ID: 1168692892

View in Genome Browser
Species Human (GRCh38)
Location 19:58387370-58387392
Sequence GGACGGTTCATGGTCTTTCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 27}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168692882_1168692892 1 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692892 19:58387370-58387392 GGACGGTTCATGGTCTTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 27
1168692884_1168692892 -2 Left 1168692884 19:58387349-58387371 CCGCGGGGCCGGGGATCCTAGGG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1168692892 19:58387370-58387392 GGACGGTTCATGGTCTTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 27
1168692887_1168692892 -10 Left 1168692887 19:58387357-58387379 CCGGGGATCCTAGGGACGGTTCA 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1168692892 19:58387370-58387392 GGACGGTTCATGGTCTTTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168692892 Original CRISPR GGACGGTTCATGGTCTTTCG GGG Exonic
907205122 1:52763268-52763290 GGGCTATTCATGGTCTTTTGTGG + Intronic
921518575 1:216129725-216129747 GGACTGTTCTAGGTCTTTCGTGG - Intronic
1065456941 10:25916753-25916775 GGACGGTTCACAGTCTCTAGTGG + Intergenic
1081659159 11:44877374-44877396 GGTCTGTCCATGGTCATTCGAGG + Intronic
1092862053 12:12726748-12726770 GGTTGGTTTATGGTCTTTCATGG - Intronic
1119260186 14:73233523-73233545 GGACGCTTCAGGGTTTTTCTAGG + Intergenic
1134261662 16:12655802-12655824 GGAAGGTTCATGGTGTTGGGAGG + Intergenic
1152921110 17:83067066-83067088 GGACGGTGCATGTTCTTACCTGG + Intergenic
1156000002 18:32374081-32374103 GCTGGGTTCATGGTCTTTGGTGG - Intronic
1161965116 19:7543481-7543503 GGCTGGTTCATGGCCTTCCGAGG - Intronic
1168692892 19:58387370-58387392 GGACGGTTCATGGTCTTTCGGGG + Exonic
936329774 2:111537587-111537609 GCACAGTTCAGGGCCTTTCGTGG + Intergenic
1175973614 20:62699371-62699393 GGAAGGTTCAGGGTCTGTGGAGG - Intergenic
1177671026 21:24227641-24227663 TGACTATTCATGGTCTTTTGTGG + Intergenic
950727215 3:14924180-14924202 GGAAGGTTCATGGTCATCCTGGG + Intronic
959145298 3:102537074-102537096 GGTCTGTTCATGGTCTTTCTTGG + Intergenic
965641426 3:170832788-170832810 GGAAGGTTTATGGCCTTTGGTGG - Intronic
966109454 3:176381104-176381126 GGATGGTTTATGGTCCTTTGAGG - Intergenic
967404215 3:189098671-189098693 GGATGGTTTATGATCTTTTGTGG + Intronic
967827467 3:193889445-193889467 GGACGATTCTAGGTCTCTCGTGG + Intergenic
973816964 4:54627843-54627865 TGACTGCTCATGGTCTTTGGAGG - Intergenic
985843171 5:2324826-2324848 ACACGCCTCATGGTCTTTCGGGG - Intergenic
992802205 5:80303786-80303808 GGACGGTTCCTGGTCATAGGTGG + Intergenic
995544407 5:113215551-113215573 AGACGGTTCATGGGCTGGCGGGG + Intronic
1016307963 6:142703119-142703141 AGACTGTTCAGGGTCTTTCTTGG + Intergenic
1017434351 6:154401946-154401968 GGAATGTTCATGGTCTTCCAGGG + Exonic
1019263020 7:92830-92852 GTAAGGTTCTTGGTCTTCCGGGG + Intergenic
1050391501 9:5148431-5148453 GGTCGGCTCATGGACTTTGGGGG + Intronic
1190228019 X:48560674-48560696 GGACTTTCCAGGGTCTTTCGGGG - Exonic
1195893451 X:109720840-109720862 GGACGGTTTAAAGTCTTTAGTGG - Intronic