ID: 1168692890

View in Genome Browser
Species Human (GRCh38)
Location 19:58387368-58387390
Sequence AGGGACGGTTCATGGTCTTT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168692884_1168692890 -4 Left 1168692884 19:58387349-58387371 CCGCGGGGCCGGGGATCCTAGGG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1168692890 19:58387368-58387390 AGGGACGGTTCATGGTCTTTCGG 0: 1
1: 0
2: 0
3: 6
4: 76
1168692882_1168692890 -1 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692890 19:58387368-58387390 AGGGACGGTTCATGGTCTTTCGG 0: 1
1: 0
2: 0
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168692890 Original CRISPR AGGGACGGTTCATGGTCTTT CGG Exonic
900432737 1:2610725-2610747 AGGGACGGTTCTTGGTCGGGGGG - Intronic
902779021 1:18692783-18692805 AGGGGATGTTCAGGGTCTTTGGG - Intronic
902903075 1:19533663-19533685 AGGGAGGGTTCCTGGACTCTTGG + Intergenic
907444772 1:54500373-54500395 AGGGACAGTACGTGGTATTTGGG + Intergenic
912467486 1:109883910-109883932 AGGGGAGGTTCATGGTCCTCAGG + Intergenic
914867215 1:151441429-151441451 GGGCACAGTTCAGGGTCTTTTGG - Intronic
918271364 1:182904299-182904321 AGGGACGGTTGATGGTATCGTGG - Exonic
920809081 1:209265205-209265227 AGGGACAGTTCCTGGTCAGTGGG + Intergenic
922546324 1:226459943-226459965 AGGGAGGGTTTTTGGTCTTCTGG + Intergenic
923097495 1:230787258-230787280 AGGCACGGGTCAAGGTCCTTTGG + Intronic
924378875 1:243442474-243442496 TGGGACGCTTCCTTGTCTTTGGG - Intronic
924668490 1:246098403-246098425 AGGCACCATTCATGGACTTTAGG + Intronic
1074708553 10:116158014-116158036 AAGGAAGGTTCCTGGTCTCTGGG + Intronic
1080880712 11:36317477-36317499 AAGGAAGGTTCAAGGTCTTTTGG + Intronic
1081468124 11:43344065-43344087 AGGTTCAGCTCATGGTCTTTTGG - Intronic
1081771240 11:45651665-45651687 AGGGTCTGTTCCTGGTCTCTAGG + Intronic
1082718670 11:56646546-56646568 AAGGATGGTTCATGGTGGTTAGG - Intergenic
1088016167 11:105062849-105062871 AGTGAGGGTTCATAGTCTTACGG + Intronic
1088921919 11:114265698-114265720 AGGCCAGGTTCATGGACTTTTGG + Intronic
1093210662 12:16304343-16304365 GGGCACGGATCATGGTCCTTGGG + Intergenic
1093600830 12:21020189-21020211 AGGGACTGCTCATTGTCTCTCGG - Intronic
1097063244 12:56301234-56301256 AGGGTCGTGTCATGGTCTCTGGG - Intronic
1098098526 12:66987260-66987282 AGGCACTGTTCTTGGTGTTTGGG - Intergenic
1100098904 12:91078102-91078124 TGGAACAGTTCATAGTCTTTTGG + Intergenic
1103509619 12:121465928-121465950 AGGGACGATTCAAGTGCTTTTGG - Intronic
1106430855 13:29679089-29679111 AGGGATGGGTCATTGTCATTTGG + Intergenic
1114660603 14:24341208-24341230 AGGGTCAGTTCATGCTATTTTGG + Intergenic
1128277074 15:66362774-66362796 TGAGATAGTTCATGGTCTTTTGG - Intronic
1128688226 15:69703046-69703068 CTGGACAGATCATGGTCTTTAGG - Intergenic
1131247794 15:90810548-90810570 AGGGAGGTTTCATGCTTTTTGGG + Intronic
1135777363 16:25268598-25268620 ATAGAGGTTTCATGGTCTTTGGG - Intergenic
1136997973 16:35203711-35203733 ATGGCCTGTTCTTGGTCTTTGGG - Intergenic
1138346917 16:56325813-56325835 AGGGAAGTGTCATGGTATTTAGG - Intronic
1141498981 16:84430688-84430710 AGGGAGGGACCAGGGTCTTTTGG + Intronic
1148123595 17:45225725-45225747 AGGGACGTTTCCTGAGCTTTGGG + Intronic
1148335426 17:46837716-46837738 AGGGATGGCTCATGGTCAGTGGG + Intronic
1150369854 17:64627854-64627876 AAGGACAGTTCATGATCTTTTGG + Intronic
1151168065 17:72221725-72221747 AGGTAGGGCTGATGGTCTTTAGG + Intergenic
1151506556 17:74531611-74531633 GGGGACTGTGCAGGGTCTTTAGG + Intergenic
1157139467 18:45091089-45091111 AAGGAAGGTTCATGGGCTTGGGG - Intergenic
1157166571 18:45363144-45363166 AGGGACTATTCAAGGTATTTTGG - Intronic
1165948070 19:39457321-39457343 AAAGATGGTTCATGGTCTGTTGG - Intronic
1168162667 19:54522040-54522062 CTGGACCATTCATGGTCTTTTGG + Intergenic
1168692890 19:58387368-58387390 AGGGACGGTTCATGGTCTTTCGG + Exonic
926996541 2:18741843-18741865 AGAGAAGCTTCATGGTCATTTGG - Intergenic
935423242 2:102892781-102892803 AGGGAGGGCTCTTGGTCTCTTGG + Intergenic
936970956 2:118175672-118175694 AGGGAGGGCTCATGGTTTCTGGG + Intergenic
947291579 2:228581964-228581986 AGGGACTGAACATGGTCCTTTGG - Intergenic
1169410302 20:5363536-5363558 AGGGAAGCTTCATGGTATTGTGG - Intergenic
1169444919 20:5663533-5663555 ATGAGCGGCTCATGGTCTTTAGG + Intergenic
1172693487 20:36806093-36806115 AGGGATGCTTCCTGGTCTTTGGG - Intronic
1172779973 20:37430759-37430781 ATGGGCGGTTCCTGGTCTCTGGG + Intergenic
1173527946 20:43747173-43747195 AGTGACATTTCATGGTGTTTTGG + Intergenic
1173588183 20:44200893-44200915 AGGTACAGTTCATTGTCTTCTGG - Intronic
949189095 3:1230077-1230099 AGGTACAGTTCATGCACTTTAGG - Intronic
949198446 3:1341983-1342005 AAGGATGATTCAGGGTCTTTAGG - Intronic
952621555 3:35349397-35349419 AGGGATATTTTATGGTCTTTTGG + Intergenic
959908386 3:111735232-111735254 AGGGACTGTTGATGGTTTCTCGG - Intronic
961677944 3:128579034-128579056 AGCCACGGTTCATGGTTTTGGGG - Intergenic
964683667 3:159370277-159370299 AGGGAGTGTGCATGGTCTGTTGG - Intronic
969587429 4:8102495-8102517 AGGCACTGTTCAGGGTATTTGGG - Intronic
980484551 4:133438883-133438905 AGGGACTTTTCATGGCTTTTTGG + Intergenic
986829233 5:11557938-11557960 AAGAACGGTTCATTTTCTTTAGG + Intronic
987607565 5:20157087-20157109 AGGGATGATTCATGGCCTTTGGG + Intronic
996731791 5:126724247-126724269 TGGGACGGGGCATGGACTTTGGG - Intergenic
1006147244 6:31966998-31967020 AGGGCCTGTTCATGGGCCTTGGG - Exonic
1018204064 6:161420457-161420479 AGGCATGGCTCATGGGCTTTTGG + Intronic
1020242915 7:6409486-6409508 AGGAACTGTTCACGGTCTTCTGG + Exonic
1020893250 7:13906091-13906113 AGGGAGGTTTTATGGTCCTTAGG - Intronic
1025113590 7:56239365-56239387 AGGGACTGTTCGTGGTATCTTGG - Intergenic
1027730102 7:81860585-81860607 AGGGACGGTTTATGCACTGTTGG + Intergenic
1036695624 8:10972976-10972998 ATGAACTGTTCATGGTGTTTGGG + Intronic
1037557036 8:20034805-20034827 AGAGAGGCTTCATCGTCTTTGGG - Intergenic
1041096735 8:54357692-54357714 AGGCACAGTCCATGGACTTTAGG + Intergenic
1050460046 9:5869840-5869862 AGGGAAGGCTCATGGCCTTTTGG + Intergenic
1057298689 9:93864043-93864065 AGGAACGGTGCATTGTCTTTGGG - Intergenic
1188364801 X:29302599-29302621 AGGATCAGTTCATGGTCTTGGGG + Intronic
1190228021 X:48560676-48560698 AGGGACTTTCCAGGGTCTTTCGG - Exonic
1190685635 X:52870306-52870328 AGGGAGGATTCAGGGTCTGTTGG + Intergenic
1195129935 X:101841598-101841620 GGGGACTGGTCATTGTCTTTGGG - Intronic
1196048608 X:111281870-111281892 AGAGACTGTCCATGCTCTTTTGG - Intergenic
1196477414 X:116104811-116104833 AGGCTCAGCTCATGGTCTTTTGG + Intergenic
1202058558 Y:20861888-20861910 AGGGACCATTCATGGTATTCTGG - Intergenic