ID: 1168692894

View in Genome Browser
Species Human (GRCh38)
Location 19:58387389-58387411
Sequence GGGGATAGTGCCCCGCGGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168692882_1168692894 20 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692894 19:58387389-58387411 GGGGATAGTGCCCCGCGGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 78
1168692884_1168692894 17 Left 1168692884 19:58387349-58387371 CCGCGGGGCCGGGGATCCTAGGG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1168692894 19:58387389-58387411 GGGGATAGTGCCCCGCGGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 78
1168692887_1168692894 9 Left 1168692887 19:58387357-58387379 CCGGGGATCCTAGGGACGGTTCA 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1168692894 19:58387389-58387411 GGGGATAGTGCCCCGCGGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 78
1168692889_1168692894 1 Left 1168692889 19:58387365-58387387 CCTAGGGACGGTTCATGGTCTTT 0: 1
1: 0
2: 1
3: 4
4: 63
Right 1168692894 19:58387389-58387411 GGGGATAGTGCCCCGCGGCCTGG 0: 1
1: 0
2: 1
3: 6
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168692894 Original CRISPR GGGGATAGTGCCCCGCGGCC TGG Exonic
900578625 1:3396568-3396590 GGGCACAGTGCCGCCCGGCCTGG + Exonic
903942476 1:26941398-26941420 GGGGACAGTGTCCCACAGCCTGG - Intronic
904441310 1:30533843-30533865 GGGGATAGTGCCCCAGGTCACGG - Intergenic
904470070 1:30730545-30730567 TGGGATTGTGCCCTGTGGCCAGG - Intergenic
920185349 1:204156018-204156040 GGGGACAGTGCCCCGCCCCATGG + Intronic
920375045 1:205503797-205503819 GGGCACAGTGCCCCACCGCCAGG - Intergenic
922720501 1:227897617-227897639 AGGGATAGAGCCCCGTTGCCTGG + Intergenic
1077331035 11:1983904-1983926 GGGGATAGTGTCCTGGGGCCTGG - Intronic
1080622343 11:33997118-33997140 GAGGATGGAGCCCCGCGGACAGG + Intergenic
1202814016 11_KI270721v1_random:39080-39102 GGGGATAGTGTCCTGGGGCCTGG - Intergenic
1092545535 12:9448448-9448470 GGGGACAGTGCCCAGGGGACGGG - Intergenic
1096970801 12:55664775-55664797 TGGGACAGTGCCCTGCGGCGAGG + Intergenic
1101642116 12:106594543-106594565 GGCGAGAATGCCCCGCAGCCTGG - Intronic
1103961448 12:124611513-124611535 GGGGAGATTGCCCGGCAGCCAGG - Intergenic
1109174205 13:59135458-59135480 GGGGATAGTCACCCCCCGCCAGG - Intergenic
1111670489 13:91323369-91323391 AGTGATAGTGCACAGCGGCCAGG - Intergenic
1120234601 14:81876102-81876124 GGAGATAGTGCCCTGCATCCTGG + Intergenic
1122846923 14:104505281-104505303 GGGGAAAGTGCCAGGAGGCCTGG + Intronic
1122907568 14:104808777-104808799 GGGGACAGTCCTCCGTGGCCTGG - Intergenic
1122972876 14:105159433-105159455 GGGGACTGGGCCCCGTGGCCTGG - Intronic
1123465510 15:20511883-20511905 GGAGATACTGCTCCCCGGCCAGG + Intergenic
1123652606 15:22489154-22489176 GGAGATACTGCTCCCCGGCCAGG - Intergenic
1123743030 15:23298013-23298035 GGAGATACTGCTCCCCGGCCAGG - Intergenic
1124276231 15:28327862-28327884 GGAGATACTGCTCCCCGGCCAGG + Intergenic
1124306467 15:28583745-28583767 GGAGATACTGCTCCCCGGCCAGG - Intergenic
1126103536 15:45133965-45133987 GGGGATAGAACCCCAGGGCCAGG + Intronic
1128133528 15:65246290-65246312 GGAGATAGTGCCTCTCAGCCAGG - Intronic
1129467270 15:75731128-75731150 GGGGATGGTGGCCCTGGGCCAGG + Intergenic
1129719956 15:77872589-77872611 GGGGATGGTGGCCCTGGGCCAGG - Intergenic
1130546408 15:84859903-84859925 GGTGAGTGTGCCCCGCGGCCCGG + Exonic
1132934959 16:2475406-2475428 GGGGATCGGGCCTCGCGCCCAGG - Intronic
1136065023 16:27753052-27753074 GGGGATTGTACCTCGCAGCCAGG + Intronic
1136226420 16:28863535-28863557 GGGGATAGAGTCCCAGGGCCCGG - Intronic
1139805940 16:69565781-69565803 CGGGAAAGGGCCCCGCTGCCAGG - Intronic
1139917968 16:70439581-70439603 GGGAACAGTGCCCTCCGGCCGGG - Intergenic
1140720157 16:77764305-77764327 GGGGATAGGGCACTGCAGCCAGG + Intergenic
1141714733 16:85720287-85720309 GGGGAAGGTGCCCAGCCGCCTGG + Intronic
1150230908 17:63549978-63550000 CGGGACAGAGCCCTGCGGCCTGG - Intergenic
1150633887 17:66899153-66899175 GGGGAGAGTGGCCCTCGGGCAGG - Intergenic
1151697932 17:75727565-75727587 GTGTATAGTGCCCCTTGGCCGGG + Intronic
1152468637 17:80478653-80478675 GGGGATAGAGACGCGGGGCCAGG - Intergenic
1153309700 18:3666069-3666091 GGGAAGAGAGCCCCGCGGTCAGG + Intronic
1153941884 18:9985834-9985856 GGGGAAAGAGCCCCGGGGCTGGG + Intergenic
1160510481 18:79450824-79450846 GGGGAGAGTGGCCAGCTGCCTGG + Intronic
1161614291 19:5261315-5261337 GGGGTTAGTGCCCCAGTGCCGGG + Intronic
1162135027 19:8550183-8550205 GGGCATAGAGCCCCTTGGCCAGG + Exonic
1165683016 19:37793437-37793459 TGGGACAGTGCCCTGCGGCGAGG - Intronic
1168692894 19:58387389-58387411 GGGGATAGTGCCCCGCGGCCTGG + Exonic
925266933 2:2572049-2572071 GGGGACAGAGCCCCTCCGCCGGG - Intergenic
927818731 2:26244385-26244407 GGGGATACTGCCCTGGGACCCGG - Intronic
932219487 2:69989098-69989120 GGGGATAGGGCCCAGAGGGCAGG + Intergenic
937436824 2:121887968-121887990 GGGGATTGTGGCCTGCGCCCTGG + Intergenic
937931044 2:127205387-127205409 AGAGATCGTGGCCCGCGGCCAGG - Intronic
938555034 2:132416543-132416565 GCGGATTGTGCTCAGCGGCCCGG - Intergenic
947591515 2:231388677-231388699 GGGCATTGTGCCCCTCGCCCTGG - Intergenic
1173750353 20:45470802-45470824 GGACATTGTTCCCCGCGGCCTGG + Intronic
1175808515 20:61844982-61845004 GGGGACAGTGCCCAGCGACCTGG - Intronic
1175831883 20:61969249-61969271 GTGAATAGTGCCCTGAGGCCAGG + Intronic
1179955097 21:44734185-44734207 GGGGGTAATGCTCCGAGGCCGGG - Intergenic
1182289597 22:29267641-29267663 GGGGATAGGGTCTCGGGGCCAGG + Intronic
1183311356 22:37111654-37111676 TGGGACAGGGCCCCGCGCCCGGG + Intergenic
1184070460 22:42143473-42143495 GGCGATGGTGACCCGCGGCGAGG - Intergenic
1184667747 22:45997576-45997598 GGGAACAGTGGCCCGGGGCCAGG - Intergenic
950081338 3:10224368-10224390 GGGGATAGAACCCCTAGGCCCGG + Intronic
950100454 3:10353427-10353449 GTGGACAGTTCCCTGCGGCCAGG - Intronic
954887757 3:53891643-53891665 GGGCTTAGCGCCCCGCGGCCGGG - Intronic
971344338 4:25798189-25798211 GGGGATTGTACCCTGCAGCCAGG - Intronic
977257761 4:94758611-94758633 GGGGAAAGTGCGCAGCGGGCTGG + Intronic
985660889 5:1155993-1156015 GGGGATGGGGCCGCGCGGCGCGG + Intergenic
1001939519 5:175730585-175730607 GGGGACAGTGCCCAGTGGCCAGG - Intergenic
1002484986 5:179529111-179529133 GGGCATGGTGGCCCGCGCCCAGG - Intergenic
1002718913 5:181246415-181246437 CGGGACAGTGACCCGCGGCGCGG - Intronic
1018461716 6:164004914-164004936 GAGGAAAGTGACCTGCGGCCTGG + Intergenic
1019536245 7:1531113-1531135 GGGGAGAGAGCCTCGCGTCCCGG - Intronic
1025959274 7:66205745-66205767 GGGGAGAGGCCCCGGCGGCCGGG - Intronic
1029123872 7:98284599-98284621 GGGGACAGAGCCCGGCGGGCTGG - Intronic
1031986778 7:128168573-128168595 GGGGAAAGTGGGCCGCGACCCGG - Intergenic
1049161706 8:141102361-141102383 GGGGACAGTGCCCCGGGCGCTGG + Intergenic
1049405787 8:142451313-142451335 GGGTAAGGTGCCCAGCGGCCTGG - Intronic
1049745106 8:144260006-144260028 GAGGCTGGTGCTCCGCGGCCTGG + Exonic
1059102542 9:111484078-111484100 AGGGCCAGTCCCCCGCGGCCCGG + Exonic
1060598328 9:124861583-124861605 GGGGATATGGCCCCGCGGCCTGG - Intronic
1061037003 9:128119458-128119480 GCGCATAGTGCCCTGCCGCCTGG - Intergenic
1190342412 X:49308326-49308348 GGGACTAGAGCCCCACGGCCAGG + Intronic
1193968245 X:88016857-88016879 TGGGATAGTGGCCCGCTGACTGG + Intergenic
1200247112 X:154532145-154532167 GGGGACAGAGCCCAGCGGGCAGG - Intronic