ID: 1168694737

View in Genome Browser
Species Human (GRCh38)
Location 19:58397798-58397820
Sequence CTGTACACCTGGTTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168694729_1168694737 -3 Left 1168694729 19:58397778-58397800 CCGGGTGTAGAGTTGCCATCCTG No data
Right 1168694737 19:58397798-58397820 CTGTACACCTGGTTGGGGCTGGG No data
1168694728_1168694737 -2 Left 1168694728 19:58397777-58397799 CCCGGGTGTAGAGTTGCCATCCT No data
Right 1168694737 19:58397798-58397820 CTGTACACCTGGTTGGGGCTGGG No data
1168694723_1168694737 30 Left 1168694723 19:58397745-58397767 CCTGGGTGGGCTCCAGCTGTCTA No data
Right 1168694737 19:58397798-58397820 CTGTACACCTGGTTGGGGCTGGG No data
1168694725_1168694737 18 Left 1168694725 19:58397757-58397779 CCAGCTGTCTACATGCTGGTCCC No data
Right 1168694737 19:58397798-58397820 CTGTACACCTGGTTGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168694737 Original CRISPR CTGTACACCTGGTTGGGGCT GGG Intergenic
No off target data available for this crispr