ID: 1168692888

View in Genome Browser
Species Human (GRCh38)
Location 19:58387360-58387382
Sequence GGGATCCTAGGGACGGTTCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168692882_1168692888 -9 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692888 19:58387360-58387382 GGGATCCTAGGGACGGTTCATGG 0: 1
1: 0
2: 1
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168692888 Original CRISPR GGGATCCTAGGGACGGTTCA TGG Exonic
906626917 1:47333155-47333177 GGGATCACAGGCACGGGTCACGG + Intergenic
910803882 1:91171480-91171502 GGGAGCCTGGGGATGGATCAGGG - Intergenic
917334948 1:173916918-173916940 GGGATCCAGGGGACGCTCCAAGG - Intronic
918406918 1:184220539-184220561 GGGATCCTTGGGATGGGACAAGG - Intergenic
920702437 1:208228056-208228078 GGGATTTTAGGGTCAGTTCATGG - Intronic
922726072 1:227923671-227923693 GGGATCCCAGGGAAGGGTTAGGG - Intronic
1070939676 10:80333312-80333334 GGGAAACTAGGGATGGTTAATGG + Intergenic
1077094581 11:793902-793924 GGTATCCTAGGGAGGCCTCAGGG - Intronic
1079860667 11:25667106-25667128 GGGAACCTAGTGAAGGTTTATGG - Intergenic
1095832835 12:46605449-46605471 GGGAACCAAGGAACTGTTCATGG + Intergenic
1097114499 12:56687775-56687797 GGAAGCCAAGGAACGGTTCAGGG + Intronic
1098106752 12:67075681-67075703 GGGATATTAGGGACAGTTCAAGG - Intergenic
1102576971 12:113861816-113861838 GGGATCGTAGGCAGGGATCAGGG + Intronic
1106830128 13:33572127-33572149 GGGAGACTAGGGACAGTTGATGG - Intergenic
1127627989 15:60799071-60799093 GGGATCCTGGGGTAGGTTAAAGG - Intronic
1128559449 15:68655042-68655064 GGGATTCTAGGGAGGGTCCAGGG + Intronic
1133732722 16:8590312-8590334 GGGATCGTGGGGAGGGTTCGTGG - Intergenic
1137402564 16:48165240-48165262 GGGTTCCCAGGGACACTTCAGGG + Intergenic
1139532277 16:67548226-67548248 GGGCTGCTAGGGGCGGTTCTGGG - Intergenic
1143141241 17:4742943-4742965 GGGAGGCTAGGGAGAGTTCAAGG + Intronic
1144643607 17:16953466-16953488 GGGACCCCAGGGAGGCTTCAGGG - Intronic
1146176406 17:30668503-30668525 TGGAGCCTAGGGACAGTTGAGGG - Intergenic
1146349866 17:32084617-32084639 TGGAGCCTAGGGACAGTTGAGGG - Intergenic
1151684446 17:75638592-75638614 GGGGTGCTAGTGACGGTGCACGG + Exonic
1152631858 17:81414097-81414119 GGGCTCCTTGGCACGGGTCAGGG - Intronic
1157123593 18:44934910-44934932 GGAATCCTAGAGAAAGTTCAGGG + Intronic
1163782709 19:19258653-19258675 GGGCTCCCGGGGCCGGTTCACGG + Exonic
1165172700 19:33905486-33905508 GGGACCCGAGGGAGTGTTCATGG - Intergenic
1168692888 19:58387360-58387382 GGGATCCTAGGGACGGTTCATGG + Exonic
928391811 2:30916403-30916425 GGGATAGGAGGGACGGTTCCCGG - Intronic
931459978 2:62442139-62442161 GGGATCCTAGAGCAGATTCAAGG + Intergenic
932792105 2:74662680-74662702 GGGGTCATAGGGAAGGTTCATGG - Intronic
938635347 2:133219460-133219482 GGGGTCCAAGGGACAGTTCAGGG + Intronic
946090745 2:217220731-217220753 GGGATCACAGGGAGGGTTTATGG - Intergenic
946326732 2:218988529-218988551 TGGATCCTAGGGTTGGGTCAGGG - Intergenic
1171025759 20:21629131-21629153 GGGCTCCTAAGGACGTGTCAGGG + Intergenic
1173479867 20:43390232-43390254 GGGAGCCTAGGCTGGGTTCATGG + Intergenic
1176256096 20:64154043-64154065 GGGGTCCTGGGGAAGGTTCTGGG + Intronic
1177006355 21:15677048-15677070 GGGATCCTGGGCATGGCTCAAGG - Intergenic
1179178799 21:39028032-39028054 GGGAACCTAGGGAGGGTTCATGG + Intergenic
1183617674 22:38955171-38955193 AGGATCCTGGGGAAGGTCCAAGG - Intronic
1184764333 22:46563830-46563852 GGGACCCAAGGGACGGATCAAGG - Intergenic
1184986570 22:48140116-48140138 TGGATCCTGGGGAGGTTTCAGGG - Intergenic
957648463 3:82967436-82967458 GTGATCCTAGAGAGAGTTCAGGG - Intergenic
967851401 3:194085333-194085355 GGGATCCTAGGGACAGTTTCAGG - Intergenic
968589450 4:1450167-1450189 GGGCTCCTGTGGAGGGTTCAGGG + Intergenic
968645828 4:1740070-1740092 GGGGTCCTAGGCAGGGTGCAGGG - Intronic
969617845 4:8264144-8264166 GGGACCCTGGGGAAGGTGCATGG + Intergenic
972910106 4:43804618-43804640 GGGATATTAGGGATGGTTAATGG + Intergenic
983093670 4:163537388-163537410 GGGATCCTATGTACAATTCAAGG + Intronic
983532550 4:168826320-168826342 GAGATCTTAGGGACGGTGAATGG + Intronic
992484505 5:77181498-77181520 AGGAGCCTGTGGACGGTTCAAGG - Intergenic
1000800712 5:165722837-165722859 GGCATCCTAGGGATTGTTCCCGG + Intergenic
1001451026 5:171824458-171824480 AGCATCCTAGTGAGGGTTCAGGG + Intergenic
1018441302 6:163815955-163815977 GAGAGCCTGGGGAAGGTTCATGG - Intergenic
1031081983 7:117267171-117267193 GGGATTTTAGGCACTGTTCAAGG + Intergenic
1035263508 7:157676040-157676062 GCGCTCCAAGGGACGGTCCATGG - Intronic
1037372716 8:18197152-18197174 TGGATCCTGGGGGTGGTTCATGG - Intronic
1039369988 8:36974395-36974417 GGGATCCTATGGACAGGTAAAGG + Intergenic
1044737587 8:95294984-95295006 GGGATCCTTGGGATAGTTAAAGG + Intergenic
1047265983 8:123309695-123309717 GGAATTCTAGGGTCTGTTCAAGG - Intergenic
1048881786 8:138877645-138877667 GGGATCCTACGGCCGGCTCCAGG - Intronic
1049051229 8:140198367-140198389 GTGATCTTAGGAGCGGTTCAGGG - Intronic
1052862966 9:33447870-33447892 GGGATTATAGGCAGGGTTCAGGG + Intergenic
1057986837 9:99725587-99725609 GGCATCCCAGGGGCCGTTCACGG - Intergenic
1059248637 9:112868426-112868448 GAGATTCTAGGGACTCTTCAGGG + Intronic
1061371891 9:130201995-130202017 GGGAATCTAGGGAGGTTTCATGG - Intronic
1061812089 9:133168048-133168070 GGGATCCCAGGGCTGGTTCCTGG + Intergenic
1191661862 X:63659644-63659666 CAGATCCTAGGGAAGGTACATGG + Intronic