ID: 1168694490

View in Genome Browser
Species Human (GRCh38)
Location 19:58396842-58396864
Sequence GCCCCCGCCGGGGTCGCCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168694478_1168694490 28 Left 1168694478 19:58396791-58396813 CCAGCTCGTGGCGCTCGCTCCAG 0: 1
1: 0
2: 1
3: 5
4: 189
Right 1168694490 19:58396842-58396864 GCCCCCGCCGGGGTCGCCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 149
1168694477_1168694490 29 Left 1168694477 19:58396790-58396812 CCCAGCTCGTGGCGCTCGCTCCA 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1168694490 19:58396842-58396864 GCCCCCGCCGGGGTCGCCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 149
1168694476_1168694490 30 Left 1168694476 19:58396789-58396811 CCCCAGCTCGTGGCGCTCGCTCC 0: 1
1: 0
2: 1
3: 5
4: 95
Right 1168694490 19:58396842-58396864 GCCCCCGCCGGGGTCGCCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 149
1168694482_1168694490 3 Left 1168694482 19:58396816-58396838 CCTGGCTTCTCTTGGTTTCCGCC 0: 1
1: 0
2: 2
3: 17
4: 174
Right 1168694490 19:58396842-58396864 GCCCCCGCCGGGGTCGCCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 149
1168694481_1168694490 9 Left 1168694481 19:58396810-58396832 CCAGCGCCTGGCTTCTCTTGGTT 0: 1
1: 0
2: 3
3: 22
4: 226
Right 1168694490 19:58396842-58396864 GCCCCCGCCGGGGTCGCCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168694490 Original CRISPR GCCCCCGCCGGGGTCGCCCT GGG Exonic
900147163 1:1163326-1163348 GCCCCCGCCGTGGCCGACGTGGG + Intergenic
900264134 1:1749006-1749028 GCCCCCTTCGGGGTCCCCCCCGG + Intergenic
900476638 1:2879271-2879293 GCCCACGCCTGGGTGCCCCTGGG - Intergenic
900680683 1:3914709-3914731 GCCACAGCCGGGGCTGCCCTGGG - Intergenic
901082887 1:6593388-6593410 GCGGCGGCCGGGGTCGGCCTGGG + Exonic
901409379 1:9071910-9071932 GCCTCAGCCCGGGTCCCCCTCGG + Intronic
901433889 1:9234741-9234763 GCCCCCGCCGCGCGCGCCCCCGG + Intergenic
901793093 1:11664572-11664594 GCCTCCGCCTGGGTGGCCCCGGG - Intronic
902361250 1:15943727-15943749 CCCCACGCCAGGTTCGCCCTCGG - Intronic
906168904 1:43707583-43707605 GCTCCCGCCGGGGTCCCCCGCGG + Exonic
910569470 1:88684116-88684138 CCCCTCGCCGCGTTCGCCCTAGG + Intergenic
912379715 1:109240754-109240776 GCCCCCGCCGCGTACCCCCTGGG - Intergenic
915246279 1:154558452-154558474 GCCCCCCCCTGGGCCGCCCCCGG + Exonic
922730528 1:227946872-227946894 GCCCCCGACCTGGACGCCCTGGG - Intronic
922753376 1:228081583-228081605 GCCCCCGCAGGTGCAGCCCTGGG + Intergenic
923141478 1:231163781-231163803 GCCTCCGCTGGGGGCGCCCTGGG - Exonic
1064443209 10:15371373-15371395 GCGCCGGGCGGGGGCGCCCTCGG - Intergenic
1064859816 10:19815739-19815761 GACCCTGGCGGGGTCTCCCTGGG - Intergenic
1067300159 10:45000881-45000903 GGCGCCGCCGCGGTCGCTCTAGG - Exonic
1073481290 10:103787632-103787654 GCCTCCGCCAGGGCTGCCCTCGG + Intronic
1073763156 10:106652459-106652481 GCCCCCGCGGGGCTTTCCCTGGG + Exonic
1075802426 10:125161260-125161282 GGCCCCGCCCGGGAGGCCCTCGG + Intergenic
1076554208 10:131311518-131311540 GCCGCCGCCGCCGCCGCCCTGGG - Exonic
1077239664 11:1503904-1503926 ACCCCAGCCGGGTGCGCCCTTGG - Intergenic
1077281447 11:1747990-1748012 GCCCCCGGCAGGTTCGCCCAAGG - Exonic
1080347010 11:31336292-31336314 GCACCCTCCTGGGTCTCCCTGGG - Intronic
1084273522 11:68040866-68040888 GCCACCCCCGGGGCAGCCCTGGG + Intronic
1092217934 12:6695470-6695492 TCCCAGGCCGGGGTCCCCCTCGG + Exonic
1099286218 12:80716810-80716832 GCCCCCGCGGGGGTTGCGGTGGG + Intergenic
1102352478 12:112204312-112204334 GGCCCCACCAGGGTTGCCCTAGG + Intronic
1102962038 12:117099278-117099300 GCCCCCGCCGCGGGCACCATGGG - Exonic
1104362215 12:128144569-128144591 GGCCCTGCCTGGGTAGCCCTGGG - Intergenic
1112570460 13:100588813-100588835 GGCGCCGCCGGGGGCGGCCTGGG - Intronic
1115235839 14:31207811-31207833 GCCGCCGGCGGGGTCGCCGCCGG - Intergenic
1115556143 14:34546462-34546484 GCCCTTGCCGGGGTCGTCCCCGG - Intergenic
1115557765 14:34556619-34556641 GCCCTTGCCGGGGTCGTCCCCGG + Intergenic
1115918293 14:38342350-38342372 GCCCCAGCTGGTGTCTCCCTAGG - Intergenic
1119650166 14:76377441-76377463 ACACCCGCCGGGGGCGCCGTGGG - Intronic
1121226237 14:92323667-92323689 TCCCCCGCCGACCTCGCCCTCGG + Exonic
1122108699 14:99480583-99480605 GCCCCCGCCAGGGTCCCCGCCGG - Intronic
1122901424 14:104783843-104783865 GCCCAGGCCGGGGTTGCACTGGG - Intronic
1125200738 15:37099013-37099035 GCCGCCGCCGGGGCCGCCGCTGG - Intronic
1128877607 15:71215066-71215088 GCCGCCGCCGCCGTCGTCCTCGG - Exonic
1132519823 16:381952-381974 GTCCCCGCCGCCGTCGCCCCGGG + Exonic
1132527750 16:426015-426037 GGCCCCGCCGGCCTCGCCCCCGG + Exonic
1132702675 16:1228797-1228819 GGGCCCTCCGGAGTCGCCCTGGG + Exonic
1132705651 16:1242071-1242093 GGGCCCTCCGGAGTCGCCCTGGG - Exonic
1132709343 16:1259535-1259557 ACCCCCGCCGAGAGCGCCCTGGG + Intergenic
1132976212 16:2712382-2712404 TCACCCGCCGGGGTCCCCCAAGG + Intergenic
1135435724 16:22425546-22425568 GCTCCAGGCGGGGTCACCCTCGG + Intronic
1142044931 16:87919350-87919372 GCTCCAGGCGGGGTCACCCTCGG + Intronic
1143450222 17:7031840-7031862 GCCCCCACTGGGGTAGTCCTTGG - Intergenic
1143513579 17:7408329-7408351 GCCCAGGCCGGGGCCGCCCGGGG - Exonic
1146935079 17:36808249-36808271 GCGCCCTCCGCGGGCGCCCTTGG - Intergenic
1147967025 17:44199286-44199308 TCCCCCGTCTGGGTCCCCCTTGG - Intronic
1148356470 17:46978931-46978953 GGCGGCGCCGGGGCCGCCCTGGG - Exonic
1148582363 17:48752755-48752777 GCCCCCTCCGGGTTCTCCCACGG + Intergenic
1149430819 17:56594474-56594496 GCCCCCGCCGGGCCGGTCCTCGG - Exonic
1151320296 17:73348785-73348807 GCCCCCACTGTGGTCTCCCTAGG - Intronic
1152162121 17:78675357-78675379 GCCCTGGCCGGGGTCGCAGTCGG - Exonic
1152584635 17:81183500-81183522 GCCCCTGCCGGGGGCACCCAGGG - Intergenic
1152714366 17:81891437-81891459 CCCACCGCCGCGGCCGCCCTGGG + Exonic
1153935246 18:9914658-9914680 GCCCGCGCCGCGGTCCGCCTGGG + Intronic
1154202392 18:12308409-12308431 GCCCCGGCGGGGGTCGCGCCGGG - Intronic
1157384126 18:47247704-47247726 GCCCCCGCCTCAGCCGCCCTCGG - Intronic
1158892917 18:61889768-61889790 GCCACCTCCTGGGTGGCCCTAGG + Intronic
1161767706 19:6216344-6216366 GACCCAGCCGGAGTCGCCCCGGG + Intronic
1162021158 19:7869234-7869256 GCCCCCGCCGCTGCCGCCCGCGG + Exonic
1162363117 19:10231260-10231282 GCCCCAGCCGCGGCCGCCCTGGG - Exonic
1163282464 19:16325816-16325838 GCCGCCGCCGCGGCAGCCCTGGG + Exonic
1166524684 19:43503874-43503896 GCCCCCCGCGCTGTCGCCCTCGG + Intronic
1166840224 19:45692718-45692740 GCCGCAGGCGGGGTCGCCCGCGG - Exonic
1167293189 19:48635603-48635625 GCCCCCGCCCGGGCTGCCCTCGG - Exonic
1167376319 19:49114303-49114325 GCCTCCGCAGGGGGCGCCCGTGG + Intronic
1167466173 19:49652018-49652040 GCCCGCCCCGGCCTCGCCCTGGG + Exonic
1168154521 19:54465348-54465370 GCCCCCGCGGGGGGCGCCCGGGG + Exonic
1168694413 19:58396575-58396597 GCCCCCGCCCGGGCCGCGCAAGG + Exonic
1168694490 19:58396842-58396864 GCCCCCGCCGGGGTCGCCCTGGG + Exonic
928767902 2:34670311-34670333 GCCCCAGCCGGTGTCTCTCTGGG - Intergenic
930198381 2:48530374-48530396 GCCGCCCCCAGGGGCGCCCTGGG + Intronic
933791697 2:85888664-85888686 GCCCCAGCCGGGCTCGCCTGAGG + Intronic
934682878 2:96297954-96297976 GACCCCTCAGGGGTAGCCCTTGG - Intronic
935594384 2:104867907-104867929 GCCCCCGCTGAGGTCCCCTTTGG + Intergenic
938397840 2:130963926-130963948 GCCCGGGCCGGGGTCGCAGTCGG - Intronic
942151063 2:173076155-173076177 GCCGCCGCCGGGCGGGCCCTGGG - Intronic
946422021 2:219570660-219570682 GCTCGCGCCGGGGCCGTCCTCGG + Exonic
948256048 2:236568566-236568588 GCCTCCGGAGGGGTCGCCCTGGG - Intronic
1169044420 20:2524644-2524666 GGCCCCGCCGGGGGAGCCCAGGG + Intronic
1169197511 20:3691515-3691537 GCCGCCTCCTGGGTGGCCCTGGG - Exonic
1169356754 20:4913164-4913186 GCCCCTGCTGAGGTTGCCCTGGG - Intronic
1172951309 20:38724918-38724940 GTCCCCGCAGGGCTCTCCCTCGG - Exonic
1175561449 20:59933783-59933805 ACGCTCGCCGGGGTCGCCCGAGG + Exonic
1175847311 20:62065560-62065582 GCCCCCGCCGAGGGCGCGCCCGG - Exonic
1176014989 20:62926374-62926396 GCCGCCGCTTGGGCCGCCCTCGG - Intronic
1176550180 21:8217405-8217427 CCCCCCGCCGGGTCCGCCCCCGG + Intergenic
1176569108 21:8400443-8400465 CCCCCCGCCGGGTCCGCCCCCGG + Intergenic
1176577022 21:8444675-8444697 CCCCCCGCCGGGTCCGCCCCCGG + Intergenic
1180079135 21:45478322-45478344 GTCTTCACCGGGGTCGCCCTGGG - Exonic
1180093225 21:45542913-45542935 GCGCCCTCAGGGGTGGCCCTGGG + Intronic
1181082801 22:20425610-20425632 GGCCGCGCCGAGGTGGCCCTGGG - Exonic
1182735131 22:32527957-32527979 GCCCCAGCTGGGCTTGCCCTGGG + Exonic
1203255075 22_KI270733v1_random:133743-133765 CCCCCCGCCGGGTCCGCCCCCGG + Intergenic
1203263131 22_KI270733v1_random:178822-178844 CCCCCCGCCGGGTCCGCCCCCGG + Intergenic
950487806 3:13283114-13283136 GCCTCCGCCGGCGCCGCCCCCGG + Intergenic
952066509 3:29577401-29577423 GCCCCGGCTGGTGTCTCCCTAGG + Intronic
966449079 3:180037124-180037146 GCACCGCCCGGGGCCGCCCTCGG - Intergenic
967055617 3:185826076-185826098 GCCGCCGCCCGGGAAGCCCTCGG - Intergenic
967694526 3:192515261-192515283 TCCCACACCGGAGTCGCCCTTGG - Intronic
967859599 3:194141289-194141311 GCGCCCGCCGGGGCGGCCCGGGG + Intergenic
968096122 3:195932040-195932062 GCCCCCGCTGGTGTCTCACTAGG - Intergenic
968845782 4:3040942-3040964 GCCCCCGCTGGCCTCTCCCTGGG - Intergenic
972437075 4:39044857-39044879 GCCCCCTCCGGGGCCACCCGGGG + Intergenic
972671138 4:41214725-41214747 CCACCTGCAGGGGTCGCCCTGGG - Intronic
979033151 4:115678439-115678461 GCCCCAGCGCGGGACGCCCTAGG - Intergenic
986631252 5:9775950-9775972 GCCCCAGCTGGTGTCTCCCTAGG + Intergenic
989480477 5:41925220-41925242 GCGCCAGCCGAGGGCGCCCTCGG - Intergenic
992320790 5:75611638-75611660 GACCCCGCCGGGCGCGCCCGGGG + Exonic
998130867 5:139650468-139650490 GCCCCCGCCGGAGCCGCCCCAGG + Intronic
999655144 5:153803855-153803877 CACACCTCCGGGGTCGCCCTTGG + Intronic
1002180039 5:177426645-177426667 GCCAGCGCCGGGGTGGCCCCCGG + Intronic
1002594602 5:180313760-180313782 GCCTCCGCCAGGCTCTCCCTGGG + Intronic
1002925663 6:1604629-1604651 GCCCCAGCCTGGGTCGGCCAAGG + Intergenic
1003175783 6:3751595-3751617 GCCCCGGCCGGGGTCGTCCCGGG + Exonic
1012399997 6:98835070-98835092 GCCCCCGCCGCCGCCGCCGTGGG - Exonic
1013033776 6:106360928-106360950 GGGCTCCCCGGGGTCGCCCTGGG - Intergenic
1013441790 6:110179212-110179234 GCGCCCGCCGCCGTCTCCCTCGG + Intronic
1016728923 6:147407001-147407023 GGCGCCGCCTGGGTCGCCGTGGG - Intergenic
1018050589 6:160005416-160005438 CCTCTCGCCGGTGTCGCCCTTGG + Intronic
1020210502 7:6154667-6154689 GCCCCAGCCACGCTCGCCCTCGG - Exonic
1022923258 7:35037180-35037202 CCGCCCGCCGGGGGCGGCCTTGG - Intronic
1023865948 7:44238556-44238578 GCCCTCCCCGAGGACGCCCTGGG + Intronic
1025635089 7:63314713-63314735 GCCCCCACCATGGTCCCCCTGGG - Intergenic
1025647606 7:63433457-63433479 GCCCCCACCATGGTCCCCCTGGG + Intergenic
1029640630 7:101817026-101817048 GCCCCCGCGGGGGTCCGCCACGG - Intronic
1034159679 7:148983456-148983478 GGCCCCGCCGGGGGCACCGTGGG + Intergenic
1034977735 7:155457977-155457999 GCCGCCGCCTGGGCCGCCCGGGG - Intergenic
1034985290 7:155509621-155509643 GCCCTCCCCGGGGCTGCCCTTGG + Intronic
1035729841 8:1846128-1846150 GCTCCCGCCAGGGTCTCCCGAGG - Intronic
1037769463 8:21789914-21789936 GCCCCGGCCCGGGTCGGTCTCGG - Intronic
1039903082 8:41767011-41767033 GCCGCCGCCGGGGTGCCCCGAGG - Intronic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1045583089 8:103500345-103500367 GCTCCCGCCTGGGTGCCCCTCGG + Intergenic
1047732288 8:127737376-127737398 TCCCCTGCCGCGGCCGCCCTCGG + Intronic
1049213170 8:141395941-141395963 TCCCCAGCCAGGGTGGCCCTTGG - Intronic
1051306657 9:15717483-15717505 GCCCCCGCTGGTGTCTCACTAGG - Intronic
1053240114 9:36487943-36487965 GCCCCAGCCTGGGTCGCGCGAGG - Intergenic
1054765032 9:69036024-69036046 GCGCACGCCGGGGTCGCTCCGGG + Intronic
1055757708 9:79572992-79573014 CCCCCCGGCGCGGTGGCCCTCGG + Intronic
1055886542 9:81069902-81069924 GCCCCAGCTGGTGTCTCCCTAGG + Intergenic
1060661904 9:125409362-125409384 GCCCCCTCCAGGGGCTCCCTGGG - Intergenic
1061029001 9:128068411-128068433 GCCGCCGCAGGGGTCCCCCACGG - Exonic
1061415386 9:130444701-130444723 GCCCCCGCCGGCGCGCCCCTGGG + Intergenic
1061812822 9:133172305-133172327 GACTCCGCCAGGGTCTCCCTTGG - Intergenic
1061975942 9:134068099-134068121 GCCCGCGCCGGGGCCGCCCAGGG + Intronic
1062733325 9:138121079-138121101 GCTCCTGCCTGGGTCACCCTGGG + Intronic
1203471473 Un_GL000220v1:116880-116902 CCCCCCGCCGGGTCCGCCCCCGG + Intergenic
1203479294 Un_GL000220v1:160852-160874 CCCCCCGCCGGGTCCGCCCCCGG + Intergenic
1186949614 X:14609122-14609144 GCCCCTGCCAGGGTCGCACTGGG + Exonic
1187974803 X:24694110-24694132 GCCCCCGCCGGGGACGACCAAGG - Intronic
1198267351 X:135022037-135022059 GCCGCCGCCAGGGTCGCCACCGG - Exonic
1198268538 X:135032784-135032806 GCCGCCGCCAGGGTCGCCACCGG + Exonic