ID: 1168691702

View in Genome Browser
Species Human (GRCh38)
Location 19:58381259-58381281
Sequence AGTCACCCGCTTTCACGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168691702_1168691706 27 Left 1168691702 19:58381259-58381281 CCTTCTCGTGAAAGCGGGTGACT No data
Right 1168691706 19:58381309-58381331 CTCCCAATCTGATTTCTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168691702 Original CRISPR AGTCACCCGCTTTCACGAGA AGG (reversed) Intergenic
No off target data available for this crispr