ID: 1168692891

View in Genome Browser
Species Human (GRCh38)
Location 19:58387369-58387391
Sequence GGGACGGTTCATGGTCTTTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168692884_1168692891 -3 Left 1168692884 19:58387349-58387371 CCGCGGGGCCGGGGATCCTAGGG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1168692891 19:58387369-58387391 GGGACGGTTCATGGTCTTTCGGG 0: 1
1: 0
2: 0
3: 9
4: 129
1168692882_1168692891 0 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692891 19:58387369-58387391 GGGACGGTTCATGGTCTTTCGGG 0: 1
1: 0
2: 0
3: 9
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168692891 Original CRISPR GGGACGGTTCATGGTCTTTC GGG Exonic
900474148 1:2868418-2868440 GGGACGGGCCATGGCCTTGCTGG + Intergenic
901234865 1:7662296-7662318 GGGACGCTTCATGTTCTTGGAGG - Intronic
902236279 1:15059548-15059570 GGGAGGCCTCATGGTCTTCCAGG + Intronic
903247096 1:22024218-22024240 GGAAGGGTTCACGGTCATTCTGG + Intergenic
905254701 1:36672763-36672785 GGGACAGTTCATCATATTTCTGG + Intergenic
910396792 1:86801833-86801855 TGGTGGGTTCATGGTCTTGCTGG + Intergenic
910550458 1:88468193-88468215 TGGTGGGTTCATGGTCTTGCTGG - Intergenic
911969093 1:104407757-104407779 CGGAGGGTTCATGGTCTTGCTGG + Intergenic
912156551 1:106928106-106928128 GGGACTGTTCAGGGTGCTTCAGG + Intergenic
914928220 1:151907217-151907239 TGGTGGGTTCATGGTCTTGCTGG - Intronic
915665941 1:157445583-157445605 TGGTGGGTTCATGGTCTTGCTGG + Intergenic
915685629 1:157629979-157630001 GTGAAGATTCATGGTCCTTCTGG - Intergenic
917094955 1:171390712-171390734 TGGCGGGTTCATGGTCTTACTGG + Intergenic
918542556 1:185648332-185648354 TGGTGGGTTCATGGTCTTACTGG + Intergenic
920648698 1:207821401-207821423 GGGTGGGTTTATGATCTTTCTGG - Intergenic
922973395 1:229761913-229761935 GGGACCGTTCATCCTCTTTCAGG - Intergenic
923783176 1:237043022-237043044 GGGAGGTTTCTTGGGCTTTCGGG + Intronic
924246924 1:242094242-242094264 GGGAAGGTGCATGGGCCTTCAGG + Intronic
1063465925 10:6244394-6244416 TGGAGGGACCATGGTCTTTCTGG + Intergenic
1064694304 10:17950239-17950261 TGGTGGGTTCATGGTCTTGCTGG + Intergenic
1075185338 10:120251336-120251358 TGGTGGGTTCATGGTCTTGCTGG + Intergenic
1077603377 11:3589671-3589693 CGGTGGGTTCATGGTCTTGCTGG - Intergenic
1080223642 11:29935080-29935102 TGGTGGGTTCATGGTCTTGCTGG - Intergenic
1084067174 11:66711354-66711376 GGGATGGATCATGGACTTTTAGG + Intronic
1084525115 11:69692473-69692495 GGGACTGCTCATTTTCTTTCTGG - Intergenic
1089540003 11:119184056-119184078 GGCACTGTTCTTGGTCTTTCTGG + Intergenic
1092590172 12:9946039-9946061 GGAACGGTCCATGGCCTTTCAGG + Intergenic
1095898906 12:47307245-47307267 CGGTGGGTTCATGGTCTTGCTGG - Intergenic
1096621017 12:52865585-52865607 GGGGCAGTTCATGATCTTCCTGG + Intergenic
1102623877 12:114218969-114218991 GGGACAGTTCCTGGGCTTGCTGG + Intergenic
1105883602 13:24624317-24624339 CGGTGGGTTCATGGTCTTGCTGG - Intergenic
1106224990 13:27778507-27778529 GGGAGGCTTGATGGTCCTTCAGG - Intergenic
1108721319 13:53135787-53135809 TGGACACTTCATGGTCTTTTAGG - Intergenic
1111858710 13:93673522-93673544 GGGTCTGTTCATGTTCCTTCTGG + Intronic
1112373831 13:98820389-98820411 GGGCCTGTTCATGGTGTTACAGG + Intronic
1114679716 14:24474230-24474252 TGGTGGGTTCATGGTCTTGCTGG - Intergenic
1120939552 14:89934168-89934190 GGGAAGTTACATGATCTTTCTGG + Intronic
1127159362 15:56165221-56165243 GGTATGGTTCATGGCCTGTCAGG - Intronic
1131601149 15:93850324-93850346 GGCACTGTTCATGCTCCTTCTGG - Intergenic
1132097861 15:99001081-99001103 TGGTGGGTTCATGGTCTTGCTGG - Intronic
1137331764 16:47504922-47504944 GGCACAGTTCATCATCTTTCAGG - Intronic
1139051617 16:63130597-63130619 TGGCAGGTTCATGGTCTTGCTGG - Intergenic
1145064959 17:19755916-19755938 GGGACTTTCCAGGGTCTTTCTGG - Intergenic
1146740311 17:35278324-35278346 TGGTGGGTTCATGGTCTCTCTGG + Intergenic
1147832926 17:43309812-43309834 GGGAAAGTTCAGGGTCTTCCAGG - Intergenic
1151506557 17:74531612-74531634 GGGACTGTGCAGGGTCTTTAGGG + Intergenic
1151982999 17:77525354-77525376 TGGTGGGTTCATGGTCTCTCTGG + Intergenic
1154231000 18:12556574-12556596 TGGTGGGTTCATGGTCTTGCTGG + Intronic
1157858236 18:51120274-51120296 TGGTGGGTTCATGGTCTTGCTGG + Intergenic
1162090936 19:8279650-8279672 TGGTGGGTTCGTGGTCTTTCCGG + Intronic
1162093169 19:8294488-8294510 TGGTGGGTTCGTGGTCTTTCCGG + Intronic
1166486835 19:43221081-43221103 TGGTCGGTTCGTGGTCTTGCTGG + Intronic
1167175627 19:47862010-47862032 GTGACTATTCATGGTCTTTTTGG + Intergenic
1167570982 19:50288939-50288961 GGGAGGGTCCCTGATCTTTCAGG - Intronic
1168692891 19:58387369-58387391 GGGACGGTTCATGGTCTTTCGGG + Exonic
930966534 2:57335509-57335531 GGGTGGGTTCATGGTCTCGCTGG - Intergenic
935550254 2:104445458-104445480 GGGACTGTTAATGCTCTTTCAGG - Intergenic
937273225 2:120668475-120668497 TGGACATTTCATGGTCTCTCTGG + Intergenic
938806521 2:134811243-134811265 TGGTGGGTTCATGGTCTTGCTGG + Intergenic
943211450 2:184972821-184972843 TGGTGGGTTCATGGTCTTGCTGG + Intergenic
943947727 2:194089757-194089779 TGGTGGGTTCATGGTCTTGCAGG + Intergenic
945869308 2:215208922-215208944 TGGTGGGTTCATGGTCTTGCTGG - Intergenic
945870367 2:215220145-215220167 TGGTGGGTTCATGGTCTTGCTGG - Intergenic
947103951 2:226649135-226649157 TGGTGGGTTCATGGTCTTGCTGG - Intergenic
1169630054 20:7621382-7621404 TGGTGGGTTCATGGTCTTGCTGG + Intergenic
1172693486 20:36806092-36806114 GGGATGCTTCCTGGTCTTTGGGG - Intronic
1173236630 20:41252181-41252203 AGGACATTTCCTGGTCTTTCAGG - Intronic
1175794711 20:61764506-61764528 GGGTGGTCTCATGGTCTTTCTGG - Intronic
1175993223 20:62799849-62799871 TGGACCGATCCTGGTCTTTCAGG - Exonic
1176344700 21:5732907-5732929 TGGTGGGTTCGTGGTCTTTCTGG + Intergenic
1176351514 21:5853491-5853513 TGGTGGGTTCGTGGTCTTTCTGG + Intergenic
1176500127 21:7591548-7591570 TGGTGGGTTCGTGGTCTTTCTGG - Intergenic
1176539021 21:8130977-8130999 TGGTGGGTTCGTGGTCTTTCTGG + Intergenic
1176557972 21:8314022-8314044 TGGTGGGTTCGTGGTCTTTCTGG + Intergenic
1178259708 21:31087860-31087882 CGGTGGGTTCATGGTCTTGCTGG + Intergenic
1183363159 22:37393441-37393463 GGGACGTGTCATGGTCTGCCAGG - Intronic
1185228943 22:49669234-49669256 TGGTGGGTTCATGGTCTTGCTGG + Intergenic
1203243971 22_KI270733v1_random:47332-47354 TGGTGGGTTCGTGGTCTTTCTGG + Intergenic
950727214 3:14924179-14924201 TGGAAGGTTCATGGTCATCCTGG + Intronic
959141475 3:102491709-102491731 TGGTGGGTTCATGGTCTTGCTGG + Intergenic
959908385 3:111735231-111735253 GGGACTGTTGATGGTTTCTCGGG - Intronic
963398051 3:144757973-144757995 CGGTGGGTTCATGGTCTTGCTGG - Intergenic
965652511 3:170948186-170948208 CGGCGGGTTCATGGTCTTGCTGG - Intergenic
965728727 3:171747005-171747027 GGGTGGGTTCGTGGTCTTGCTGG - Intronic
965918198 3:173877328-173877350 GGGACGGTCCATGAAATTTCTGG + Intronic
969736149 4:8992348-8992370 TGGTGGGTTCATGGTCTTGCTGG + Intergenic
974807390 4:66898334-66898356 TGGTAGGTTCATGGTCTTGCTGG + Intergenic
981170397 4:141616234-141616256 GGGTGGGTTCGTGGTCTTGCTGG - Intergenic
984728832 4:183046513-183046535 TGGTGGGTTCATGGTCTTGCTGG - Intergenic
985322861 4:188734182-188734204 TGGTGGGTTCATGGTCTTGCTGG + Intergenic
987923308 5:24310847-24310869 TGGTGGGTTCATGGTCTTGCTGG - Intergenic
989965988 5:50466214-50466236 TGGTGGGTTCATGGTCTTGCTGG - Intergenic
990323041 5:54648497-54648519 GGGTGGGTTCATGGTCTCGCTGG + Intergenic
995679061 5:114696631-114696653 TGGTGGGTTCATGGTCTTGCTGG - Intergenic
995920611 5:117306183-117306205 TGGTGGGTTCATGGTCTTGCTGG - Intergenic
996478546 5:123948483-123948505 GGGTAGGTTCATGGTCTCACCGG + Intergenic
996724755 5:126664493-126664515 AGGAAGGTTCATTGTCATTCTGG + Intergenic
997158036 5:131579197-131579219 TGGTGGGTTCATGGTCTTGCTGG + Intronic
998800147 5:145861006-145861028 GGGAAGGTTCATAGTCTATAAGG - Intronic
1001307237 5:170584370-170584392 GGGCCTGTTCATGGTGTGTCGGG + Intronic
1003774949 6:9349874-9349896 TGAACTGCTCATGGTCTTTCTGG - Intergenic
1003801128 6:9668629-9668651 CGGTGGGTTCATGGTCTTGCCGG - Intronic
1004906762 6:20243947-20243969 TGGTGGGTTCATGGTCTTGCTGG + Intergenic
1005764337 6:28995964-28995986 GAGACGGTTCCTGGTCTTGAAGG + Exonic
1005976868 6:30806862-30806884 TGGTAGGTTCATGGTCTTGCTGG + Intergenic
1010799134 6:80153510-80153532 AGGACGTTGCATGGTCTTTAAGG - Intronic
1015595630 6:134863867-134863889 TGGAAAGTTCATGGTGTTTCTGG - Intergenic
1016482138 6:144494268-144494290 TGGTGGGTTCATGGTCTTCCTGG + Intronic
1016858633 6:148696439-148696461 TGGTGGGTTCATGGTCTTGCTGG + Intergenic
1017434350 6:154401945-154401967 AGGAATGTTCATGGTCTTCCAGG + Exonic
1017581053 6:155866033-155866055 TGGTGGGTTCATGGTCTTGCTGG + Intergenic
1018043153 6:159942870-159942892 GGAACTGTTCAAGGTCATTCTGG + Intergenic
1020552135 7:9620857-9620879 CGGTGGGTTCATGGTCTCTCTGG + Intergenic
1022853902 7:34296801-34296823 GGCAAGAATCATGGTCTTTCTGG - Intergenic
1025837283 7:65106062-65106084 GAGACAGTTCATGGGCTTTCAGG + Intergenic
1025907063 7:65795588-65795610 GAGACAGTTCATGGGCTTTCAGG + Intergenic
1029110818 7:98212308-98212330 GGGCCGGTTCTTGGTCTTCATGG - Exonic
1031730830 7:125298866-125298888 TGGTGGGTTCATGGTCTTGCTGG + Intergenic
1037417416 8:18666977-18666999 CGGTGGGTTCATGGTCTTGCTGG + Intronic
1038870844 8:31490888-31490910 CGGTGGGTTCATGGTCTTGCTGG - Intergenic
1043845068 8:85153766-85153788 AGGTGGGTTCATGGTCTTGCTGG - Intergenic
1045792263 8:105997201-105997223 CGGTGGGTTCATGGTCTCTCTGG - Intergenic
1048360598 8:133694160-133694182 GGGATGGCTCATGGGGTTTCAGG + Intergenic
1051419545 9:16876103-16876125 TGGTGGGTTCATGGTCTTGCTGG + Intergenic
1052203249 9:25807935-25807957 GTGTGGGTTCGTGGTCTTTCTGG + Intergenic
1052576728 9:30300491-30300513 TGGTGGGTTCATGGTCTTTCTGG - Intergenic
1052988376 9:34504006-34504028 GGGACTTCTCATGGTCTTCCAGG + Intronic
1054018067 9:44548615-44548637 GGGACGTTTCAAGCTCTTTCAGG + Intergenic
1054062367 9:45304717-45304739 GGGACGTTTCAAGCGCTTTCAGG + Intergenic
1054078262 9:60566366-60566388 GGGACGTTTCAAGCGCTTTCAGG - Intergenic
1057907021 9:98991052-98991074 CGGTGGGTTCATGGTCTTGCTGG + Intronic
1062572657 9:137192796-137192818 GGAACGGTTGATGGTGTGTCTGG - Intronic
1203460301 Un_GL000220v1:30418-30440 TGGTGGGTTCGTGGTCTTTCTGG + Intergenic
1203595515 Un_KI270747v1:129950-129972 CGGACGTTTCAAGGGCTTTCAGG + Intergenic
1185671561 X:1813983-1814005 GGCACGGTTCTCGGTGTTTCCGG + Intergenic
1190228020 X:48560675-48560697 GGGACTTTCCAGGGTCTTTCGGG - Exonic
1201145570 Y:11063502-11063524 GTGACGATGCATGGTCTTTGAGG + Intergenic
1201429337 Y:13889183-13889205 TGGTGGGTTCATGGTCTTGCTGG - Intergenic
1202136934 Y:21675989-21676011 TGGTGGGTTCATGGTCTTGCTGG + Intergenic