ID: 1168704064

View in Genome Browser
Species Human (GRCh38)
Location 19:58458288-58458310
Sequence CTGTAATCCCAGCTACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1168704064_1168704072 25 Left 1168704064 19:58458288-58458310 CCCTCCAGTAGCTGGGATTACAG No data
Right 1168704072 19:58458336-58458358 TTTTGTATTTTTAGTAGAGACGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
1168704064_1168704074 27 Left 1168704064 19:58458288-58458310 CCCTCCAGTAGCTGGGATTACAG No data
Right 1168704074 19:58458338-58458360 TTGTATTTTTAGTAGAGACGGGG 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801
1168704064_1168704073 26 Left 1168704064 19:58458288-58458310 CCCTCCAGTAGCTGGGATTACAG No data
Right 1168704073 19:58458337-58458359 TTTGTATTTTTAGTAGAGACGGG 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
1168704064_1168704068 -3 Left 1168704064 19:58458288-58458310 CCCTCCAGTAGCTGGGATTACAG No data
Right 1168704068 19:58458308-58458330 CAGGCTTGCACCACCATACCTGG 0: 11
1: 671
2: 11798
3: 35630
4: 101493

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1168704064 Original CRISPR CTGTAATCCCAGCTACTGGA GGG (reversed) Intergenic
No off target data available for this crispr