ID: 1168692882

View in Genome Browser
Species Human (GRCh38)
Location 19:58387346-58387368
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168692882_1168692890 -1 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692890 19:58387368-58387390 AGGGACGGTTCATGGTCTTTCGG 0: 1
1: 0
2: 0
3: 6
4: 76
1168692882_1168692891 0 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692891 19:58387369-58387391 GGGACGGTTCATGGTCTTTCGGG 0: 1
1: 0
2: 0
3: 9
4: 129
1168692882_1168692894 20 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692894 19:58387389-58387411 GGGGATAGTGCCCCGCGGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 78
1168692882_1168692888 -9 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692888 19:58387360-58387382 GGGATCCTAGGGACGGTTCATGG 0: 1
1: 0
2: 1
3: 6
4: 61
1168692882_1168692895 21 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692895 19:58387390-58387412 GGGATAGTGCCCCGCGGCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1168692882_1168692892 1 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692892 19:58387370-58387392 GGACGGTTCATGGTCTTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 27
1168692882_1168692893 15 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692893 19:58387384-58387406 CTTTCGGGGATAGTGCCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168692882 Original CRISPR TAGGATCCCCGGCCCCGCGG CGG (reversed) Exonic