ID: 1168692895

View in Genome Browser
Species Human (GRCh38)
Location 19:58387390-58387412
Sequence GGGATAGTGCCCCGCGGCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 57}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168692889_1168692895 2 Left 1168692889 19:58387365-58387387 CCTAGGGACGGTTCATGGTCTTT 0: 1
1: 0
2: 1
3: 4
4: 63
Right 1168692895 19:58387390-58387412 GGGATAGTGCCCCGCGGCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1168692887_1168692895 10 Left 1168692887 19:58387357-58387379 CCGGGGATCCTAGGGACGGTTCA 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1168692895 19:58387390-58387412 GGGATAGTGCCCCGCGGCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1168692882_1168692895 21 Left 1168692882 19:58387346-58387368 CCGCCGCGGGGCCGGGGATCCTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1168692895 19:58387390-58387412 GGGATAGTGCCCCGCGGCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 57
1168692884_1168692895 18 Left 1168692884 19:58387349-58387371 CCGCGGGGCCGGGGATCCTAGGG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1168692895 19:58387390-58387412 GGGATAGTGCCCCGCGGCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168692895 Original CRISPR GGGATAGTGCCCCGCGGCCT GGG Exonic