ID: 1168692887

View in Genome Browser
Species Human (GRCh38)
Location 19:58387357-58387379
Sequence TGAACCGTCCCTAGGATCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168692887_1168692895 10 Left 1168692887 19:58387357-58387379 CCGGGGATCCTAGGGACGGTTCA 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1168692895 19:58387390-58387412 GGGATAGTGCCCCGCGGCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1168692887_1168692894 9 Left 1168692887 19:58387357-58387379 CCGGGGATCCTAGGGACGGTTCA 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1168692894 19:58387389-58387411 GGGGATAGTGCCCCGCGGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 78
1168692887_1168692893 4 Left 1168692887 19:58387357-58387379 CCGGGGATCCTAGGGACGGTTCA 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1168692893 19:58387384-58387406 CTTTCGGGGATAGTGCCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 18
1168692887_1168692892 -10 Left 1168692887 19:58387357-58387379 CCGGGGATCCTAGGGACGGTTCA 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1168692892 19:58387370-58387392 GGACGGTTCATGGTCTTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 27
1168692887_1168692899 25 Left 1168692887 19:58387357-58387379 CCGGGGATCCTAGGGACGGTTCA 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1168692899 19:58387405-58387427 GGCCTGGGCCTTTTCTCATTAGG 0: 1
1: 0
2: 1
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168692887 Original CRISPR TGAACCGTCCCTAGGATCCC CGG (reversed) Exonic