ID: 1168698427

View in Genome Browser
Species Human (GRCh38)
Location 19:58419782-58419804
Sequence CACGTAGGGTAACCAAAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168698424_1168698427 -3 Left 1168698424 19:58419762-58419784 CCTCTGGGGCTCAAGAGAGACAC No data
Right 1168698427 19:58419782-58419804 CACGTAGGGTAACCAAAGTATGG No data
1168698423_1168698427 -2 Left 1168698423 19:58419761-58419783 CCCTCTGGGGCTCAAGAGAGACA No data
Right 1168698427 19:58419782-58419804 CACGTAGGGTAACCAAAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168698427 Original CRISPR CACGTAGGGTAACCAAAGTA TGG Intergenic
No off target data available for this crispr