ID: 1168692893

View in Genome Browser
Species Human (GRCh38)
Location 19:58387384-58387406
Sequence CTTTCGGGGATAGTGCCCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 18}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168692882_1168692893 15 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692893 19:58387384-58387406 CTTTCGGGGATAGTGCCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 18
1168692887_1168692893 4 Left 1168692887 19:58387357-58387379 CCGGGGATCCTAGGGACGGTTCA 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1168692893 19:58387384-58387406 CTTTCGGGGATAGTGCCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 18
1168692889_1168692893 -4 Left 1168692889 19:58387365-58387387 CCTAGGGACGGTTCATGGTCTTT 0: 1
1: 0
2: 1
3: 4
4: 63
Right 1168692893 19:58387384-58387406 CTTTCGGGGATAGTGCCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 18
1168692884_1168692893 12 Left 1168692884 19:58387349-58387371 CCGCGGGGCCGGGGATCCTAGGG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1168692893 19:58387384-58387406 CTTTCGGGGATAGTGCCCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168692893 Original CRISPR CTTTCGGGGATAGTGCCCCG CGG Exonic
1090398437 11:126434046-126434068 CTGTGGGGGCGAGTGCCCCGGGG + Intronic
1092428025 12:8389647-8389669 CTCACAGGGACAGTGCCCCGGGG + Intergenic
1092545537 12:9448453-9448475 CTCTCGGGGACAGTGCCCAGGGG - Intergenic
1094507418 12:31073598-31073620 CTCTCGGGGACAGCGCCCAGGGG + Intergenic
1102774783 12:115508949-115508971 CTTGCGGGGTGAGTGCCCTGAGG + Intergenic
1113908453 13:113830859-113830881 GTTTCAGGGATGGAGCCCCGGGG - Intronic
1168692893 19:58387384-58387406 CTTTCGGGGATAGTGCCCCGCGG + Exonic
938862753 2:135386836-135386858 CTTTCGGGGGTGGGGCCCTGGGG + Intronic
943147654 2:184065775-184065797 CTTCCTGGGACAGAGCCCCGGGG - Intergenic
945318790 2:208397658-208397680 CTTACTGGCATAGTGCCCAGAGG + Intronic
1172689965 20:36783500-36783522 CTATGGGGGATTGAGCCCCGAGG + Exonic
1183664038 22:39237169-39237191 CTTTCGGGGAGAGCCCCCTGAGG - Intronic
1183667325 22:39253436-39253458 CTTACGGGGGTGGTGCCCCAGGG + Intergenic
1184099234 22:42333227-42333249 CTTTAGGGGATGGTGCACCAGGG + Intronic
987035553 5:14014959-14014981 CTATGGGGGGTAGTGCCCGGGGG - Intergenic
998392407 5:141795726-141795748 CTCTAGGGGACAGTGCCCCCAGG - Intergenic
1003755347 6:9113385-9113407 CTTTAGGGGATTGAGCCCAGGGG - Intergenic
1020139766 7:5605936-5605958 GTTTCGGGGACAGTGCACCAGGG - Exonic
1025584938 7:62771922-62771944 CTTTCTGAGAAAGTGCCTCGTGG - Intergenic
1187428043 X:19196497-19196519 CCTTCTGGGCTACTGCCCCGGGG + Intergenic