ID: 1168692882

View in Genome Browser
Species Human (GRCh38)
Location 19:58387346-58387368
Sequence TAGGATCCCCGGCCCCGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168692882_1168692894 20 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692894 19:58387389-58387411 GGGGATAGTGCCCCGCGGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 78
1168692882_1168692891 0 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692891 19:58387369-58387391 GGGACGGTTCATGGTCTTTCGGG 0: 1
1: 0
2: 0
3: 9
4: 129
1168692882_1168692892 1 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692892 19:58387370-58387392 GGACGGTTCATGGTCTTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 27
1168692882_1168692890 -1 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692890 19:58387368-58387390 AGGGACGGTTCATGGTCTTTCGG 0: 1
1: 0
2: 0
3: 6
4: 76
1168692882_1168692895 21 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692895 19:58387390-58387412 GGGATAGTGCCCCGCGGCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1168692882_1168692893 15 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692893 19:58387384-58387406 CTTTCGGGGATAGTGCCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 18
1168692882_1168692888 -9 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692888 19:58387360-58387382 GGGATCCTAGGGACGGTTCATGG 0: 1
1: 0
2: 1
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168692882 Original CRISPR TAGGATCCCCGGCCCCGCGG CGG (reversed) Exonic
902801094 1:18830764-18830786 TAGCACCCCAGACCCCGCGGTGG + Intergenic
904128723 1:28260187-28260209 AAGGATCCGCGGCCCTGGGGTGG - Intronic
904253090 1:29238289-29238311 TAGGATCCCAGGCCTCAGGGTGG - Intronic
920418173 1:205812663-205812685 TAGTATCCCCAACCCCGAGGAGG + Intronic
920674607 1:208030403-208030425 GAGCATCCCCGGCCCAGCGCTGG - Intronic
1065712548 10:28532467-28532489 CAGCAGCCCCTGCCCCGCGGAGG + Intergenic
1067682754 10:48450884-48450906 CCGGCTCCCCGGCCCCGTGGGGG + Exonic
1086322497 11:85664935-85664957 AAGGATCCCAGGCCCCAGGGCGG + Exonic
1100423418 12:94459839-94459861 GAGGATCCCGGTCCACGCGGAGG - Exonic
1104602343 12:130162304-130162326 CGGGCTCCCGGGCCCCGCGGGGG - Intergenic
1104912295 12:132245108-132245130 CAGGCTCCCCTGCCCCGCGGAGG + Intronic
1106246578 13:27954686-27954708 AAGGAGCCCGGGCCCCGCGGCGG + Intergenic
1107604026 13:42040806-42040828 CAGGAGCCCCGGCGCAGCGGCGG + Intronic
1122399145 14:101457400-101457422 TGGGACCCCCCGCCCCACGGCGG - Intergenic
1124453844 15:29822493-29822515 GAGCATGCCCGGCCCGGCGGGGG + Exonic
1129348214 15:74937915-74937937 CCGGACCCCCGGCCCCGCCGTGG - Exonic
1129462958 15:75709123-75709145 TAGGAACCCTTGCCCCACGGAGG + Intronic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1132934924 16:2475304-2475326 GGGGATCCCCGGCCACGCGCGGG + Intronic
1136993286 16:35170253-35170275 CGGGGTCCCGGGCCCCGCGGCGG - Intergenic
1139467094 16:67159845-67159867 TGGGAACCCAGGCCCCGCCGAGG - Exonic
1143483364 17:7239312-7239334 CGGGATCCCCGGCTCCGGGGAGG - Exonic
1151314168 17:73311688-73311710 TAGGGTCCCAGGCACCGCGGTGG + Intronic
1152132235 17:78484569-78484591 GAGGATCCCCCCCTCCGCGGGGG + Intronic
1152663001 17:81551684-81551706 CAGGATCCCGCGCCCCGCCGTGG + Intronic
1152663174 17:81552354-81552376 GAGAAGCCCCGGCCGCGCGGCGG + Exonic
1160994386 19:1875975-1875997 TCGCAGCCCCGACCCCGCGGCGG + Intergenic
1163690380 19:18735406-18735428 CAGGATCCCCCGCTCCCCGGGGG - Intronic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
1168721777 19:58558407-58558429 CGGGGTCCCGGGCCCCGCGGCGG - Exonic
928511776 2:32010097-32010119 TCGGCGGCCCGGCCCCGCGGCGG - Intronic
940847924 2:158661330-158661352 TAGGAACCTCAGCTCCGCGGGGG + Exonic
946188011 2:217992116-217992138 TAGGCCCCCCTGCCCCGCAGTGG - Intronic
1173741840 20:45407028-45407050 TGGGCTCCGCGGCCCCCCGGGGG + Intronic
1175108344 20:56629681-56629703 TAGGAGCCCTGGCCTCTCGGTGG + Intronic
1175913592 20:62415730-62415752 GAGGATCCCTGGTCCTGCGGGGG + Intronic
1176083393 20:63285067-63285089 GAGGAGCCCAGGCCCCGAGGAGG - Intronic
1178429533 21:32506841-32506863 TCGCATCCCCGGCCCCACTGTGG + Intronic
957046706 3:75381222-75381244 TCGCATCCCCGGCCCCACTGTGG - Intergenic
961878771 3:130045290-130045312 TCGCATCCCCGGCCCCACTGTGG - Intergenic
968199559 3:196740264-196740286 GCGGCTCCCCGGCCCCGCGCGGG - Intronic
968990999 4:3912338-3912360 TCGCATCCCCGGCCCCACTGTGG - Intergenic
969032594 4:4226727-4226749 CGGAATCCCCGGCCCCCCGGCGG - Exonic
969824345 4:9745197-9745219 TCGCATCCCCGGCCCCACTGTGG + Intergenic
978503500 4:109433669-109433691 CAGGATCCCCGCGCCCGCGGCGG + Intergenic
979547273 4:121951969-121951991 GAGGCTCTCCAGCCCCGCGGCGG + Intergenic
987340540 5:16935865-16935887 TGGTTTCCCCGGACCCGCGGCGG - Exonic
1007631430 6:43275424-43275446 TTGGGTCCCTGGCCCCGGGGCGG + Intronic
1018900520 6:168049708-168049730 AAGGAGCCCAGGCCCCGAGGAGG + Intergenic
1022120447 7:27303073-27303095 CAGGATCCCTGGCTCCCCGGTGG + Intergenic
1022427692 7:30284645-30284667 GAGGTTCCCCGGCCCCGCGCCGG - Exonic
1033146127 7:138871276-138871298 CAGGATCTCCCGCCCCCCGGAGG - Exonic
1034324659 7:150219974-150219996 TAGGATCTCCAGCCCCAGGGTGG + Intergenic
1034434764 7:151058155-151058177 TGGGAACCACGGCGCCGCGGCGG - Exonic
1034768533 7:153749257-153749279 TAGGATCTCCAGCCCCAGGGTGG - Intergenic
1034802884 7:154063663-154063685 TAGGACCCCCATCCCAGCGGGGG + Intronic
1035018648 7:155787680-155787702 GAGGCTCTCCTGCCCCGCGGAGG + Intergenic
1035022037 7:155805816-155805838 TAGGATCCACGGGCGCCCGGCGG + Intronic
1035732412 8:1862280-1862302 CAGGATCCCCAGGCCTGCGGTGG + Intronic
1036613262 8:10368037-10368059 TAGAATTCCCTGCCCCGCGAAGG + Intronic
1059271270 9:113071646-113071668 CAGGAACCCGGGCCCCCCGGTGG - Intergenic
1062146442 9:134992271-134992293 AAGGACCCCCCTCCCCGCGGAGG + Intergenic
1190745763 X:53321083-53321105 TCGGATCCCGGGCCGCCCGGGGG + Exonic
1200162906 X:154018464-154018486 TAGGGTCCCTGGCCCCTTGGTGG - Intronic