ID: 1168692890

View in Genome Browser
Species Human (GRCh38)
Location 19:58387368-58387390
Sequence AGGGACGGTTCATGGTCTTT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168692884_1168692890 -4 Left 1168692884 19:58387349-58387371 CCGCGGGGCCGGGGATCCTAGGG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1168692890 19:58387368-58387390 AGGGACGGTTCATGGTCTTTCGG 0: 1
1: 0
2: 0
3: 6
4: 76
1168692882_1168692890 -1 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692890 19:58387368-58387390 AGGGACGGTTCATGGTCTTTCGG 0: 1
1: 0
2: 0
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168692890 Original CRISPR AGGGACGGTTCATGGTCTTT CGG Exonic