ID: 1168703815

View in Genome Browser
Species Human (GRCh38)
Location 19:58456773-58456795
Sequence CAGTGTTACCTCTTTGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 191}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168703815_1168703817 -8 Left 1168703815 19:58456773-58456795 CCATCCTCAAAGAGGTAACACTG 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1168703817 19:58456788-58456810 TAACACTGCAGAAACATCAGAGG 0: 1
1: 0
2: 1
3: 19
4: 216
1168703815_1168703818 -7 Left 1168703815 19:58456773-58456795 CCATCCTCAAAGAGGTAACACTG 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1168703818 19:58456789-58456811 AACACTGCAGAAACATCAGAGGG 0: 1
1: 0
2: 0
3: 30
4: 279
1168703815_1168703819 -4 Left 1168703815 19:58456773-58456795 CCATCCTCAAAGAGGTAACACTG 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1168703819 19:58456792-58456814 ACTGCAGAAACATCAGAGGGAGG 0: 1
1: 1
2: 2
3: 17
4: 210
1168703815_1168703822 20 Left 1168703815 19:58456773-58456795 CCATCCTCAAAGAGGTAACACTG 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1168703822 19:58456816-58456838 CATGTCAGCTGGAACTCTGGTGG 0: 1
1: 0
2: 1
3: 18
4: 194
1168703815_1168703821 17 Left 1168703815 19:58456773-58456795 CCATCCTCAAAGAGGTAACACTG 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1168703821 19:58456813-58456835 GGACATGTCAGCTGGAACTCTGG 0: 1
1: 0
2: 0
3: 15
4: 140
1168703815_1168703820 9 Left 1168703815 19:58456773-58456795 CCATCCTCAAAGAGGTAACACTG 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1168703820 19:58456805-58456827 CAGAGGGAGGACATGTCAGCTGG 0: 1
1: 0
2: 0
3: 31
4: 263
1168703815_1168703825 28 Left 1168703815 19:58456773-58456795 CCATCCTCAAAGAGGTAACACTG 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1168703825 19:58456824-58456846 CTGGAACTCTGGTGGGGCTGAGG 0: 1
1: 0
2: 1
3: 36
4: 421
1168703815_1168703823 21 Left 1168703815 19:58456773-58456795 CCATCCTCAAAGAGGTAACACTG 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1168703823 19:58456817-58456839 ATGTCAGCTGGAACTCTGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 177
1168703815_1168703824 22 Left 1168703815 19:58456773-58456795 CCATCCTCAAAGAGGTAACACTG 0: 1
1: 0
2: 1
3: 15
4: 191
Right 1168703824 19:58456818-58456840 TGTCAGCTGGAACTCTGGTGGGG 0: 1
1: 1
2: 2
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168703815 Original CRISPR CAGTGTTACCTCTTTGAGGA TGG (reversed) Exonic
900910395 1:5593351-5593373 CAGGGTTTGCTCTTTAAGGAGGG + Intergenic
903449656 1:23444255-23444277 CTGTTTTCCCTCTTTGGGGATGG + Intronic
907929111 1:58982537-58982559 AAGTGTCACCTCTTCCAGGAAGG - Intergenic
909701169 1:78525139-78525161 CCTTGTTACATCTTTGAGCATGG - Intronic
910135544 1:83964442-83964464 CAGTGTTTACTCTGTGAGAAGGG - Intronic
910455662 1:87394990-87395012 AAATGTTACCTTTTTGAGGATGG - Intergenic
910463357 1:87471162-87471184 CTGTGTTACCACTTGGAGAAGGG + Intergenic
910506382 1:87954132-87954154 CAGTGTTAGGTTTTTGAGGGTGG + Intergenic
911648936 1:100365253-100365275 GAGTGTCTCCTCTTTGAGGAAGG - Intronic
911753522 1:101526127-101526149 CTGTGCTACCTCATTGAAGAGGG + Intergenic
912172073 1:107112904-107112926 AAGTGTTGCCTCTTTCACGATGG + Intergenic
912600352 1:110925264-110925286 CAGAATTCCCTCTTTGAGGAAGG - Intergenic
913145956 1:115990172-115990194 CTGTGTTGCGTCTTGGAGGATGG + Intronic
914460343 1:147877993-147878015 CAGTGTTACTGCTTAGGGGATGG + Intergenic
915625812 1:157113485-157113507 CAGTCTGTCGTCTTTGAGGAAGG - Intergenic
918015337 1:180628219-180628241 CAGTGTGAGGTCTTTGAAGAAGG - Intergenic
919743732 1:200995633-200995655 CAGTGCTACCTCTTGGAAGCTGG + Intronic
922438950 1:225635585-225635607 CTGAGTTTCCTCTTTGAGTATGG - Intronic
922755729 1:228095864-228095886 TAGTGTTCCCTTTTTGGGGACGG - Intronic
1063178009 10:3569827-3569849 CTGTGTTACATGTTTGAGAATGG - Intergenic
1063178038 10:3570004-3570026 CTGTGTTACATGTTTGAGAATGG - Intergenic
1063178069 10:3570181-3570203 CTGTGTTACATGTTTGAGAATGG - Intergenic
1064818389 10:19293739-19293761 CACTGTGACCTATTTGAGGGTGG + Intronic
1065857064 10:29839320-29839342 AAATGTCAACTCTTTGAGGAAGG - Intergenic
1066202022 10:33150952-33150974 CAGGGTTACTTCTCAGAGGATGG - Intergenic
1067714390 10:48678085-48678107 CAGAGTCTCCACTTTGAGGAAGG - Intergenic
1067961928 10:50864072-50864094 CACTGTTATCTAGTTGAGGATGG + Exonic
1068548657 10:58381858-58381880 CAGTGTCAGCTCTTTGGGGCAGG + Intergenic
1070155235 10:73829762-73829784 AAGTGTTACTGCTTTCAGGAAGG + Intronic
1070950494 10:80427262-80427284 GAGCGTTTCCTCCTTGAGGAAGG + Intronic
1072672893 10:97444227-97444249 CAGAGTTTTCTCTTTGAGCATGG + Intronic
1072831856 10:98666357-98666379 CAGTGTTAGATCATTGAGGCAGG + Intronic
1075121777 10:119669778-119669800 CAGTGTTTCCTCTGCCAGGAGGG + Intronic
1075826721 10:125363305-125363327 CAGTATTTCCTCTTTCTGGAAGG + Intergenic
1076325392 10:129616618-129616640 TAGTGTTACCTGGTTAAGGAGGG - Intronic
1078547756 11:12258292-12258314 CAGTGCCACTTCTTTAAGGAAGG + Intronic
1079519739 11:21312551-21312573 CATTCTTACATCTTTGAGGGAGG + Intronic
1081047831 11:38297806-38297828 CAGTGTTAGCACTTTGAGCAGGG + Intergenic
1081198006 11:40185098-40185120 CAGTGTGAACACTTTTAGGAGGG + Intronic
1083112079 11:60420647-60420669 CACTGTTACCTGGTTGAAGATGG - Intergenic
1088812830 11:113403072-113403094 AAGAGTTATCTCTTAGAGGAAGG - Intergenic
1089316536 11:117594922-117594944 CATTGTTACCTCTGTCAAGAAGG + Intronic
1090807501 11:130211570-130211592 GTGTTTTACCTCTTTGAGGGAGG + Intergenic
1096654777 12:53081970-53081992 CAGTAAATCCTCTTTGAGGAGGG + Intergenic
1097364542 12:58696741-58696763 CACTGGCACCTATTTGAGGATGG + Intronic
1097827953 12:64193896-64193918 AAGTGAGACCTCATTGAGGAAGG + Exonic
1099603140 12:84767226-84767248 CTGTGTTATCTCTTTGATGGTGG + Intergenic
1101264814 12:103073161-103073183 CAGTGGGACCTATTGGAGGATGG + Intergenic
1101866407 12:108523630-108523652 CAGTGTTTGCTCTTTTAGGAGGG - Exonic
1102332504 12:112046303-112046325 CAGTGTTTCCCCTCAGAGGAGGG + Intronic
1104752747 12:131250455-131250477 CAGTCTTAGCCCTTTGAGCATGG + Intergenic
1107015827 13:35706946-35706968 CAGTGTTGCCTCTCTGAAGCAGG - Intergenic
1111356979 13:87119338-87119360 AATTGTTACCTCTTTGAGATTGG - Intergenic
1117985754 14:61384646-61384668 CACTGATGGCTCTTTGAGGAAGG + Intronic
1118632495 14:67718514-67718536 CAGTGTTAGCCCTGGGAGGATGG + Intronic
1120129432 14:80787566-80787588 TAGTGTGACTTCTTTGGGGAGGG + Intronic
1122119336 14:99543544-99543566 GAGTGTCACCTCCTTCAGGAAGG - Intronic
1122334109 14:100956553-100956575 CAGTGTTTCCTCTTTGACTAAGG + Intergenic
1122444354 14:101758431-101758453 GAGGGTTACCTCTTCCAGGATGG - Intergenic
1123709281 15:22974989-22975011 CACTGTGAGCTTTTTGAGGATGG + Intronic
1123947177 15:25244435-25244457 CAGTGGTACCTCCTTGAGCCTGG + Intergenic
1123947994 15:25248167-25248189 CAGTGGTACCTCCTTGAGCCTGG + Intergenic
1124788217 15:32701634-32701656 CAGTGTTCCCTCTCTGACCATGG + Intergenic
1125391650 15:39199154-39199176 GAGTGTTACGTCTTTGTTGAGGG - Intergenic
1126389837 15:48135448-48135470 CATTGTTATTTCTTAGAGGAAGG - Exonic
1126947371 15:53836858-53836880 CAGTTTTAACCCTATGAGGATGG + Intergenic
1130190273 15:81728070-81728092 CCATATTACCTCTTTGCGGAGGG - Intergenic
1130326228 15:82882402-82882424 GACTGTGAGCTCTTTGAGGATGG - Intronic
1131057523 15:89384436-89384458 CAGTGTTTCCTGCTTGAGGCTGG + Intergenic
1131152880 15:90057974-90057996 TACTGTGACCTCTTAGAGGAGGG + Intronic
1131351182 15:91701393-91701415 CAGTGTTACCCCCTGAAGGAAGG + Intergenic
1131708116 15:95020696-95020718 CTGTGCTTCCTCTATGAGGATGG - Intergenic
1132195446 15:99911264-99911286 CAGTGTTACTGCTTTGTGAAAGG - Intergenic
1133503942 16:6391812-6391834 CAGTGTGAGCTCTTCGAGGATGG - Intronic
1134636861 16:15799253-15799275 CATTCTTACCTCTTTGTTGAAGG - Intronic
1135851442 16:25967568-25967590 CAGTCTTATTTCTTAGAGGAAGG + Intronic
1136344607 16:29666705-29666727 CACTGGTTCCTCTTGGAGGATGG - Exonic
1137622127 16:49883060-49883082 CAAGGTTACCTCTATGAGGATGG + Intergenic
1140126403 16:72122391-72122413 GAGTGTTACCAGTTTGAGAATGG - Intronic
1142812644 17:2402277-2402299 GAGAGTTAGCTCTTTGAGGCCGG + Intergenic
1148317335 17:46713854-46713876 CAGTCTTCCCACTGTGAGGAGGG - Exonic
1148902301 17:50887569-50887591 CACTGAAACCTCTTTGAGGGAGG + Intergenic
1148967099 17:51445289-51445311 CACTGGGACCTCTTTGAGGGTGG + Intergenic
1152995526 18:402811-402833 CTGAGTTACCACTTTGGGGAAGG + Intronic
1153745163 18:8171207-8171229 CAGTGTTTACTGTCTGAGGAAGG + Intronic
1155861788 18:30910678-30910700 CACTGGGACCTCTTTGAGGGTGG + Intergenic
1157530069 18:48412662-48412684 CAGTGCTACCTTTTCCAGGAAGG - Intergenic
1157741304 18:50095891-50095913 AAGTGTTACATCTTTGGAGAGGG + Intronic
1157889100 18:51397439-51397461 CATTGTTAATTATTTGAGGATGG + Intergenic
1159443010 18:68506147-68506169 CCATGTTTCCTCTTTTAGGAAGG - Intergenic
1159666946 18:71173209-71173231 GAATGTTAGCTCCTTGAGGATGG - Intergenic
1160097634 18:75889914-75889936 CCGTGTTACCTCCTCCAGGATGG + Intergenic
1164393708 19:27846253-27846275 CAGTGCTAGGTCTTTCAGGAAGG + Intergenic
1166816616 19:45550251-45550273 CAGTTTTACCTCTTTAGAGAAGG + Intronic
1167189205 19:47972211-47972233 AAGTCTTACCTCATTGAGGTTGG + Intronic
1168573135 19:57487136-57487158 CAATGTTGGGTCTTTGAGGAAGG + Intergenic
1168703815 19:58456773-58456795 CAGTGTTACCTCTTTGAGGATGG - Exonic
1168706331 19:58472339-58472361 CAGTGCTACCTCTTTGGGGATGG - Exonic
925190468 2:1878244-1878266 CAGTGTTACCATTTTCAGAATGG - Intronic
927252650 2:21011738-21011760 CAGTGATAGCTCTGTGAGGGCGG + Exonic
928919838 2:36515084-36515106 CTGTGTTGACTCTTTGGGGAGGG + Intronic
931417246 2:62092744-62092766 CAGTATTTCCCCTTTGAGTAAGG + Intronic
931860915 2:66353539-66353561 CAGTGTGAATTCTTGGAGGATGG - Intergenic
932966635 2:76483243-76483265 GAGTGTTAGCCTTTTGAGGATGG - Intergenic
934016688 2:87893877-87893899 CAGTGTTACTGGTTTGAAGATGG + Intergenic
935666792 2:105519103-105519125 AAGTGTGACCTCTCTGGGGAAGG + Intergenic
936019211 2:108982003-108982025 GACTGTGCCCTCTTTGAGGACGG - Intronic
938258721 2:129880376-129880398 CCGTGTTGCCTCCTTGAGCAGGG - Intergenic
941777942 2:169413217-169413239 GACTGTTACCCCTTTAAGGAGGG + Intergenic
942455428 2:176135310-176135332 TGGTGTTACCTCTTTCAGGAAGG + Intergenic
1168865173 20:1080089-1080111 CAGAGTTACCCCCTTGAGAAGGG - Intergenic
1169527573 20:6446810-6446832 TAGGGTTACCTGATTGAGGAGGG - Intergenic
1170091995 20:12599355-12599377 CAGTGTTTGCTCTTTGCTGAAGG + Intergenic
1170476685 20:16721877-16721899 CACAGTTACCTATTTTAGGAGGG - Intergenic
1175923296 20:62459824-62459846 CAGAGTGACCTGTTTGACGATGG + Intergenic
1177357383 21:20026897-20026919 CAAGTTTACCTCTGTGAGGAAGG - Intergenic
1181961074 22:26622205-26622227 CAGAGCTACCTCTTTGAGCTAGG + Intronic
1182045287 22:27269363-27269385 CACTGGTACCTCTTTAGGGAGGG - Intergenic
1183144488 22:35977040-35977062 CAGTCATATCTCTTTGATGATGG - Intronic
1183325226 22:37187874-37187896 CACTGGGACCTCTTTGGGGAGGG + Intronic
1183459653 22:37942116-37942138 CAGAGATCCCTCTTGGAGGATGG - Exonic
1184129735 22:42510711-42510733 CCGCCTTACCTCTTTGAGGGTGG - Exonic
1184139889 22:42572516-42572538 CCGTCTTACCTCTTTGAGGGTGG - Exonic
1185259090 22:49851814-49851836 CAGTGTTACTTCCTAGAGCATGG + Intergenic
949562410 3:5214743-5214765 CAGTGTCTTCTCTTTTAGGAAGG + Intronic
950156319 3:10724089-10724111 CAGTGTTACCTGTGTGATGTTGG - Intergenic
951248001 3:20363639-20363661 CAGTGTCACCTCCTTTATGAAGG + Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955313619 3:57915648-57915670 CAGTTTTACATCTTTCAGAATGG - Intronic
956200561 3:66701321-66701343 CTGGGTTACCTCTTTGCAGATGG + Intergenic
957031491 3:75247269-75247291 CAGTGTTACGTGTTTCAAGATGG - Intergenic
957615962 3:82527880-82527902 CAGGCTTACCTCTTTCAGGAAGG - Intergenic
959911674 3:111770714-111770736 CAGTTCTACCTCTGTGAGGTGGG - Intronic
960128422 3:114026215-114026237 CACTGTCACCTCTGTGAGAATGG + Intronic
964904494 3:161702614-161702636 CAGTTTTACCTCATTCAGCATGG - Intergenic
967652996 3:192009380-192009402 CAGTGATTCCTGATTGAGGAGGG + Intergenic
967981575 3:195069116-195069138 CAGGATCGCCTCTTTGAGGAAGG - Exonic
968666538 4:1825431-1825453 CACTGTGACCTCTCTGGGGACGG - Intronic
969472269 4:7395929-7395951 CAGTGGTCCCTATGTGAGGATGG - Intronic
969539358 4:7777179-7777201 TAGTGTTGTTTCTTTGAGGAGGG - Intronic
970555181 4:17224734-17224756 CACTGGGACCTCTTTGAGGGTGG - Intergenic
973862556 4:55079607-55079629 TACTGCTACTTCTTTGAGGATGG + Exonic
975713081 4:77179822-77179844 CAGTTTCATCTCTTGGAGGATGG + Intronic
976847364 4:89505163-89505185 CATTGTGACCTCTTTTAGGTTGG + Intergenic
977355104 4:95936150-95936172 CAGTGTTTCAATTTTGAGGAGGG - Intergenic
978318399 4:107465586-107465608 CAGTGTTAATTCATTGAGGATGG - Intergenic
979304942 4:119131700-119131722 CAGTGCTAACTCTGGGAGGAAGG - Intergenic
979905818 4:126290411-126290433 GAGTGTTACCTCTTTCTTGATGG + Intergenic
981270705 4:142845508-142845530 CAGCGAGACCTCTTTGGGGAAGG + Intronic
981282420 4:142973630-142973652 CAGTGTTTTCTCTCTGAAGATGG + Intergenic
982221751 4:153130493-153130515 CAGTGGTTCCTTTTTGGGGAAGG - Intergenic
982720257 4:158852259-158852281 CAGTGTCATCTCTTCCAGGAAGG - Intronic
990324741 5:54663508-54663530 CACTGGTACCACTTTGAAGAGGG + Intergenic
990376461 5:55175827-55175849 AAATGTTTCCTCTTTGAGAATGG + Intergenic
991564696 5:67992570-67992592 AAGTGGTACCTCTTTGACCATGG - Intergenic
994408876 5:99381358-99381380 CAGGGTTTTCTCTTTCAGGAAGG + Intergenic
995168884 5:109082611-109082633 GAGTTTTACCTCTTAGAGAAAGG + Intronic
995221425 5:109652999-109653021 CACTGTTAACTATGTGAGGAGGG + Intergenic
995864634 5:116678086-116678108 TAGTGCTACCTCTTTGTGGGGGG + Intergenic
996358998 5:122624962-122624984 CATTGCTACCACTGTGAGGAAGG - Intergenic
997439799 5:133901166-133901188 ATGTGTTTCCTCTTTGAGGATGG + Intergenic
998879479 5:146631909-146631931 CACTCTTACCTCCTGGAGGAAGG + Intronic
1001258149 5:170201062-170201084 CAGTGTCACCTCTCCAAGGAAGG - Intergenic
1001301424 5:170536534-170536556 CTTTGTTTCCTCTTTGGGGAGGG - Intronic
1007146758 6:39642486-39642508 GAGTGGCAGCTCTTTGAGGATGG - Intronic
1007997681 6:46325916-46325938 CAGAGTTTCTTCTTTGAGGTGGG + Intronic
1008087193 6:47257619-47257641 GATAGTTACCTCTTTGGGGAGGG + Intronic
1010658898 6:78545611-78545633 CAGAGTTCCTTCTTTAAGGAGGG - Intergenic
1011191450 6:84733866-84733888 CAGTGTAACCTATATAAGGAAGG - Exonic
1012277732 6:97294236-97294258 CACTTTTACTTCTTGGAGGATGG + Intergenic
1012989274 6:105908373-105908395 CAGTTTTAATTATTTGAGGAAGG - Intergenic
1013822144 6:114167298-114167320 CAGTGTTCCTGTTTTGAGGATGG + Intronic
1013893824 6:115060419-115060441 CAGTGAAACCTCTTTAATGAAGG - Intergenic
1016339845 6:143050797-143050819 CATTTTATCCTCTTTGAGGATGG - Intergenic
1018055675 6:160050291-160050313 TGTTGTTAACTCTTTGAGGATGG + Intronic
1018575386 6:165254667-165254689 CAGTGGTACAGCCTTGAGGAGGG + Intergenic
1023740821 7:43279066-43279088 CAGTGTTATTTCTTTGAGCTGGG + Intronic
1027879896 7:83821469-83821491 AGGTGTTTCCTCTTTGAAGAGGG - Intergenic
1028243595 7:88449862-88449884 CAGAGTTAACTCTTTCAGAAAGG - Intergenic
1028752930 7:94402319-94402341 TATTGTTAACTCCTTGAGGAAGG - Intronic
1028846337 7:95484380-95484402 TATTGTTATCTCTTTGAGGCAGG + Intronic
1030802950 7:113876327-113876349 CAGTGTTACATGTTTTATGAAGG + Intergenic
1031682521 7:124692074-124692096 CAGTGTAACCTCAATGAGGCAGG - Intergenic
1032120999 7:129156445-129156467 AAGCTCTACCTCTTTGAGGATGG + Intronic
1034521617 7:151625055-151625077 CATTGTAAGCTCTGTGAGGATGG - Intronic
1034541671 7:151762486-151762508 CAGTGTCAGTTCTGTGAGGATGG + Intronic
1036244148 8:7102304-7102326 CAGTGTTACCTCTGAGAAGCAGG - Intergenic
1037999764 8:23381712-23381734 CAGTGTTTCCTCCCTGAGGTTGG - Intronic
1038739201 8:30202016-30202038 CATTCTTAGCTTTTTGAGGATGG - Intergenic
1042768601 8:72354447-72354469 TAATGCTTCCTCTTTGAGGAGGG + Intergenic
1047532383 8:125688643-125688665 CAGTGGGACTTCTCTGAGGAAGG + Intergenic
1047580415 8:126208262-126208284 CACTGGGACCTATTTGAGGATGG - Intergenic
1048276529 8:133070212-133070234 CAGTGTGACATCTCTGAGGACGG + Intronic
1050552984 9:6763630-6763652 CAGTGTTACCATTGTGAAGAGGG + Intronic
1050828077 9:9974721-9974743 GACTGTGAGCTCTTTGAGGATGG + Intronic
1055804130 9:80074259-80074281 GACTGTGAGCTCTTTGAGGAGGG - Intergenic
1058143950 9:101389468-101389490 CAGGGTTACTCCTTTGAAGAGGG - Exonic
1059517456 9:114908972-114908994 CAGTGTTAGCTCTTAGCTGAGGG - Intronic
1186740286 X:12509984-12510006 CAGTGTTAGCTCTGTGATGGTGG + Intronic
1189498085 X:41528020-41528042 CAGGGTTACCTCTTCTAGGGTGG + Intronic
1192845053 X:74898053-74898075 ATGTGTCACCTCCTTGAGGATGG - Intronic
1197851214 X:130862382-130862404 CAGTGTAACCTCATTGAGAAGGG - Intronic
1198252484 X:134893569-134893591 CAGTGTTAGCTCTAGGAGGGTGG - Intronic
1198375535 X:136035339-136035361 CATGGTTACCCCTTTGTGGAGGG - Intronic
1199127798 X:144144663-144144685 CAGTGTTACTGGTTTGAAGATGG - Intergenic
1199289148 X:146086934-146086956 AATTGTTACCCCTTTGAGAATGG + Intergenic
1199791118 X:151156043-151156065 TAGAGTTTCCTCTTTCAGGATGG - Intergenic
1201495451 Y:14588018-14588040 CAGTGTTTACTACTTGAGGATGG + Intronic