic
1080313489 11:30922077-30922099 GACTTCAGACAGTAGAGCCCAGG + Intronic
1087196284 11:95307405-95307427 TGCCTCAGACACTTGAGTCCAGG - Intergenic
1090017679 11:123100753-123100775 GACCTGAGACAGTTTAGCCCAGG - Intronic
1093371714 12:18374340-18374362 GACTTGACACAGTGGAGTCAGGG - Intronic
1107909160 13:45089021-45089043 GAGCTCAGAGAGTTGAGTCTTGG + Intergenic
1113401630 13:109999721-109999743 GACCTCACAGAGCTGAGGCTGGG + Intergenic
1120955627 14:90079508-90079530 GACTGCACACAGGTGAGACCTGG - Intronic
1121742249 14:96262365-96262387 GACCTCAGACAGGCGACTCCGGG + Intronic
1122428442 14:101624890-101624912 GACCTCACACTGCAGAGGCCGGG + Intergenic
1123797353 15:23784994-23785016 GACCTCAAACAGTTAAATTCTGG - Intergenic
1123797650 15:23788930-23788952 GACCTCAAACAGTTAAATTCTGG + Intergenic
1132425336 15:101711061-101711083 CATCTCACATAGTTGAGTGCCGG - Intronic
1132652114 16:1025994-1026016 GACACCCCACAGATGAGTCCCGG + Intergenic
1140406041 16:74712239-74712261 GTCCTCAGACAGGTGAGTCCAGG + Intergenic
1146300488 17:31685460-31685482 GCCTGGACACAGTTGAGTCCAGG + Intergenic
1147486438 17:40819156-40819178 GACCTCACCCCGTTTAGTTCCGG - Exonic
1148227421 17:45908639-45908661 GAGCTCACACAGCTGAGGCTGGG + Intronic
1148240376 17:45996351-45996373 GACCCCACCCACTCGAGTCCTGG + Intronic
1148461560 17:47841581-47841603 AACCTCAGATACTTGAGTCCTGG + Intergenic
1149454851 17:56779584-56779606 GACCACACACAGTTGATTCCAGG + Intergenic
1156360640 18:36381576-36381598 GACCTCACAGAGCTCAGACCAGG - Intronic
1157161952 18:45321658-45321680 GAGCTGACACAGCAGAGTCCGGG + Intronic
1160338113 18:78060742-78060764 AACCTCACCAGGTTGAGTCCTGG + Intergenic
1162786299 19:13037018-13037040 GACCTCACCCTGTTCAGCCCAGG - Intronic
1165996086 19:39845217-39845239 GTTCTCACACAGATGAGTGCGGG + Intronic
1168585047 19:57584979-57585001 GACCTCACAAAGGTGAGTGGAGG + Exonic
1168689628 19:58368844-58368866 GACCTCACACAGTTGAGTCCGGG + Exonic
1168713944 19:58516543-58516565 GACCTCCCCCAGCTGAGTACTGG + Exonic
926690886 2:15732598-15732620 GACATCACACAGATGGCTCCTGG - Intronic
932646704 2:73510620-73510642 CACCTCACACAGGAGAGCCCTGG - Intronic
938259466 2:129884763-129884785 GACCTTACTCAGGTGTGTCCAGG + Intergenic
944031697 2:195241960-195241982 GCCCACAGACAGTAGAGTCCAGG + Intergenic
944775891 2:202964077-202964099 AACCTCACACAGCTCAGGCCTGG + Intronic
948618995 2:239221556-239221578 GAGGTGACACAGTTGAGTCCAGG - Intronic
1175569149 20:60006025-60006047 GATCTCACCCAGTTGAGAGCAGG - Intronic
1176409638 21:6441496-6441518 CAACACACACACTTGAGTCCAGG - Intergenic
1177975499 21:27844795-27844817 GAGCACATAAAGTTGAGTCCAGG - Intergenic
1178716276 21:34967424-34967446 GACGTGGCACAGTTGAGTCTCGG - Intronic
1179685131 21:43049818-43049840 CAACACACACACTTGAGTCCAGG - Intergenic
1182075543 22:27493071-27493093 TAATTCACACGGTTGAGTCCAGG + Intergenic
1184297441 22:43533841-43533863 GACATTTCACAGATGAGTCCTGG + Intronic
1184572911 22:45337894-45337916 GTCTTCAGACAGTGGAGTCCGGG - Intronic
950399572 3:12759846-12759868 GACCTCACACAGCCGAGGGCAGG + Intronic
950647005 3:14383243-14383265 GACCACACACAGGTGAGTGGAGG - Intergenic
953048602 3:39318551-39318573 GAGCTCACACAGCTGTGTCTAGG + Intergenic
954895485 3:53971634-53971656 AACCTCCCATTGTTGAGTCCAGG - Intergenic
955274258 3:57532755-57532777 GACCTAGCACAGTTGAGTGGTGG - Intronic
958098649 3:88980407-88980429 GTCCTCAAACATTTGAATCCAGG - Intergenic
958759530 3:98291350-98291372 GACCTCCTACAGTTGCGTTCAGG - Intergenic
962479796 3:135788434-135788456 GACCTAACACAGTGAAGTGCAGG - Intergenic
963701437 3:148630978-148631000 GACCTCAAGTAGTTAAGTCCTGG - Intergenic
966402758 3:179563486-179563508 GTCCCGACACAGCTGAGTCCAGG - Intronic
966735249 3:183182095-183182117 ACCCTGAAACAGTTGAGTCCAGG - Intronic
971385566 4:26138099-26138121 GGCCTCACACAGTGGTCTCCTGG - Intergenic
971480282 4:27108829-27108851 GAGCTCACATAGTGGAGCCCAGG + Intergenic
974102649 4:57434979-57435001 GACCTAAGAAAGTTGAGGCCAGG + Intergenic
979360821 4:119762904-119762926 GCCCTCAAACTGTTGAGGCCAGG + Intergenic
982405151 4:155011175-155011197 GACCTAACATAGATGGGTCCAGG + Intergenic
983962323 4:173769806-173769828 GACCCCACACAAGTGAGTCCTGG - Intergenic
989841666 5:46081644-46081666 CATCTCACAGAGTTAAGTCCTGG + Intergenic
991151289 5:63373706-63373728 GAGGTCACACAGTTGAAGCCAGG - Intergenic
992656663 5:78917116-78917138 GACCTGACAGGGTTGACTCCTGG - Intronic
994015113 5:94956000-94956022 CACCTCACACAGGAGAGTTCTGG + Intronic
997065927 5:130558571-130558593 GACAGCATACAGTTGAGTCTTGG - Intergenic
1000563721 5:162822472-162822494 GATGTCACTCAGTTGTGTCCCGG - Intergenic
1000745822 5:165032032-165032054 GACCTCACAGGCTTGTGTCCTGG + Intergenic
1006734367 6:36262142-36262164 GACCTCACACAGTTGGTCCTAGG + Intronic
1008535001 6:52500878-52500900 GGCCTCTCTCAGGTGAGTCCAGG - Exonic
1012301306 6:97591930-97591952 GATCTCAGACCGTTAAGTCCTGG + Intergenic
1019776719 7:2915862-2915884 CAATTCACAGAGTTGAGTCCTGG + Intronic
1022114817 7:27252213-27252235 GACCCCGTGCAGTTGAGTCCAGG + Intergenic
1026293412 7:69029180-69029202 GACCTCACTCATTTGAGGCTAGG + Intergenic
1032027414 7:128454818-128454840 GATCTCAGAAAGTAGAGTCCCGG - Intergenic
1033010098 7:137612365-137612387 GAGCTCACATAGATGCGTCCAGG - Intronic
1034856545 7:154553925-154553947 GTGCTGACACAGCTGAGTCCTGG + Intronic
1035017634 7:155780669-155780691 GCCCTCACCCAGTTGAAGCCAGG - Exonic
1035157567 7:156926409-156926431 GACCTAACACAAGTGAGTTCAGG - Intergenic
1035756015 8:2033679-2033701 GACCTCGCACAGCAGGGTCCTGG - Intergenic
1038280934 8:26164049-26164071 TCCCTCACACAGTTGAGCTCAGG + Intergenic
1041347686 8:56918187-56918209 GATCCCACACAGCTGAGTCTTGG + Intergenic
1043247526 8:78023936-78023958 GATCTCCCACAATAGAGTCCTGG - Intergenic
1045696991 8:104820553-104820575 GACCTTAAAAATTTGAGTCCAGG + Intronic
1050576084 9:6997049-6997071 GGCATCACACAGTAGAGTGCTGG - Intronic
1055155375 9:73056760-73056782 GATCTCACACAGTGGTGTCCTGG + Intronic
1056333519 9:85542068-85542090 GACCTCACACAGGCCAGTCAGGG - Intergenic
1057417491 9:94877783-94877805 GACATCACGCACTTGAGACCTGG - Intronic
1057891900 9:98875885-98875907 GACCACAAACACCTGAGTCCTGG - Intergenic
1059953257 9:119489803-119489825 GACCTGACACAGTTGAATAAAGG + Intergenic
1060267687 9:122121872-122121894 GATCTGACTCAGTTGGGTCCTGG - Intergenic
1186127018 X:6425562-6425584 GACCTGGCACAGTTGAATTCAGG - Intergenic
1186679985 X:11862531-11862553 GACCTCCTACAGTTGTGTCAGGG + Intergenic
1189090135 X:38073363-38073385 AACCTCCCACAGATGAGTTCAGG + Intronic
1193161284 X:78232468-78232490 TACCTCACACAGGAGAGTTCTGG - Intergenic
1196995427 X:121377606-121377628 GATCTCAGACAGCTGAGTCCAGG - Intergenic