ID: 1168698424

View in Genome Browser
Species Human (GRCh38)
Location 19:58419762-58419784
Sequence GTGTCTCTCTTGAGCCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168698424_1168698429 12 Left 1168698424 19:58419762-58419784 CCTCTGGGGCTCAAGAGAGACAC No data
Right 1168698429 19:58419797-58419819 AAGTATGGATCCAGATCTTGCGG No data
1168698424_1168698431 20 Left 1168698424 19:58419762-58419784 CCTCTGGGGCTCAAGAGAGACAC No data
Right 1168698431 19:58419805-58419827 ATCCAGATCTTGCGGTTTATGGG No data
1168698424_1168698427 -3 Left 1168698424 19:58419762-58419784 CCTCTGGGGCTCAAGAGAGACAC No data
Right 1168698427 19:58419782-58419804 CACGTAGGGTAACCAAAGTATGG No data
1168698424_1168698430 19 Left 1168698424 19:58419762-58419784 CCTCTGGGGCTCAAGAGAGACAC No data
Right 1168698430 19:58419804-58419826 GATCCAGATCTTGCGGTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168698424 Original CRISPR GTGTCTCTCTTGAGCCCCAG AGG (reversed) Intergenic
No off target data available for this crispr