ID: 1168692895

View in Genome Browser
Species Human (GRCh38)
Location 19:58387390-58387412
Sequence GGGATAGTGCCCCGCGGCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168692882_1168692895 21 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692895 19:58387390-58387412 GGGATAGTGCCCCGCGGCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1168692887_1168692895 10 Left 1168692887 19:58387357-58387379 CCGGGGATCCTAGGGACGGTTCA 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1168692895 19:58387390-58387412 GGGATAGTGCCCCGCGGCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1168692889_1168692895 2 Left 1168692889 19:58387365-58387387 CCTAGGGACGGTTCATGGTCTTT 0: 1
1: 0
2: 1
3: 4
4: 63
Right 1168692895 19:58387390-58387412 GGGATAGTGCCCCGCGGCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1168692884_1168692895 18 Left 1168692884 19:58387349-58387371 CCGCGGGGCCGGGGATCCTAGGG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1168692895 19:58387390-58387412 GGGATAGTGCCCCGCGGCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168692895 Original CRISPR GGGATAGTGCCCCGCGGCCT GGG Exonic
900935704 1:5765124-5765146 GGGATGGTTCCCCGCACCCTGGG + Intergenic
905897494 1:41558185-41558207 GGGATGATGCCCCCCGGCCCAGG + Intronic
910414270 1:86981672-86981694 GGGATAGGCTCCCACGGCCTTGG + Intronic
920185350 1:204156019-204156041 GGGACAGTGCCCCGCCCCATGGG + Intronic
920865789 1:209752424-209752446 AGGATAGTCCACAGCGGCCTTGG - Intergenic
1073740257 10:106398652-106398674 GGGATACTGGTCCGTGGCCTGGG - Intergenic
1076847925 10:133078845-133078867 GAGAAACTGCCCCGCGGCGTGGG + Intronic
1076848002 10:133079315-133079337 GAGAAACTGCCCCGCGGCGTGGG + Intronic
1077331034 11:1983903-1983925 GGGATAGTGTCCTGGGGCCTGGG - Intronic
1084611759 11:70207701-70207723 GGGACAGTGTCCTGCGGCCTTGG - Intergenic
1202814015 11_KI270721v1_random:39079-39101 GGGATAGTGTCCTGGGGCCTGGG - Intergenic
1101642115 12:106594542-106594564 GCGAGAATGCCCCGCAGCCTGGG - Intronic
1105899146 13:24741525-24741547 GGGGTAGCGCCTCGTGGCCTTGG + Intergenic
1107112415 13:36712204-36712226 GGGGTGGTGCCCCAAGGCCTTGG - Intergenic
1111670488 13:91323368-91323390 GTGATAGTGCACAGCGGCCAGGG - Intergenic
1120881396 14:89417344-89417366 GGGTCAGTGCCCCGCGCCCCAGG - Intronic
1122907567 14:104808776-104808798 GGGACAGTCCTCCGTGGCCTGGG - Intergenic
1123061745 14:105597673-105597695 GCGTGAGTGGCCCGCGGCCTAGG + Intergenic
1123086483 14:105719404-105719426 GCGTGAGTGGCCCGCGGCCTAGG + Intergenic
1124347961 15:28934900-28934922 GGGATAGAGCCCGGAGACCTGGG + Intronic
1130546409 15:84859904-84859926 GTGAGTGTGCCCCGCGGCCCGGG + Intronic
1131681484 15:94728439-94728461 AGGATATTGCCCCGGGGCCGTGG - Intergenic
1132803300 16:1764470-1764492 GGGAGGGTGCCCGGTGGCCTCGG - Intronic
1137623662 16:49893751-49893773 GGGATTGTGCCCAGGGCCCTTGG - Intergenic
1138534427 16:57652481-57652503 GGGATTCTGCCCCGCAACCTGGG + Intronic
1139805939 16:69565780-69565802 GGGAAAGGGCCCCGCTGCCAGGG - Intronic
1148874024 17:50675911-50675933 GGTACAGAGCCCCACGGCCTTGG - Exonic
1151385656 17:73753749-73753771 GGGATAGTGCCCCCTGGGATTGG - Intergenic
1152408577 17:80110868-80110890 GGGGTAGTCCCCAGAGGCCTTGG - Intergenic
1152710726 17:81869521-81869543 GGGTGAGTGCCCTGCGGCCGCGG - Exonic
1153804971 18:8703928-8703950 AGGATAATGCCCAACGGCCTTGG + Intergenic
1162039806 19:7963887-7963909 GGGATGGGGCCCAGCGGCCATGG - Intronic
1163291448 19:16381828-16381850 GTGCGAGTCCCCCGCGGCCTGGG + Intronic
1167391317 19:49196873-49196895 CGGTGAGTGCCCCGGGGCCTTGG + Exonic
1168692895 19:58387390-58387412 GGGATAGTGCCCCGCGGCCTGGG + Exonic
928903348 2:36344691-36344713 GGGATAGGGCTCTGTGGCCTGGG - Intergenic
929501342 2:42493822-42493844 GGGAGAGGGCACCGCGGCCTCGG - Exonic
932814729 2:74852585-74852607 GGGCTAGTGCCCCACAGCCCTGG + Intronic
933858434 2:86441443-86441465 GGGTAAGAGCGCCGCGGCCTCGG + Exonic
945251044 2:207767069-207767091 GGGGTAGTCCCCTGCGGCCATGG + Exonic
1173750354 20:45470803-45470825 GACATTGTTCCCCGCGGCCTGGG + Intronic
1175808514 20:61844981-61845003 GGGACAGTGCCCAGCGACCTGGG - Intronic
1175814640 20:61877135-61877157 GGGACAGTGCCCAGCCTCCTGGG + Intronic
1181026792 22:20131642-20131664 GGGGCAGGACCCCGCGGCCTCGG - Intronic
1181091513 22:20476206-20476228 GGGAAAGTGCCCCGAGGGCTTGG - Intronic
961664590 3:128487840-128487862 GGTAGAGTGCGCCTCGGCCTCGG + Intronic
966538271 3:181060022-181060044 GCGTTAGTGCCACCCGGCCTTGG + Intergenic
967853217 3:194097631-194097653 GGGGTAGTCCCCCGGGGCCAAGG - Intergenic
968820251 4:2844255-2844277 GGGATAGGACCCCGGGGACTAGG + Intronic
979715749 4:123835261-123835283 GCGCTAGTGCACCTCGGCCTGGG + Intergenic
986335882 5:6754980-6755002 TGCAGACTGCCCCGCGGCCTCGG + Exonic
1001847945 5:174938079-174938101 GGGATTGTCCCCTGTGGCCTGGG - Intergenic
1006725397 6:36196493-36196515 GGGATGGTGCCCCGTGGCGGCGG + Intergenic
1007252426 6:40505061-40505083 GGGACAGTTGCCCGTGGCCTCGG + Intronic
1019417716 7:934979-935001 TGGGTCGTGCCGCGCGGCCTGGG + Intronic
1021845245 7:24757281-24757303 GAGAAAGCGCCGCGCGGCCTCGG + Intronic
1027138147 7:75639071-75639093 GGGGGGGTGCCCCGCAGCCTCGG - Intronic
1035032249 7:155869248-155869270 GGGACAGTGACCCCAGGCCTGGG + Intergenic
1042517280 8:69672883-69672905 GGAAGAGAGCCCCGCTGCCTTGG - Exonic
1049146819 8:141006522-141006544 GGGATACTGCTCCCTGGCCTGGG + Intergenic
1049161707 8:141102362-141102384 GGGACAGTGCCCCGGGCGCTGGG + Intergenic
1049405786 8:142451312-142451334 GGTAAGGTGCCCAGCGGCCTGGG - Intronic
1059102543 9:111484079-111484101 GGGCCAGTCCCCCGCGGCCCGGG + Exonic
1196224462 X:113149194-113149216 GGGATGGTGACCCGTGACCTTGG + Intergenic